Maize adenylate cyclase ZmSnRK1.2, its encoding gene, expression vector and applications

By providing maize adenylate cyclase ZmSnRK1.2 and its encoding gene and expression vector, and regulating cAMP content, the problem of insufficient maize tolerance to high-temperature stress was solved, and the effects of improving maize's high-temperature tolerance and breeding high-temperature tolerant varieties were achieved.

CN119823975BActive Publication Date: 2025-10-31HENAN AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411831535.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-12
Publication Date
2025-10-31
Estimated Expiration
2044-12-12

AI Technical Summary

Technical Problem

Existing technologies show that maize is not tolerant enough to high-temperature stress, resulting in reduced yields, and there is a lack of high-temperature tolerant gene resources.

Method used

We provide maize adenylate cyclase ZmSnRK1.2, its encoding gene, and expression vector. By regulating cAMP content, we can enhance the heat resistance of maize. We also construct a ZmSnRK1.2 knockout mutant using the CRISPR/Cas9 system for gene editing.

Benefits of technology

It significantly improved the survival rate and heat resistance of maize under high temperature stress, and provided a new approach to breeding heat-resistant varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119823975B_ABST
    Figure CN119823975B_ABST
Patent Text Reader

Abstract

This invention discloses a maize adenylate cyclase ZmSnRK1.2, its encoding gene, expression vector, and applications, aiming to address the current technical problem of scarce maize heat-resistant gene resources and germplasm resources. This application verifies that maize kinase ZmSnRK1.2, as a novel adenylate cyclase, has high catalytic activity and can rapidly produce cAMP in the presence of ATP. This application also verifies... ZmSnRK1.2 The positive regulatory role of genes in the heat tolerance of maize. This application provides new ideas and technical approaches for solving the damage caused by heat stress in maize and for breeding heat-tolerant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention application relates to the field of molecular breeding technology, specifically to a maize adenylate cyclase ZmSnRK1.2, its encoding gene, expression vector, and applications. Background Technology

[0002] Corn is an important food crop in my country, crucial for ensuring food security. However, with global warming and increasingly frequent extreme heat waves, corn yields are facing a serious threat. High-temperature stress has a significant impact on all growth stages of corn, ultimately affecting yield. During the seedling stage, high-temperature stress increases seedling electrical conductivity, leading to weak plant growth and decreased leaf area index and total dry matter accumulation per plant. This poor development directly affects subsequent growth and development, thus reducing yield. During the flowering stage, temperatures exceeding 32℃ negatively impact pollination. If temperatures rise further above 38℃, tassels may fail to flower properly, severely hindering pollen shedding. High temperatures also interfere with the normal development of female ears, leading to uncoordinated development and a significant decrease in pollination and seed setting rate. During the grain-filling stage, high temperatures significantly shorten the grain-filling time and reduce dry matter accumulation, affecting not only the thousand-grain weight but also directly reducing yield.

[0003] cAMP (3',5'-cyclic adenosine monophosphate) is a key signaling molecule in plants, playing a crucial role in their response to heat stress. This process begins with the catalytic action of adenylate cyclase (AC), an enzyme that converts ATP into cAMP. As a second messenger, cAMP is widely involved in regulating various biological processes, including the response to heat stress. Under high temperatures, cAMP levels increase significantly, potentially activating specific signal transduction pathways and leading to altered expression of heat-resistance-related genes such as heat shock proteins (HSPs). Furthermore, cAMP interacts closely with the abscisic acid (ABA) signaling pathway; ABA can further increase cAMP levels, thus synergistically enhancing plant heat tolerance. In maize, cAMP enhances heat tolerance by regulating the expression of cellulose synthase genes, affecting cell wall stability.

[0004] The information disclosed in this background section is intended only to enhance the understanding of the background technology of this disclosure and should not be construed as an admission or in any way implying that the information constitutes prior art known to those skilled in the art. Summary of the Invention

[0005] ZmSnRK1.2ZmSnRK1.2 is a gene of sucrose non-fermentation-1 (SNF1)-associated protein kinase 1 (SnRK1) in maize (Zea mays L.), which is highly conserved in maize and closely related to plant development and stress response. The inventors have discovered that ZmSnRK1.2 is a novel adenylate cyclase with biological functions in response to high-temperature stress. Specifically, this disclosure provides a maize adenylate cyclase ZmSnRK1.2, its encoding gene, expression vector, and applications, aiming to address the current technical problem of scarce maize heat-resistant gene resources and germplasm resources.

[0006] According to one aspect of this disclosure, a maize adenylate cyclase ZmSnRK1.2 is provided, the amino acid sequence of which is shown in SEQ ID NO.1.

[0007] According to a second aspect of this disclosure, a gene encoding the aforementioned maize adenylate cyclase ZmSnRK1.2 is provided. ZmSnRK1.2 Its nucleotide sequence is shown in SEQ ID NO.2.

[0008] According to a third aspect of this disclosure, a method is provided that contains the said coding gene. ZmSnRK1.2 Or the expressive carrier of its fragments.

[0009] According to the fourth aspect of this disclosure, the maize adenylate cyclase ZmSnRK1.2 and the encoding gene are... ZmSnRK1.2 Alternatively, the expression vector may be used in regulating the heat resistance trait of maize or in the preparation of reagents for regulating the heat resistance trait of maize.

[0010] According to the fifth aspect of this disclosure, the maize adenylate cyclase ZmSnRK1.2 and the encoding gene are... ZmSnRK1.2 Alternatively, the expression vector may be used to regulate cAMP levels in plants or to prepare reagents for regulating cAMP levels.

[0011] According to the sixth aspect of this disclosure, the coding gene ZmSnRK1.2 Alternatively, the expression vector may be used in the breeding / identification of maize varieties / lines with heat stress tolerance traits.

[0012] According to the seventh aspect of this disclosure, the coding gene ZmSnRK1.2 Alternatively, the expression vector may be used in the construction / breeding of transgenic plants with heat stress tolerance.

[0013] One or more technical solutions provided in the embodiments of this application have at least one of the following technical effects or advantages:

[0014] 1. First confirmation of maize kinase ZmSnRK1.2 is a novel adenylate cyclase containing three relatively conserved AC catalytic center motifs. It exhibits high catalytic activity in vitro and can rapidly produce cAMP in the presence of ATP.

[0015] 2. ZmSnRK1.2 Gene expression levels were significantly reduced under high-temperature stress; simultaneously, by constructing ZmSnRK1.2 Knockout mutants subjected to high-temperature stress showed that the survival rate of the mutant lines was significantly lower than that of the wild type under high-temperature stress, exhibiting a distinct heat-sensitive phenotype, indicating that... ZmSnRK1.2 Positively regulates the high-temperature resistance of corn.

[0016] 3. This application provides new ideas and technical approaches for solving the damage caused by high temperature stress in maize and for breeding heat-resistant varieties. Attached Figure Description

[0017] Figure 1 This study includes the prediction of the domains of the ZmSnRK1.2 encoded protein in one embodiment of this application, and the sequence alignment analysis of the AC motif of the ZmSnRK1.2 encoded protein with the AC motif protein sequence of known plant adenylate cyclases.

[0018] Figure 2 This study analyzes the adenylate cyclase activity of ZmSnRK1.2 in one embodiment of this application.

[0019] Figure 3 As shown in one embodiment of this application ZmSnRK1.2 Gene expression analysis under high temperature stress.

[0020] Figure 4 As shown in one embodiment of this application ZmSnRK1.2 Gene structure diagram, CRISPR / Cas9 target sequence design sites, ZmSnRK1.2 Analysis of mutation sites and in vivo cAMP content in Cas9-ZmSnRK1.2 knockout mutant materials.

[0021] Figure 5 Phenotypic analysis and survival rate statistical analysis of maize wild-type B104 and Cas9-ZmSnRK1.2 knockout mutants after high-temperature treatment in one embodiment of this application. Detailed Implementation

[0022] To better understand the technical solution of this application, the above technical solution will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0023] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; the reagents involved are all commercially available conventional reagents; and the detection methods involved are all conventional methods unless otherwise specified.

[0024] Example 1: Detection of AC catalytic center motif in maize kinase ZmSnRK1.2

[0025] To confirm whether ZmSnRK1.2 is a novel adenylate cyclase (AC), the ZmSnRK1.2 protein sequence was analyzed using an online website (https: / / prosite.expasy.org / scanprosite). The analysis revealed that ZmSnRK1.2 contains three relatively conserved AC catalytic center motifs: [RKS]X[DE]X(9, 11)[KR]X(1, 3)[DE]( Figure 1 Therefore, it is preliminarily speculated that ZmSnRK1.2 is a novel adenylate cyclase.

[0026] Example 2: Enzyme activity analysis of adenylate cyclase ZmSnRK1.2

[0027] To further verify whether ZmSnRK1.2 is a novel adenylate cyclase, a complementation experiment was first performed on *E. coli* strain SP850 (from the Yale University E. coli Genetic Reserve Center, accession number: 7200). In this experiment, wild-type *E. coli* could break down maltose in the presence of cAMP in the cells and form red colonies on maltose-maccon agar plates, while *E. coli*... cyaA The mutants formed white colonies due to the absence of cAMP in their cells. (Research results) Figure 2 This indicates that wild-type Escherichia coli and those containing the induced ZmSnRK1.2 protein... cyaA The mutant exhibits red colonies, while the individual... cyaA Mutants and those lacking the ability to induce ZmSnRK1.2 protein. cyaA The mutant formed white colonies, indicating that ZmSnRK1.2 can produce cAMP, which is a novel adenylate cyclase.

[0028] In this example, the recombinant protein GST-SnRK1.2 was purified by in vitro prokaryotic expression, and the in vitro catalytic activity of GST-SnRK1.2 was detected by LC / MS. The results ( Figure 2 This indicates that the recombinant protein GST-SnRK1.2 can rapidly produce cAMP in the presence of ATP.

[0029] In summary, ZmSnRK1.2 is a novel maize adenylate cyclase.

[0030] Example 3: Corn ZmSnRK1.2 Functional verification of genes

[0031] In order to determine ZmSnRK1.2 Whether gene expression is affected by high temperature was investigated in maize inbred line B73 seedlings at the three-leaf stage.

[0032] The cells were subjected to high-temperature stress at 42℃ for 0 h, 3 h, 6 h, 9 h, and 12 h. Total RNA was then extracted from the second leaf, and its expression was analyzed by qRT-PCR. Results ( Figure 3 )show, ZmSnRK1.2 Gene expression is significantly reduced under high temperature stress.

[0033] Furthermore, the CRISPR / Cas9 system was used to... ZmSnRK1.2 Gene knockout was performed. Using a CRISPR-Cas9 vector previously stored in the inventor's laboratory, a gene knockout was constructed. ZmSnRK1.2 The CRISPR-Cas9-ZmSnRK1.2 vector, containing a specific gene mutation site, was successfully constructed and transformed into the maize inbred line B104 for genetic transformation, thereby inhibiting the... ZmSnRK1.2 Genes were edited, and then the resulting corn seedlings were sequenced and compared to obtain... ZmSnRK1.2 Mutation sites in genes.

[0034] The specific steps are as follows:

[0035] (1) Target sequence design

[0036] Using the NCBI website, search for the sequence of the target gene; in the CDS of the target gene, find two target sequences near the ATG end (Target1: ACTCTCGGAATTGGCTCATTCGG; Target2: ATTCGGGAAGGTGAAAATTGCGG). Figure 4 ).

[0037] (2) Construction of intermediate vector sgRNA

[0038] First, the intermediate vector was digested with enzymes and then recovered using a gel. The sgRNA digestion system (50 μL) is shown in Table 1.

[0039] Table 1 sgRNA digestion system

[0040] .

[0041] Next, the designed primers (F1: GGCAACTCTCGGAATTGGCTCATT; R1: AATGAGCCAATTCCGAGAGTCAAA) and (F2: GGCAATTCGGGAAGGTGAAAATTG; R2: CCGCAATTTTCACCTTCCCGAATCAAA) were diluted to 100 μM / L, and the target fragment was obtained by ligation using a PCR instrument. The PCR reaction system is shown in Table 2, and the program was set as follows: 37℃ for 5 min, 95℃ for 5 min, ramp down to 25℃, 5℃ / min.

[0042] Table 2 PCR reaction system

[0043] .

[0044] Finally, the target fragment was diluted 200-fold and ligated into the intermediate vector sgRNA at 25°C for 5 min. The ligation was then performed on DH5α cells using U3-F (acactttatgcttccggctc) and R1 / R2 primers, followed by shaking and sequencing to obtain the correct intermediate vector. The target fragment and sgRNA ligation system (10 μL) is shown in Table 3.

[0045] Table 3. Target fragment and sgRNA ligation system

[0046] .

[0047] (3) Construction of Cas9 final load

[0048] The intermediate vector with correct sequencing and the final Cas9 vector were used to construct the final vector as shown in Table 4. The ligation solution was incubated overnight at 4°C and transformed into DB3.1. Colony PCR was performed using U3-F and R1 / R2 primers, followed by shaking and sequencing to obtain the correct Cas9 vector. The transformed maize was then transformed using Agrobacterium-mediated transformation (sent to the relevant company for completion).

[0049] Table 4 Final Load Connection System

[0050] .

[0051] (4) ZmSnRK1.2 Identification of knockout mutant materials

[0052] DNA was extracted from T0 generation transgenic knockout plants. Identification primers containing the Target1 sequence (F3: CGGTGGAGATGTTCGTTTTT; R3: GGGCAACACGAGTATCCA) of approximately 400 bp were designed using the Target1 sequence. PCR amplification, gel recovery, and sequencing verification were then performed to determine whether a mutation had occurred in the T0 generation transgenic plants.

[0053] After the transgenic plants were constructed, the mutant plants were... snrk1.2-1 , snrk1.2-2 The cells were cultured simultaneously with B104 until the three-leaf stage, and then subjected to high-temperature stress treatment at 42℃ for 14 h during the day and 38℃ for 10 h at night. Phenotypic results were observed. Figure 5 This indicates that under high-temperature stress, the survival rate of the mutant lines was significantly lower than that of the wild type, exhibiting a distinct heat-sensitive phenotype, suggesting that... ZmSnRK1.2 Positive regulation of heat resistance traits in maize 。

[0054] Although some preferred embodiments of this invention have been described, those skilled in the art, upon learning the basic inventive concept, can make other changes and modifications to these embodiments. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments as well as all changes and modifications falling within the scope of this invention.

[0055] Obviously, those skilled in the art can make various modifications and variations to this invention without departing from the spirit and scope of its inventive concept. Therefore, if these modifications and variations fall within the scope of the claims of this application and their equivalents, this application also intends to include these modifications and variations.

Claims

1. Application of maize adenylate cyclase ZmSnRK1.2, with the amino acid sequence shown in SEQ ID NO.1, in the catalytic generation of cAMP or in the preparation of catalysts for cAMP generation.

2. The application of the gene encoding the nucleotide sequence shown in SEQ ID NO.2 or its expression vector in increasing cAMP levels in cells or in preparing reagents for increasing cAMP levels in cells, characterized in that, The encoding gene ZmSnRK1.2 Overexpression.

3. The application of the gene encoding the nucleotide sequence shown in SEQ ID NO.2 in identifying the heat-sensitive phenotype of maize, characterized in that, If the encoded gene is not expressed or lacks function, it is determined to be a heat-sensitive phenotype.

Citation Information

Patent Citations

  • Maize sucrose non-fermentation-1 associated protein kinase 1 gene family and application thereof

    CN108707594A