Fraxinus chinensis transcription factor FvCAMTA1 gene promoter and application thereof
By obtaining the promoter of the ash transcription factor FvCAMTA1 gene and constructing an expression vector, it verifies its response ability in tobacco leaves, solving the problem of insufficient research on the villi ash genome and achieving improvements in the salt tolerance of ash tree species.
Patent Information
- Application Number
- CN202510724519.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-03
- Publication Date
- 2025-07-04
- Estimated Expiration
- 2045-06-03
AI Technical Summary
In the prior art, the genome sequence of villus ash wax has not been completed, which limits the study of its functional genes, making it difficult to select excellent ash tree species through transgenic or molecular markers, and there is a lack of effective genomic means for the improvement and development and utilization of saline-alkali land.
The promoter sequence of the ash transcription factor FvCAMTA1 gene was obtained through step cloning technology, and the promoter expression vectors of different lengths were constructed, and its function was verified in tobacco leaves. The Agrobacterium injection method was used to study its ability to respond to salt stress, and the expression characteristics in different tissues were analyzed in combination with RT-qPCR technology.
It is verified that the FvCAMTA1 gene promoter can respond to salt stress, suggesting that it plays an important role in the salt stress signaling pathway, and improves the understanding and improvement of salt tolerance of ash species.
Smart Images

Figure CN120249282A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of genetic engineering, and in particular relates to a transcription factor of white wax FvCAMTA1 Gene promoters and their applications. Background Art
[0002] Soil salinization has become a global problem. Salinized soil has a high salt content, is easy to harden, has a low organic matter content, and is not very fertile. Improving and developing saline-alkali land and improving the ecological environment are key issues that contemporary forestry urgently needs to address. Although physical and chemical improvements can be effective in the short term, long-term use will also cause the soil environment to deteriorate. The combination of engineering and biological improvements is currently the most effective way, and the selection of salt-tolerant plant materials has become the key to this measure. The response mechanism of plants to salt stress is complex and multi-layered, especially salt-tolerant plants, which have certain unique and efficient salt-resistant mechanisms and characteristics. Analyzing the salt-resistant mechanism of plants can help us take effective measures to reduce the impact of salt stress on plants. At the same time, through modern molecular breeding methods, we can fully utilize existing saline soil resources by cultivating resistant trees.
[0003] Wax fern Velvet Ash ) is not only a preferred tree species for the development and utilization of saline-alkali land, but also an excellent landscape tree species. Due to its relatively complex genome, the sequencing and assembly of the genome sequence have not yet been completed, which greatly limits the research on its functional genes. Genomic research on the excellent salt-alkali tolerance traits of Fraxinus chinensis and the discovery of key genes for adapting to stress environments are of great significance for the rapid, efficient and targeted screening of excellent Fraxinus chinensis species through modern molecular biological methods such as transgenics or molecular marker-assisted selection, and for further promoting the research on forest salt tolerance using salt-tolerant genes. Summary of the invention
[0004] In order to overcome the above-mentioned deficiencies of the prior art, the present invention provides a transcription factor FvCAMTA1 Gene promoter and its application. The present invention obtains a 1231 bp gene promoter by walking cloning technology. FvCAMTA1 Gene promoter sequences were constructed, promoter expression vectors of different lengths were constructed, and their functions were verified in tobacco leaves by Agrobacterium injection. The results showed that the promoter could respond to salt stress, suggesting that it may play an important role in the salt stress signaling pathway as a transcription factor. In addition, RT-qPCR technology was used to analyze FvCAMTA1 The expression characteristics of the gene in different tissues showed that its expression in leaves was significantly higher than that in roots and stems, and the expression level increased significantly under salt stress. Based on the above research, the present invention was completed.
[0005] To achieve the above object, the present invention provides the following technical solutions: In the first aspect of the present invention, the present invention provides a Fraxinus transcription factor FvCAMTA1 gene promoter, characterized in that the nucleotide sequence of the Fraxinus transcription factor FvCAMTA1 gene promoter is as shown in SEQ ID NO.1.
[0006]
[0007] In some preferred embodiments, the nucleotide sequence of the promoter of the Fraxinus transcription factor FvCAMTA1 is shown in SEQ ID NO.2.
[0008] ATACTGCAAGTTAAAAATTCTCCAACTTCCAACAACTTCTGCTGCTGCTCTCTAGGTCTGTTCTGCTAATTTTTTATATATTTTGGATTTTAATTGCTTGGTTTTTTTCAGTTAATTACATCACTTTTTGAGTGTGAATGATCGGTTGAGTGATAAG (SEQ ID NO.2).
[0009] In some preferred embodiments, the nucleotide sequence of the promoter of the Fraxinus transcription factor FvCAMTA1 is shown in SEQ ID NO.3.
[0010] TAAATTTGTATATAATATTGCTTTATTGAATAATGTGTCCTTCGAAATAGAACAAAGAAATATGTATTCTGAGAATGACAGGACAATTTTCAAATAAGTCCGATCGAAACGCTAGAAAATAACAATTTTTTTCTTTTTCAGCGCATAATCATACTGCAAGTTAAAAATTCTCCAACTTCCAACAACTTCTGCTGCTGCTCTCTAGGTCTGTTCTGCTAATTTTTTATATATTTTGGATTTTAATTGCTTGGTTTTTTTCAGTTAATTACATCACTTTTTGAGTGTGAATGATCGGTTGAGTGATAAG (SEQ ID NO.3).
[0011] In some preferred embodiments, the nucleotide sequence of the promoter of the Fraxinus transcription factor FvCAMTA1 is shown in SEQ ID NO.4.
[0012]
[0013] In a second aspect of the present invention, there is provided the use of the above-mentioned Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter in the preparation of a recombinant vector for expressing a foreign gene.
[0014] In a third aspect of the present invention, there is provided a recombinant vector comprising the above-mentioned Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter.
[0015] In some embodiments of the present invention, the above-mentioned recombinant vector comprises a viral vector or a non-viral vector.
[0016] As a preferred embodiment, the recombinant vector is FvCAMTA1 promorter1::GUS, FvCAMTA1 promorter2::GUS or FvCAMTA1 promorter3::GUS.
[0017] In a fourth aspect of the present invention, there is provided a host cell comprising the above-mentioned recombinant vector.
[0018] As a preferred embodiment, the host cell comprises a prokaryotic cell.
[0019] As a preferred embodiment, the host cell is Agrobacterium, preferably Agrobacterium tumefaciens LBA4404.
[0020] In a fifth aspect of the present invention, there is provided the use of the above-mentioned Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter, the above-mentioned recombinant vector or the above-mentioned host cell in the construction of a transgenic plant, wherein the Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter drives the expression of a foreign gene in the transgenic plant.
[0021] In a sixth aspect of the present invention, there is provided a method for improving the salt tolerance of a plant, comprising the following steps: Constructing the Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter into an expression vector to form a recombinant expression vector, and then transforming the plant with the recombinant expression vector so that the plant carries the FvCAMTA1 gene promoter, and finally regulating the salt tolerance of the plant by driving the high expression of the target gene.
[0022] As a preferred embodiment, the nucleotide sequence of the Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter is as shown in SEQ ID NO.1.
[0023] As a preferred embodiment, the nucleotide sequence of the Fraxinus chinensis Roxb. transcription factor FvCAMTA1 gene promoter is as shown in SEQ ID NO.2.
[0024] As a preferred embodiment, the ash transcription factor FvCAMTA1 The nucleotide sequence of the gene promoter is shown in SEQ ID NO.4.
[0025] As a preferred embodiment, the plant is a dicotyledon or a monocotyledon, and the dicotyledon is tobacco or ash.
[0026] In the seventh aspect of the present invention, there is provided an application of the above promoter, the above recombinant vector or the above host cell in driving the expression of a target gene under salt stress induction.
[0027] As a preferred embodiment, the application refers to driving the expression of a target gene in ash under salt stress induction.
[0028] The above one or more technical solutions have the following beneficial effects: The present invention obtains the full-length sequence of the gene coding region through RACE-PCR technology, and clones its promoter sequence by chromosome walking technology. The analysis of the promoter sequence shows that FvCAMTA1 The gene promoter contains multiple elements related to plant hormone response, light response and stress response, indicating that it may participate in the plant's stress resistance mechanism. By constructing promoter expression vectors of different lengths and verifying their functions in tobacco leaves by Agrobacterium injection method, the results show that the promoter can respond to salt stress, suggesting that it may play an important role in the salt stress signaling pathway as a transcription factor. In addition, RT-qPCR technology is used to analyze FvCAMTA1 The expression characteristics of the gene in different tissues. The results show that its expression in leaves is significantly higher than that in roots and stems, and the expression level increases significantly under salt stress treatment. FvCAMTA1 The gene expression characteristics in different tissues were analyzed by RT-qPCR. The results showed that its expression in leaves was significantly higher than that in roots and stems, and the expression level increased significantly under salt stress treatment.
[0029] The advantages of the additional aspects of the present invention will be partially given in the following description, partially become obvious from the following description, or be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0030] The specification drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.
[0031] Figure 1 The promoter sequence of the gene cloned by the present invention FvCAMTA1 gene.
[0032] Figure 2 For the present invention FvCAMTA1 cis-acting elements in the promoter sequence of the gene.
[0033] Figure 3GUS staining of promoters with different lengths in tobacco leaf discs after salt stress treatment in the embodiments of the present invention. Among them, A, B, and C are the expressions of FvCAMTA1 promorter1::GUS, FvCAMTA1 promorter2::GUS, and FvCAMTA1 promorter3::GUS in tobacco leaves respectively; D is the control injected with the empty vector; E is the treatment with salt stress but without injecting the empty vector control; F is the control injected with the empty vector and treated with salt stress.
[0034] Figure 4 For FvCAMTA1 the tissue expression specificity of the gene, where ** represents significant at the level of p < 0.01.
[0035] Figure 5 For FvCAMTA1 the expression levels of the gene in the salt-sensitive variety 'Qingbi' (WT) and the salt-tolerant variety 'Lula No. 3' (L3) under 100 mmol / L and 300 mmol / L NaCl treatments, where * represents significant at the level of p < 0.05, and ** represents significant at the level of p < 0.01. Specific embodiments
[0036] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.
[0037] It should be noted that the details not elaborated in the present invention are well-known to those skilled in the art. The experimental methods without specific conditions noted in the following embodiments are usually carried out according to conventional conditions or the conditions recommended by the manufacturer. The experimental steps not detailed are referred to "Molecular Cloning: A Laboratory Manual" ((US) M.R. Green (Michael R. Green), (US) J. Sambrook (Joseph.Sambrook) eds., Fourth Edition), pathophysiology experiments, online databases, etc.
[0038] In this laboratory, using salt-tolerant Fraxinus velutina and salt-sensitive Fraxinus chinensis as materials, through Illumina HiSeq2000 high-throughput sequencing technology, the transcriptome Unigene data of the two materials under salt and non-salt treatments were obtained respectively, and the differences in salt-induced genes between the two were compared. 316 genes specifically induced by salt in Fraxinus velutina were screened. A gene in the calmodulin-binding transcription factor family with relatively significant expression differences was found among these genes. The CDS sequence (GenBank: MF673839.1) was cloned and sequenced in the laboratory, and it was named FvCAMTA1 gene, and this study determined through verification FvCAMTA1The gene is a key gene contributing to the excellent salt and alkali tolerance traits of Fraxinus velutina Torr.
[0039] To deeply analyze FvCAMTA1 the internal mechanism of the gene induced by salt stress and accurately define its contribution in the salt tolerance process of Fraxinus velutina Torr., in this study, the salt-sensitive variety 'Qingbi' and the salt-tolerant variety 'Lula No. 3' of Fraxinus velutina Torr. were selected, salt stress treatment was applied to them, and FvCAMTA1 the expression levels of the gene in two types of Fraxinus velutina Torr. varieties with different salt tolerances were measured, and for different tissue parts of the roots, stems and leaves of Fraxinus velutina Torr., FvCAMTA1 the tissue expression specificity of the gene was measured. During the research process, the full-length promoter of the gene was cloned, and the transcription factors on its promoter were analyzed. The functions of promoters with different lengths were verified through promoter truncation experiments, and FvCAMTA1 the self-activation verification of the full-length promoter of the gene was carried out. Multiple stress response elements were contained in its promoter and it could positively respond to salt stress. Based on this, it was concluded that FvCAMTA1 the gene plays a positive regulatory role in the resistance regulation process of Fraxinus velutina Torr. to salt stress. FvCAMTA1 In the following embodiments, the materials and reagents used, unless otherwise specified, were obtained from commercial sources.
[0040] In the following embodiments, the materials and reagents used, unless otherwise specified, were obtained from commercial sources.
[0041] The following is a further detailed description of the present invention in combination with specific embodiments. It should be noted that the specific embodiments are explanations rather than limitations of the present invention.
[0042] Experimental Materials and Reagents In this study, test-tube seedlings of Fraxinus velutina Torr. ( Velvet Ash (Fraxinus velutina Torr.) ), preserved in the germplasm resource library of the Key Laboratory of Forest Tree Genetics and Improvement of Shandong Province, were used as test materials. Fresh leaves were taken, quickly frozen in liquid nitrogen, and ground into powder for storage at -80 °C for later use. Seeds of Nicotiana benthamiana ( Tobacco (Nicotiana tabacum) ) were provided by this laboratory. Speed STARTM HS DNA Ploymerase and LA PCRTM in vitro cloning kit were purchased from TaKaRa and OMEGA companies. Various Primer star Taq enzymes, gel recovery kits, T4 DNA ligase, restriction endonucleases, Escherichia coli DH5α competent cells, Agrobacterium strain GV3101, vector pGBKT-7, PPZP211-GUS, pMD18-T vector, plasmid extraction, gel recovery kits and primers (Table 1) etc. were purchased from Shandong Huabo Genetic Engineering Co., Ltd.
[0043] Table 1 Primer Sequences
[0044] The data were analyzed using SPSS 18.0 statistical analysis software for statistical analysis of experimental data. SigmPlot 10.0 software was used for drawing graphs.
[0045] Example 1 Amplification of the FvCAMTA1 gene promoter of Fraxinus velutina Using the Fraxinus genomic DNA as a template, referring to the chromosome walking steps of the Genome Walking kit, after 3 rounds of nested PCR and 3 times of chromosome walking, a 1231 bp nucleotide sequence upstream of the start codon ATG of the ORF was obtained, and its nucleotide sequence is shown in SEQ ID NO.1. The promoter and its cis-acting elements were predicted using NNPP (https: / / www.fruitfly.org / seq_tools / promoter.html) and PLACE (http: / / www.Dna.affrc.go.p / PLACE / ).
[0046] As Figure 1 shown, the promoter sequence of the 1231 bp FvCAMTA1 gene was obtained by walking cloning. Three possible promoter sites were predicted through the NNPP online database, located at 148 - 198 bp, 925 - 975 bp, and 1076 - 1126 bp respectively. The results of Plant CARE analysis are as Figure 2 shown, and it was found that the promoter sequence contains the conserved core promoter element TATA-box and the cis-enhancer element CAAT-box, which conforms to the basic structural characteristics of eukaryotic gene promoters. In addition, the promoter sequence also contains plant hormone response elements, light response elements, and stress response elements. Hormone response elements include the salicylic acid response element TCA-element, the ABA response element ABRE, the jasmonic acid response elements TGACG-motif and CGTCA-motif, the ethylene response element ERE, and the auxin response element TGA-element. Light response elements include ACE, G-Box, I-box, GATA-motif, AE-box, and Box 4. Stress response elements include the stress defense response element TC-rich repeats, the damage response element WRE3, the damage and pathogen response element box S, the low temperature response element STRE, and the anaerobic induction element ARE. At the same time, MYB and MYC binding elements were found in the gene promoter sequence, and the GCN4_motif endosperm expression element was also found, indicating that this gene may have tissue-specific expression in plants.
[0047] Example 2 Construction of the promoter plant expression vector and transient expression in tobacco leaves To study the response mechanism of promoters with different lengths to salt stress, primers Pro_F_148 / Pro_R_148 (SEQ ID NO.8, SEQ ID NO.6), Pro_F_925 / Pro_R_925 (SEQ ID NO.7, SEQ ID NO.6), and Pro_F_1076 / Pro_R_1076 (SEQ ID NO.5, SEQ ID NO.6) were designed to amplify the FvCAMTA1 gene promoter (SEQID NO.1) region, respectively obtaining promoter fragments FvCAMTA1 promorter1 (SEQ ID NO.2), FvCAMTA1 promorter (SEQ ID NO.3), and FvCAMTA1 promorter3 (SEQ ID NO.4). The promoter fragments were respectively ligated to the pMD 18-T vector to obtain recombinant vectors. The recombinant vectors and the PPZP211-GUS vector were respectively subjected to BamH I and SalAfter double digestion and ligation, recombinant vectors FvCAMTA1 promorter1::GUS, FvCAMTA1promorter2::GUS, and FvCAMTA1 promorter3::GUS were constructed. The above recombinant vectors FvCAMTA1promorter1::GUS, FvCAMTA1 promorter2::GUS, FvCAMTA1 promorter3::GUS and the empty vector control (pPZP211::GUS) were respectively introduced into Agrobacterium tumefaciens strain LBA4404 by the freeze-thaw transformation method, and positive clones were screened by colony PCR. Single colonies were picked and inoculated into LB liquid medium containing 50 μg / mL kanamycin and 100 μg / mL rifampicin, and cultured with shaking at 28 °C and 200 rpm until OD600 = 0.6 - 0.8. After collecting the bacteria, they were resuspended in infection buffer (10 mM MgCl2, 10 mM MES pH 5.6) containing 100 μM acetosyringone to OD600 = 0.5. The fourth to fifth true leaves of 5-week-old Nicotiana benthamiana were selected, and the bacterial solution was injected into the intercellular space on the back of the leaves using a needleless syringe, with the empty vector injection group and the buffer treatment group as controls. After injection, the plants were cultured in the dark for 24 h, and then transferred to a light incubator (16 h light / 8 h dark) for 48 h. The leaf tissue (1 cm in diameter) at the injection site was immersed in GUS staining solution (75 mM Na3PO4 pH 7.0, 0.05 mM K3[Fe(CN)6], 0.05 mM K4[Fe(CN)6], 0.1% Triton X-100, 10 mM EDTA, 20% methanol, 50 μg / mL X-Gluc), and incubated at 37 °C in the dark for 16 h. After decolorization with 75% ethanol, the GUS signal intensity was observed under a fluorescence microscope, and the proportion of the stained area was quantitatively analyzed using ImageJ software.
[0048] To study the response mechanism of promoters with different lengths to salt stress, Agrobacterium-mediated transient transformation was used to transform tobacco leaves under salt stress. The PPZP211 empty vector was used as a positive control, and tobacco plants injected only with buffer were used as a negative control, and GUS histochemical staining was performed. As Figure 3 shown in A and C of Figure 3 , after salt treatment, the tobacco leaves transiently expressing promoter fragments FvCAMTA1 promorter1 and FvCAMTA1 promorter3 showed blue after GUS staining, and the blue color of promoter fragment FvCAMTA1 promorter3 was deeper than that of FvCAMTA1 promorter1. As FvCAMTA1 shown in B, D, E, and F of FvCAMTA1 , promoter fragment FvCAMTA1 promorter2, the empty vector, and the control were all colorless. In summary, FvCAMTA1The promoter fragments FvCAMTA1 promorter1 and FvCAMTA1 promorter3 of the gene can both respond to salt stress, and the expression intensity of the promoter with a longer length is higher than that of the promoter with a shorter length. This region may play an important role in the transcriptional activation of the gene during the salt stress response process FvCAMTA1 in the transcriptional activation of the gene.
[0049] Example 3 FvCAMTA1 Tissue-specific expression and expression analysis under salt treatment Select the salt-sensitive variety 'Qingbi' (WT) and the salt-tolerant variety 'Lula No. 3' (L3). Immerse the roots of the seedlings of the salt-sensitive variety 'Qingbi' (WT) with consistent growth in 100 mmol / L and 300 mmol / L NaCl solutions, and immerse the roots of the seedlings of the salt-tolerant variety 'Lula No. 3' (L3) with consistent growth in 300 mmol / L NaCl solution. After 0, 1, 4, and 12 h respectively, take the 6th and 7th true leaves, the 6th stem segment, and the young roots starting from the shoot tip, quickly freeze them in liquid nitrogen, and store them at -80 °C for later use. Each treatment is repeated 3 times. Using the GAPDH gene as the internal reference gene, design primer sets FvCAMTA1-qPCR-F / FvCAMTA1-qPCR-R (SEQ ID NO.9, SEQID NO.10), qFvGAPDH-F / qFvGAPDH-R (SEQ ID NO.11, SEQ ID NO.12). The RT-qPCR method uses the SYBR PrimeScrip TM RT-PCR kit from Tiangen Biochemical Co., Ltd. to perform the RT-qPCR experiment (the instrument model is ABIStep One plus). The specific experimental steps are carried out according to the kit instructions to detect FvCAMTA1 the relative expression levels of the gene in different tissues and the relative expression levels under salt treatment.
[0050] FvCAMTA1 The tissue expression specificity of the gene is as Figure 4 shown. FvCAMTA1 The gene is expressed at the lowest level in the stem, followed by the root, which is 2.1 times that of the stem. It is the highest in the leaf, which is 3.2 times that of the stem. Under stress treatment FvCAMTA1 the expression level of the gene is as Figure 5 shown. In the treatment with 100 mmol / L NaCl solution, FvCAMTA1 the expression level of the gene shows a trend of rising rapidly and then decreasing. FvCAMTA1 The gene has the highest expression at 1 h, which is 2.236 times that at 0 h, and then decreases rapidly. By 12 h, the expression level has no significant difference from that at 0 h. In the treatment with 300 mmol / L NaCl solution, FvCAMTA1The expression trend of the gene was similar to that under 100 mmol / L NaCl treatment, but the expression level was significantly higher than that under 100 mmol / L NaCl treatment. At 1 h, its expression level was 3.8 times that at 0 h, and at 12 h, the expression level was still significantly higher than that at 0 h, being 2.1 times. In the salt-tolerant variety 'Luwax 3', FvCAMTA1 the expression level of the gene was higher than that in 'Qingbi'. After treatment with 300 mmol / L NaCl solution for 1 h, FvCAMTA1 the expression level of the gene in 'Luwax 3' was 6 times that at 0 h, and at 12 h, it was still 4.1 times that at 0 h.
[0051] In this study, the chromosome walking technique was successfully used to clone FvCAMTA1 a 1,231 bp promoter sequence upstream of the start codon ATG of the gene. Bioinformatics analysis showed that this sequence had the dual structural characteristics of a typical eukaryotic promoter: a TATA-box core element at -28 bp upstream of the transcription start site and a CAAT-box enhancer element at -98 bp. Further analysis showed that a total of 23 functional elements were identified in the promoter region, including 4 types of hormone response elements (ABRE, TGA-element, etc.), 5 types of light response elements (G-box, I-box, etc.), and 14 types of stress-related elements. The coexistence of MYB binding elements and MYC recognition motifs suggested that it might be involved in the stress response regulatory network. Notably, the discovery of GCN4_motif indicated that this gene might have potential functions in endosperm development. Detection by real-time fluorescence quantitative PCR (RT-qPCR) showed that FvCAMTA1 the expression level of the gene in leaves was 3.2 times and 2.5 times that in roots and stems respectively. The analysis of the expression of the GUS gene in tobacco leaves transiently transformed with different promoter fragments of FvCAMTA1 the gene showed that GUS was expressed in tobacco leaves, and the activity of the GUS gene was not detected in the control group injected with only buffer. The GUS expression intensity of the full-length promoter was higher than that of the truncated promoter, indicating that FvCAMTA1 the cis-acting elements upstream of the promoter of the gene had a promoting effect on its expression.
[0052] Meanwhile, FvCAMTA1 under salt stress conditions at different times and different concentrations, FvCAMTA1 the expression level of the gene was higher than that at 0 h of treatment. Under 300 mmol / L salt treatment, FvCAMTA1 the expression level of the gene was significantly higher than that under 100 mmol / L salt treatment, and in the salt-tolerant variety 'Luwax 3', FvCAMTA1 the expression level of the gene was higher than that in the salt-sensitive 'Qingbi', indicating that FvCAMTA1 the expression level of the gene was positively correlated with the degree of salt stress.
[0053] The above results indicate that FvCAMTA1 The gene promoter contains multiple stress-responsive elements and can positively respond to salt stress. Based on this, it is speculated that FvCAMTA1 may play a positive regulatory role in the process of regulating the salt stress resistance of Fraxinus chinensis Roxb.
[0054] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A Fraxinus transcription factor FvCAMTA1 gene promoter, characterized in that The ash transcription factor FvCAMTA1 The nucleotide sequence of the gene promoter is shown in SEQ ID NO.
1.
2. Use of the gene promoter of the Fraxinus transcription factor according to claim 1 in the preparation of an exogenous gene expression vector FvCAMTA1 3. A recombinant vector, characterized in that, Including the ash transcription factor described in claim 1 FvCAMTA1 Gene promoter.
4. A host cell, characterized in that, comprises the recombinant vector as described in claim 3.
5. The host cell according to claim 4, wherein, The host cell is Agrobacterium.
6. Use of the Fraxinus transcription factor according to claim 1 FvCAMTA1 for constructing a transgenic plant, which is characterized in that the gene promoter, the recombinant vector according to claim 3 or the host cell according to claim 4 or 5 is used The promoter drives the expression of the foreign gene in the transgenic plant.
7. The application according to claim 6, characterized in that, The plant is a dicotyledonous plant or a monocotyledonous plant.
8. A method for improving the salt tolerance of plants, characterized in that, comprises the following steps: Construct the promoter of the Fraxinus transcription factor FvCAMTA1 gene into an expression vector to obtain a recombinant expression vector, and then transform the recombinant expression vector into a plant so that the plant carries the promoter of the Fraxinus transcription factor FvCAMTA1 gene, and finally regulate the salt tolerance of the plant by driving the high expression of the target gene.
9. Use of the promoter of the fraxinus transcription factor described in claim 1, the recombinant vector described in claim 3, or the host cell described in claim 4 or 5 to drive the expression of a target gene under salt stress induction. FvCAMTA1 10. The application according to claim 9, wherein, The application refers to driving the expression of the target gene by Fraxinus chinensis under salt stress induction.
Citation Information
Patent Citations
FvMYB1 gene for regulating and controlling salt resistance of fluffy white wax and application thereof
CN103173464A
Expression gene of high-salt stress-induced fraxinus velutina FvNCED3 gene promoter and application thereof
CN106282190A