Terpenoid cyclase mutants capable of changing catalytic products and application of terpenoid cyclase mutants

Abstract

The invention belongs to the field of enzyme engineering, and particularly relates to terpene cyclase mutants capable of changing catalytic products and application. According to the specific technical scheme, the terpenoid cyclase mutant is characterized in that 64 amino acids are truncated at the N end of wild type terpenoid cyclase BcABA3, then the truncated terpenoid cyclase BcABA3 is mutated, and the amino acid sequence of the wild type terpenoid cyclase BcABA3 is as shown in SEQ ID NO: 1. The invention provides a method for improving terpenoid cyclase and controlling product distribution condition, which specifically comprises the following steps: truncating wild type terpenoid cyclase, and then carrying out specific point mutation. Based on the method, four new terpenoid cyclases are further provided, and compared with wild type terpenoid cyclases, when the new terpenoid cyclases catalyze farnesyl pyrophosphate, farnesene can be prepared in a targeted mode, and the distribution condition of farnesene or ionylideneane in a product can be controlled.

Description

Technical Field

[0001] The present invention belongs to the field of enzyme engineering, and particularly relates to a class of terpene cyclase mutants that can change the catalytic products and their applications. Background Art

[0002] According to the prior research of the inventor's research group and the disclosure of the related patent 201810678989.X, terpene cyclase can use farnesyl pyrophosphate as a substrate to catalytically synthesize the precursor of abscisic acid: zingiberene, thereby improving the efficiency of artificial synthesis of abscisic acid and reducing the preparation cost.

[0003]

[0004] In addition to synthesizing zingiberene, this reaction also produces by-products farnesene (including α-farnesene and β-farnesene). α-Farnesene, also known as farnesene, is a colorless to light yellow liquid, which has insecticidal activity and also has the aroma of grass, flower and balsam, and can be used in daily chemical flavors, perfumes, spices, etc.

[0005] Therefore, if a new class of terpene cyclases can be provided to control the direction of the catalytic products of farnesyl pyrophosphate, and control the distribution and yield of the products, it will have broad application prospects. Summary of the Invention

[0006] The object of the present invention is to provide a class of terpene cyclase mutants that can change the catalytic products and their applications.

[0007] To achieve the above object of the invention, the technical solution adopted by the present invention is: a class of terpene cyclase mutants, wherein the terpene cyclase mutants are obtained by truncating 64 amino acids at the N-terminus of the wild-type terpene cyclase BcABA3, and then mutating the truncated terpene cyclase BcABA3. The amino acid sequence of the wild-type terpene cyclase BcABA3 is as shown in SEQ ID NO: 1.

[0008] Preferably, the amino acid sequence of the terpene cyclase mutant is as shown in SEQ ID NO: 3.

[0009] Preferably, the amino acid sequence of the terpene cyclase mutant is as shown in SEQ ID NO: 4.

[0010] Preferably, the amino acid sequence of the terpene cyclase mutant is as shown in SEQ ID NO: 5.

[0011] Preferably, the amino acid sequence of the terpene cyclase mutant is as shown in SEQ ID NO: 6.

[0012] Correspondingly, a method for changing the product catalyzed by terpene cyclase BcABA3. The terpene cyclase mutant is obtained by truncating 64 amino acids from the N-terminus of the wild-type terpene cyclase BcABA3 and then mutating the truncated terpene cyclase BcABA3. The amino acid sequence of the wild-type terpene cyclase BcABA3 is shown in SEQ ID NO: 1. The catalysis refers to using the terpene cyclase to catalyze the reaction of farnesyl pyrophosphate.

[0013] Preferably, 64 amino acids are truncated from the N-terminus of the terpene cyclase BcABA3, and the glutamic acid at the 24th position of the truncated terpene cyclase BcABA3 is mutated to alanine, or the threonine at the 107th position of the truncated terpene cyclase BcABA3 is mutated to alanine or cysteine or serine.

[0014] Correspondingly, a method for synthesizing α-farnesene uses farnesyl pyrophosphate as a substrate and utilizes terpene cyclase BcABA3 to catalyze the synthesis of α-farnesene; the amino acid sequence of the terpene cyclase BcABA3 is shown in SEQ ID NO: 3.

[0015] The present invention has the following beneficial effects: The present invention provides a method for improving terpene cyclase and controlling the product distribution, specifically by truncating the wild-type terpene cyclase and then performing specific point mutations. Based on this method, 4 new terpene cyclases are further provided. Compared with the wild-type terpene cyclase, when the new terpene cyclases catalyze farnesyl pyrophosphate, they can specifically prepare farnesene and control the distribution of farnesene or methyl chavicol in the products. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 Schematic diagram of polyacrylamide gel electrophoresis of truncated terpene cyclase and each mutant enzyme;

[0017] Figure 2 Schematic diagram of the product catalyzed by the wild-type terpene cyclase BcABA3;

[0018] Figure 3 Schematic diagram of the product catalyzed by the truncated terpene cyclase BcABA3;

[0019] Figure 4 Schematic diagram of the product catalyzed by the mutant A of terpene cyclase BcABA3;

[0020] Figure 5 Schematic diagram of the product catalyzed by the mutant B1 of terpene cyclase BcABA3;

[0021] Figure 6 Schematic diagram of the product catalyzed by the mutant B2 of terpene cyclase BcABA3;

[0022] Figure 7 Schematic diagram of the product catalyzed by the terpene cyclase BcABA3 mutant B3 Specific implementation mode

[0023] The present invention provides a new class of terpene cyclase BcABA3 mutants. The amino acid sequence of the wild-type terpene cyclase BcABA3 is shown in SEQ ID NO: 1. The method for obtaining the terpene cyclase mutant is as follows: first, truncate the N-terminus on the basis of the wild-type terpene cyclase BcABA3, and then mutate specific amino acids. The truncation method is: truncate 64 amino acids at the N-terminus of the wild-type terpene cyclase BcABA3. The amino acid sequence of the truncated terpene cyclase BcABA3 obtained after truncation is shown in SEQ ID NO: 2.

[0024] The preferred scheme is: mutate the glutamic acid at the 24th position of the truncated terpene cyclase BcABA3 to alanine, and its amino acid sequence is shown in SEQ ID NO: 3, named mutant BcABA3-A; mutate the threonine at the 107th position of the truncated terpene cyclase BcABA3 to alanine or cysteine or serine, and its amino acid sequences are shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6 respectively, named mutant BcABA3-B1, BcABA3-B2, and BcABA3-B3 respectively.

[0025] The terpene cyclase BcABA3 mutants provided by the present invention can change the composition of the products formed by the terpene cyclase catalyzing farnesyl pyrophosphate (FPP), increase the yield of by-products, and convert the by-product farnesene into the main product or even the only product.

[0026] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. If not specifically specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The data obtained are all the averages obtained after at least 3 repetitions, and all the repetitions obtained are valid data.

[0027] Example 1: Preparation of the terpene cyclase BcABA3 mutant

[0028] 1. Obtain the wild-type terpene cyclase and the truncated terpene cyclase.

[0029] For the detailed operations of cloning the coding gene of the wild-type terpene cyclase, constructing the expression vector, expressing and purifying the protein, etc., refer to the prior patent CN201810678989.X of the inventor's research group, which will be briefly described below.

[0030] (1) Perform one round of PCR amplification to obtain the target gene fragment.

[0031] Using the cDNA of Botrytis cinerea TB-31 as a template, perform the following PCR reaction program with the Vazyme P505 high-fidelity enzyme kit: perform PCR reactions using primers ABA3-F / CE-R, ABA3-T1-F / ABA3-T1-R, ABA3-T2-F / CE-R, and ABA3-T3-F / CE-R respectively to amplify the target protein gene sequence corresponding to the base sequence with a TEV cleavage site at the 5' end. Verify the obtained product by agarose gel electrophoresis and purify and recover it. The primers are shown in Table 1.

[0032] Table 1 Comparison table of each primer sequence

[0033]

[0034] (2) Perform two rounds of PCR amplification to add homologous regions.

[0035] Using the reaction products of step (1) as templates respectively, perform amplification with primers CE-F and CE-R to obtain target products with homologous sequences to the vector at both ends. Perform agarose gel electrophoresis and recover the target fragment from the gel. The primer sequences of CE-F and CE-R are as follows:

[0036] CE-F: GTGCCGCGCGGCAGCCATATGGAGAACCTTTATTTCCAAGGCA;

[0037] CE-R: GTGGTGGTGGTGCTCGAGTCAAACTGGAACCTCAAAATGTGT.

[0038] In steps (1) and (2), the amplification reaction system and amplification program are both shown in Table 2.

[0039] Table 2 Reaction system and amplification program

[0040]

[0041]

[0042] (3) Homologous recombination. After digesting the pET28a vector with NdeI and XhoI enzymes, perform electrophoresis and recover the gel slice. Treat the gel recovery product obtained in step (2) with a homologous recombination enzyme, and transform the enzyme-treated product into E. coli DH5α. Pick the transformants for sequencing, and extract the plasmid after verification.

[0043] (4) Protein expression. The expression vector was transformed into E. coli BL21(DE3), and the transformants were picked. After verification, they were used for protein expression. The medium for E. coli BL21(DE3) was LB medium. E. coli BL21(DE3) was inoculated into LB medium at an inoculation amount of 1% (v / v) and cultured at 37 °C and 200 rpm until OD 600 reached approximately 0.6, and then IPTG was added to a final concentration of 0.2 mM. Then, it was cultured at 16 °C and 200 rpm for 16 hours.

[0044] (5) Protein purification. The protein was purified according to the general procedure of Ni-NTA. The buffers used in the purification process were as follows:

[0045] Buffer 1: 25 mM HEPES, 500 mM NaCl, 5% glycerol, 5 mM β-mercaptoethanol, pH adjusted to 7.5 with NaOH;

[0046] Lysis buffer: PMSF was added to Buffer 1 to a final concentration of 1 mM, lysozyme was added to 1 g / L, and imidazole was added to 1 mM;

[0047] Washing buffer: Imidazole was added to Buffer 1 to 5 - 10 mM;

[0048] Elution buffer: Imidazole was added to Buffer 1 to 50 - 300 mM.

[0049] After purification, wild-type BcABA3 and truncated BcABA3 were obtained respectively.

[0050] 2. Obtaining mutants based on truncated terpene cyclase.

[0051] Site-directed mutagenesis was performed using the operating method in the TransGene site-directed mutagenesis kit instructions to obtain mutants A, B1, B2, and B3 respectively. The specific method was as follows:

[0052] (1) Using the expression vector of truncated wild-type terpene cyclase BcABA3 as a template, amplification was carried out according to the following reaction system.

[0053] Table 3 Reaction system and amplification program

[0054]

[0055]

[0056] Among them, the primers for each mutant are shown in Table 4.

[0057] Table 4 Primer sequence comparison table for each mutant

[0058]

[0059] (2) Treat the product of the one-step reaction with DMT enzyme (37 °C, 1 h). Transform the product into DMT competent cells, pick the transformants, extract the plasmids and verify by sequencing.

[0060] (3) Protein expression. Transform the expression vector into E. coli BL21(DE3), pick the transformants, and use them for protein expression after verification. The medium for E. coli BL21(DE3) is LB medium. Inoculate E. coli BL21(DE3) into LB medium at an inoculation amount of 1% (v / v), and culture at 37 °C and 200 rpm until the OD 600 reaches approximately 0.6, then add IPTG to a final concentration of 0.2 mM. Then continue to culture at 16 °C and 200 rpm for 16 h.

[0061] (5) Protein purification. Purify the protein according to the general Ni-NTA procedure. The buffers used in the purification process are as follows:

[0062] Buffer 1: 25 mM HEPES, 500 mM NaCl, 5% glycerol, 5 mM β-mercaptoethanol, adjusted to pH 7.5 with NaOH;

[0063] Lysis buffer: Add PMSF to Buffer 1 to a final concentration of 1 mM, add lysozyme to 1 g / L, and add imidazole to 1 mM;

[0064] Wash buffer: Add imidazole to Buffer 1 to 10 mM;

[0065] Elution buffer: Add imidazole to Buffer 1 to 50 - 300 mM.

[0066] Perform SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) analysis on the truncated BcABA3, BcABA3-A, BcABA3-B1, BcABA3-B2, and BcABA3-B3 obtained after purification. The results are as Figure 1 shown (the wt in Figure 1 corresponds to the truncated BcABA3), and the purified proteins all have the expected sizes. The amino acid sequences of wild-type BcABA3, truncated BcABA3, BcABA3-A, BcABA3-B1, BcABA3-B2, and BcABA3-B3 are shown in Table 5 respectively.

[0067] Table 5 Comparison table of amino acid sequences of various terpene cyclases

[0068]

[0069]

[0070] Example 2: Demonstration of the catalytic effects of terpene cyclases and various mutants

[0071] 0.3 μM of terpene cyclase or each mutant was separately mixed with 150 mM Tris-HCl (pH = 7.5), 2 mM MgCl2, 5% (v / v) glycerol, 5 mM β-mercaptoethanol, and 60 μM FPP, and reacted at 35 °C for 20 min.

[0072] After the reaction, n-hexane with twice the volume of the whole reaction system was added to quench and extract the products for HPLC analysis. HPLC conditions: chromatographic column YMC Carotenoid column, mobile phase methanol: water = 9:1 (V:V), flow rate 1 mL / min, column temperature 40 °C, UV absorption detection wavelength 254 nm.

[0073] The product prepared by wild-type BcABA3 is as Figure 2 shown; the product prepared by truncated BcABA3 is as Figure 3 shown; the product prepared by mutant A is as Figure 4 shown, and the main product is α-farnesene; the product prepared by mutant B1 is as Figure 5 shown, and the content ratio of ethyl angelate in the product is 29.0%; the product prepared by mutant B2 is as Figure 6 shown, and the content ratio of ethyl angelate in the product is 41.0%; the product prepared by mutant B3 is as Figure 7 shown, and the content ratio of ethyl angelate in the product is 49.8%. Figures 2 to 7 In, peak 1 is the main product 2Z,4E-α-ionylideneethane, peak 2 is the by-product allfarnesene, and peak 3 is the by-product ɑ-farnesene.

[0074] The peak areas of the products obtained by different enzymes in the total products are shown in Table 6.

[0075] Table 6 Comparison table of product results of each terpene cyclase

[0076]

[0077] The results show that compared with wild-type BcABA3, by truncating the N-terminus and then performing specific point mutations, the products and the amounts of products obtained by catalysis can be targeted regulated.

[0078] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations, variations, modifications, and substitutions made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A class of terpene cyclase mutants, characterized in that: The terpene cyclase mutant is obtained by truncating 64 amino acids from the N-terminus of the wild-type terpene cyclase BcABA3 and then mutating the truncated terpene cyclase BcABA3. The amino acid sequence of the wild-type terpene cyclase BcABA3 is shown in SEQ ID NO:

1.

2. The terpene cyclase mutant according to claim 1, wherein: The amino acid sequence of the terpene cyclase mutant is shown in SEQ ID NO:

3.

3. The terpene cyclase mutant according to claim 1, wherein: The amino acid sequence of the terpene cyclase mutant is shown in SEQ ID NO:

4.

4. The terpene cyclase mutant according to claim 1, wherein: The amino acid sequence of the terpene cyclase mutant is shown in SEQ ID NO:

5.

5. The terpene cyclase mutant according to claim 1, wherein: The amino acid sequence of the terpene cyclase mutant is shown in SEQ ID NO:

6.

6. A method for changing the product after catalysis by terpene cyclase BcABA3, characterized in that: The terpene cyclase mutant is obtained by truncating 64 amino acids from the N-terminus of the wild-type terpene cyclase BcABA3 and then mutating the truncated terpene cyclase BcABA3. The amino acid sequence of the wild-type terpene cyclase BcABA3 is shown in SEQ ID NO:

1. The catalysis refers to using the terpene cyclase to catalyze the reaction of farnesyl pyrophosphate.

7. The method according to claim 6, characterized in that: Truncate 64 amino acids from the N-terminus of the terpene cyclase BcABA3, mutate the glutamate at position 24 of the truncated terpene cyclase BcABA3 to alanine, or mutate the threonine at position 107 of the truncated terpene cyclase BcABA3 to alanine or cysteine or serine.

8. A method for synthesizing α-farnesene, characterized in that: Using farnesyl pyrophosphate as a substrate, α-farnesene is catalytically synthesized by the terpene cyclase BcABA3. The amino acid sequence of the terpene cyclase BcABA3 is shown in SEQ ID NO: 3.

Images