Panax notoginseng bHLH transcription factor gene PnbHLH2 and application thereof

Abstract

The invention discloses a pseudo-ginseng bHLH transcription factor gene PnbHLH2, the nucleotide sequence of the pseudo-ginseng bHLH transcription factor gene PnbHLH2 is as shown in SEQ ID NO: 1, a bHLH transcription factor is encoded, molecular biology and functional genomics related technologies prove that the PnbHLH2 gene has the capability of improving fungal infection resistance of plants, the PnbHLH2 gene is constructed on a plant expression vector and transferred into tobacco for overexpression, and the yield of the pseudo-ginseng bHLH transcription factor gene PnbHLH2 is improved. Experimental results show that the resistance of the transgenic tobacco overexpressed with the PnbHLH2 to fusarium latericum, fusarium moniliforme, humicola fucoatra and cylindrocarpon destructor is obviously enhanced, and the resistance of the transgenic tobacco overexpressed with the PnbHLH2 to the fusarium latericum, the fusarium moniliforme, the humicola fucoatra and the cylindrocarpon destructor is obviously enhanced. The transgenic tobacco overexpressed with the PnbHLH2 has the advantages that the resistance of the transgenic tobacco overexpressed with the PnbHLH2 to the fusarium latericum, the fusarium moniliforme, the fusarium moniliforme and the cylindrocarpon destructor is obviously improved;

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology and genetic engineering, and particularly relates to a bHLH transcription factor gene of Panax notoginseng with antifungal infection ability. PnbHLH2 and its applications. Background Art

[0002] Pathogen infection has a serious impact on plant growth and development (Wilkinson SW, Mageroy MH, López Sánchez A, et al. Surviving in a hostile world: plant strategies to resist pests and diseases. Annual Review of Phytopathology, 2019, 57: 505-529). Plant diseases can occur throughout the plant production chain and are one of the biggest threats to sustainable development, causing major crops such as rice, wheat, corn, and potatoes to lose 13%-22% of their yield each year (Savary S, Willocquet L, Pethybridge SJ, et al. The global burden of pathogens and pests on major foodcrops. Nature Ecology and Evolution, 2019, 3 (3): 430-439). Fungal diseases are the most common type of plant diseases, accounting for approximately 80%-90% of all disease types. Traditional methods for controlling plant diseases primarily rely on chemical agents, improved cultivation practices, and the breeding of new resistant varieties. While these methods have achieved some success, they still cannot completely resolve the disease problem due to their long breeding cycles, poorly effective cultivation practices, and the potential for environmental pollution and food safety issues caused by chemical agents. With the rapid development of biotechnology, the use of genetic engineering to breed new disease-resistant varieties can not only overcome many of the drawbacks of these control methods, but also minimize damage to beneficial microorganisms in the soil, ultimately achieving sustainable agricultural development.

[0003] During the process of natural selection and biological evolution, plants have developed unique molecular mechanisms for regulating gene expression. These regulatory mechanisms are divided into three levels: transcriptional regulation, post-transcriptional regulation, and translational regulation. Transcription factors (TFs) are proteins that can bind to specific sequences upstream of genes and regulate gene transcription. There are many transcription factor protein families in plants, including bHLH, bZIP, Zinc-finger, and MYB, among which bHLH transcription factors have attracted much attention. Typical plant transcription factors generally consist of four functional regions, namely the DNA-binding domain, the transcription regulation domain, the nucleus localization signal, and the oligomerization site (Chen Xia, Luo Shiqiao, Duan Cuifang, et al. Research Progress on Transcription Factors in Higher Plants. Anhui Agricultural Science Bulletin, 2008, 14 (9): 48-52, 65). Overexpression of a disease-resistant transcription factor gene in plants through genetic engineering is equivalent to the introduction of multiple disease-resistant genes, thereby improving comprehensive disease resistance. Therefore, transcription factors have become a research hotspot in plant disease-resistant genetic engineering in recent years. There are approximately 58 transcription factor families in plants, of which six transcription factor families, AP2 / ERF (APETALA2 / ethyleneresponsive factor), bHLH (basic helix-loop-helix), MYB, NAC [NAM (no apicalmeristem), ATAF1 / 2 (Arabidopsis transcription activation factor), CUC2 (cup-shaped cotyledon)], WRKY, and bZIP (basic leucine zipper), are involved in responses to biotic and abiotic stresses (Ng DW, Abeysinghe JK, Kamali M. Regulating the regulators: the control of transcription factors in plant defense signaling. International journal of molecular sciences, 2018, 19 (12): 3737).

[0004] bHLH is one of the largest transcription factor families in plants (Zhang Z, Chen J, Liang C, et al. Genome-wide identification and characterization of the bHLH transcriptionfactor family in pepper ( Capsicum annuum L.). Frontiers in Genetics, 2020,11: 570156), named because of the basic helix-loop-helix (bHLH) conserved domain in its protein structure (WangL, Xiang L, Hong J, et al. Genome-wide analysis of bHLH transcription factorfamily reveals their involvement in biotic and abiotic stress responses inwheat ( Triticum aestivumL.). 3 Biotech, 2019, 9 (6): 236). A typical bHLH contains a highly conserved bHLH domain consisting of approximately 60 amino acids. This domain has two functionally distinct regions: the basic region on the N-terminal side and the HLH region on the C-terminal side (Carretero-Paulet L, Galstyan A, Roig-Villanova I, et al. Genome-wide classification and evolutionary analysis of the bHLH familyof transcription factors in Arabidopsis, poplar, rice, moss, and algae. Plant Physiology, 2010, 153 (3): 1398-1412). The basic region consists of 13-17 amino acids and is involved in DNA binding (Blanc-Mathieu R, Dumas R, Turchi L, et al. Plant-TFClass: a structural classification for plant transcription factors. Trends in Plant Science,2024, 29 (1): 40-51). The bHLH region is usually composed of two amphipathic α-helices separated by variable loops, and the hydrophobic contacts between the helices mediate the formation of homo- and / or heterodimers between bHLH proteins (Pires N, Dolan L. Origin and diversification of basic-helix-loop-helix proteins in plants. Molecular Biology Evolution, 2010, 27 (4): 862-874).

[0005] The bHLH family has been shown to be an important regulatory factor in plant defense responses. bHLH transcription factors regulate the biosynthesis of secondary metabolites such as flavonoids, anthocyanins, glucosinolates, diterpenoid phytoalexins and saponins, thereby regulating plant defense responses (Meraj TA, Fu J, Raza MA, et al. Transcriptional factorsregulate plant stress responses through mediating secondary metabolism. Genes(Basel), 2020, 11 (4): 346). Chrysanthemum CmbHLH18 Heterologous overexpression of CmbHLH enhances Arabidopsis resistance to necrotrophic fungi by enhancing callose deposition, preventing spore entry into leaves, reducing ROS accumulation, increasing the activities of antioxidant and defense enzymes, and promoting the expression of resistance-related genes (Ding Y, Wang X, Wang D, et al. Identificationof CmbHLH transcription factor family and excavation of CmbHLHs resistant tonecrotrophic fungus Alternaria in Chrysanthemum . Genes (Basel), 2023, 14 (2): 275). Transcription factors GhPAS1 Silencing of GhPAS1 increased cotton susceptibility to Verticillium wilt, whereas its overexpression enhanced cotton resistance to Verticillium dahliae (Zhang J, Gu M, Wu H, et al. GhPAS1, a bHLH transcriptionfactor in upland cotton ( Gossypium hirsutum ), positively regulates Verticillium dahlia resistance. Industrial Crops and Products, 2023, 192:116077).

[0006] Panax notoginseng Panax notoginseng (Burk.) FH Chen] is an Araliaceae ( Araliaceae) Ginseng Panax ) is a perennial herb and a traditional precious medicinal material in my country. It has the effects of promoting blood circulation, removing blood stasis, and reducing inflammation and relieving pain (Xie W, Meng X, Zhai Y, et al. Panax Notoginsengsaponins: A review of its mechanismsof antidepressant or anxiolytic effects and network analysis onphytochemistry and pharmacology. Molecules, 2018, 23 (4): 940). However, Panax notoginseng has a long growth cycle and is vulnerable to a variety of diseases during cultivation, especially those caused by Fusarium solani ( Fusarium solani ) and other fungi, which seriously reduce the yield and quality of Panax notoginseng (Fan ZY, Miao CP, Qiao XG, et al. Diversity, distribution, and antagonistic activities of rhizobacteria of Panax notoginseng Journal of Ginseng Research, 2016, 40 (2): 97-104). Currently, there is a lack of high-disease-resistant, stable, and excellent Panax notoginseng varieties in production. The bHLH family of transcription factors plays an important role in plant defense responses, so the discovery and functional analysis of bHLH genes in Panax notoginseng has important research and application value. Summary of the Invention

[0007] The present invention provides a panax notoginseng bHLH transcription factor gene PnbHLH2 And its application in improving tobacco's resistance to Fusarium rubrum, Fusarium rubrum, Humicola rufina and Cylindrospermum destructans.

[0008] The present invention clones the transcription factor gene from Panax notoginseng PnbHLH2 , PnbHLH2 The nucleotide sequence is shown in SEQ ID NO: 1. The open reading frame of the gene is 408 bp and encodes a protein with the amino acid sequence shown in SEQ ID NO: 2.

[0009] The present invention separates and clones the transcription factor gene of Panax notoginseng PnbHLH2 The complete cDNA fragment of Agrobacterium tumefaciens ( Agrobacterium tumefaciens ) mediated the transfer of the target gene into the recipient plant and overexpressed it. Further experiments were conducted to verify whether the gene had the ability to enhance the antifungal activity of the plant, laying the foundation for the subsequent use of the gene to improve the ability of tobacco and other plants to resist fungal diseases. The inventors named this gene PnbHLH2 .

[0010] above PnbHLH2The gene is used to improve tobacco's resistance to Fusarium rubrum, Fusarium rubrum, Humicola rufina, and Cylindrospermum destructum. The specific operation is as follows: (1) Using amplification PnbHLH2 Total RNA was extracted from the roots of Panax notoginseng using specific primers and amplified by reverse transcription-polymerase chain reaction (RT-PCR). PnbHLH2 The coding region of the target gene was then ligated into the pGEM-T vector and cloned by sequencing to obtain the target gene. (2) Use restriction endonucleases Eco RI and Bam HI digested pGEM-T- PnbHLH2 The target gene fragment was obtained by gel recovery, and the plant expression vector pCAMBIA2300S was digested with the same endonuclease, and the desired large vector fragment was obtained by gel recovery. PnbHLH2 The gene fragment was connected with the pCAMBIA2300S fragment to construct a plant overexpression vector, and then the constructed recombinant vector was transformed into tobacco for expression through Agrobacterium tumefaciens-mediated transformation; (3) Transformants were screened using the resistance markers on the recombinant vector T-DNA, and true transgenic plants were obtained through PCR testing. The ability of transgenic plants to resist fungal infection was analyzed, and finally transgenic plants with significantly enhanced resistance to Fusarium rubrum, Fusarium rubrum, Humicola rufina, and Cylindrospermum destructum were screened.

[0011] The present invention provides a new method for improving plant resistance to fungal diseases. Cultivating disease-resistant plants through genetic engineering can overcome the shortcomings of traditional breeding, shorten the breeding cycle, and simplify the operation, making it easy to obtain highly resistant materials. PnbHLH2 This gene enhances plant resistance to Fusarium rubrum, Fusarium rubrum, Humicola rufina, and Cylindrospermum destructans. Introducing this gene into tobacco can produce new fungus-resistant varieties and materials. The use of genetic engineering to cultivate resistant plant varieties and materials has significant advantages and irreplaceable importance. It not only facilitates the large-scale production of crops, medicinal herbs, and horticultural plants, significantly reducing the use of chemical pesticides, but also saves costs in agricultural production and reduces environmental pollution. Therefore, this invention has broad market application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 This invention PnbHLH2PCR detection results of transgenic tobacco genomic DNA. The marker in the figure is DL2000 DNA Marker (Takara Biotechnology (Dalian) Co., Ltd., China), which consists of five DNA fragments of 2,000 bp, 1,000 bp, 750 bp, 500 bp, and 250 bp; the positive control is plasmid pGEM-T- PnbHLH2 The negative control is the PCR product with sterile water as the template; WT is the PCR product with total DNA of non-transgenic tobacco (wild type) as the template; Figure 2 It is part of the positive PnbHLH2 Genetically modified tobacco PnbHLH2 The results of expression analysis at the transcriptional level are shown in the figure, where WT is non-transgenic tobacco (wild type), 2-1, 2-4, 2-7, 2-9, 2-10, 2-12, 2-14, 2-17, 2-18, 2-19, 2-20, and 2-21 are PnbHLH2 genetically modified tobacco; Figure 3 This invention PnbHLH2 The results of disease resistance identification of transgenic tobacco are shown in Figure a, tobacco leaves inoculated with Fusarium rubrum; Figure b, tobacco leaves inoculated with Fusarium rubrum; Figure c, tobacco leaves inoculated with Humicola rufa; Figure d, tobacco leaves inoculated with Cylindrospermum destructans; WT is wild-type tobacco; 2-4, 2-9, and 2-17 are PnbHLH2 Transgenic tobacco lines. DETAILED DESCRIPTION

[0013] The present invention is further described in detail below through the accompanying drawings and examples, but the scope of protection of the present invention is not limited to the contents described above. The methods in the examples are conventional methods unless otherwise specified, and the reagents used are conventional commercial reagents or reagents prepared according to conventional methods unless otherwise specified.

[0014] Example 1: PnbHLH2 Gene cloning and sequence analysis The roots of Panax notoginseng were ground into powder using liquid nitrogen 12 hours after inoculation with Fusarium solani. The powder was then transferred into a centrifuge tube. Total RNA was extracted using the guanidine isothiocyanate method. The RNA was extracted using Go Script TMThe Reverse Transcriptase System uses total RNA as a template to synthesize the first-strand cDNA. The reaction system and operation process are as follows: take 5 μg of total RNA, add 1 μL Oligo dT15 primer and 1 μL Random primer in sequence, and fill the reaction volume to 10 μL with Nuclease-Free Water; mix well, heat denaturation at 70°C for 5 minutes, and then quickly cool on ice for 5 minutes, then add 4 μL 5× Reaction Buffer, 4 μL MgCl2 (25 mM), 1 μL PCR Nucleotide Mix, 0.4 μL Recombinant RNAsin ® Ribonuclease Inhibitor, 0.4 μL Reverse Transcriptase, 1.2 μL Nuclease-Free Water, mix well and centrifuge briefly, let stand at 25°C for 5 min, incubate at 42°C for 1.5 h, remove and heat at 70°C for 10 min to terminate the reaction; after first-strand cDNA synthesis, store at -20°C until use.

[0015] Amplify the target gene using the synthesized first-strand cDNA as a template PnbHLH2 The upstream and downstream primer sequences used were 5'ATGATGGAACATAAAAGAAGCCCC3' and 5'GTATTTGGGGGAAGTAGTCTTGATAG3', respectively. The target gene was amplified using TAKARA ExTaq®. PCR reaction conditions were 94°C for 5 min, 94°C for 30 s, 57°C for 30 s, and 72°C for 30 s (32 cycles), and 72°C for 5 min. The reaction system (50 μL) consisted of 2 μL cDNA, 5 μL 10× Ex Taq Buffer (containing MgCl2). 2+ 20 mM), 4 μL dNTP Mix (2.5 mM each), 1 μL upstream primer (5 μM), 1 μL downstream primer (5 μM), 0.25 μL TaKaRa Ex Taq (5 U / μL), and 36.75 μL ddH2O. After PCR, 8 μL was subjected to 1.2% agarose gel electrophoresis to verify the specificity and size of the amplified product.

[0016] The PCR product obtained had only one DNA band. The PCR amplification product was recovered by gel excision using the SanPrep column PCR product purification kit (Shanghai Bioengineering). TA cloning was performed using the pGEM-T Vector System Ⅰ (TaKaRa). The reaction system and operation process were as follows: 4 μL of PCR product was added in sequence to 0.7 μL of pGEM-T vector, 0.9 μL of T4 DNA Ligase, and 5 μL of 2×Rapid Ligation Buffer. After mixing, the reaction was incubated at 16°C overnight. The ligation product was transformed into Escherichia coli DH5α using the heat shock transformation method. Positive clones were screened using LB solid medium containing ampicillin (Amp). Several single colonies were selected and amplified using amplification. PnbHLH2 The specific primers identified the inserted PnbHLH2 The clones identified were sequenced and the final PnbHLH2 The full-length cDNA is 408 bp (see SEQ ID NO: 1), encoding a protein containing 135 amino acids with a molecular weight of approximately 14.88 kDa and an isoelectric point of approximately 9.67. PnbHLH2 The protein sequence encoded by the gene was tested to see if it had a signal peptide. PnbHLH2 There is no signal peptide, and subcellular localization predicts that it is localized to the nucleus.

[0017] Example 2: Construction of plant overexpression vector pGEM-T- PnbHLH2 and the plant expression vector pCAMBIA2300S plasmid, and 1 μL was used for agarose gel electrophoresis to detect the integrity and concentration of the extracted plasmid. Eco RI (TaKaRa, Japan) and Bam HI (TaKaRa, Japan) were used to treat plasmid pGEM-T- PnbHLH2 and pCAMBIA2300S for double enzyme digestion (50 μL system). The reaction system and operation process are as follows: take 20 μL pGEM-T- PnbHLH2 or pCAMBIA2300S plasmid, add 7.5 μL 10×K buffer, 2.5 μL Eco RI, 2.5 μL Bam HI, 17.5 μL ddH2O, mix well, centrifuge briefly, and place at 37℃ for 3 h. All enzyme digestion products were spotted on agarose gel for electrophoresis, and thenPnbHLH2 The fragment and the large fragment of the pCAMBIA2300S vector were separately recovered from gels using the SanPrep Column DNA Gel Extraction Kit (Shanghai, China). 1 μL of the recovered product was analyzed by agarose gel electrophoresis to determine the size and concentration of the recovered fragments and stored at -20°C until further use.

[0018] The recovered PnbHLH2 The DNA fragment and the pCAMBIA2300S vector fragment were connected. The reaction system (20 μL) and the operation process were as follows: take 10 μL PnbHLH2 The DNA fragment was added to 2 μL of pCAMBIA2300S vector DNA, 2 μL of 10×T4 DNA Ligase Buffer, 1 μL of T4 DNA Ligase, and 5 μL of ddH2O in sequence. After mixing, the mixture was centrifuged briefly and then reacted in a 16°C water bath overnight. The ligation product was then transformed into E. coli DH5α using the heat shock method. Positive clones were screened using solid medium containing 50 mg / L kanamycin (Km). Single colonies were selected and shaken, and the bacterial solution was used as a template for amplification. PnbHLH2 PCR was performed using specific primers to select PnbHLH2 For clones successfully connected to pCAMBIA2300S, if the strain tested was positive, glycerol was added and stored at -80°C for future use.

[0019] Extract and purify the pCAMBIA2300S- PnbHLH2 The plant expression vector pCAMBIA2300S- was then constructed using the liquid nitrogen freeze-thaw method. PnbHLH2 Transform into Agrobacterium tumefaciens LBA4404 competent cells. The operation steps are as follows: take 2 μg pCAMBIA2300S- [[ID= Add the plasmid to a centrifuge tube containing 100 μL competent cells, mix gently, and place on ice for 5 minutes. Then transfer to liquid nitrogen and freeze for 5 minutes. Then quickly place in a 37°C water bath for 5 minutes. Immediately after that, place on ice for 5 minutes. Add 800 μL LB liquid culture medium and shake culture at 28°C for 2-3 hours. Spread the activated Agrobacterium on LB solid medium containing 50 mg / L Km and culture statically at 28°C. Select a single colony and shake the bacteria. Then use amplification ​ PCR was performed using specific primers to detect pCAMBIA2300S- ​ Whether to transform into Agrobacterium, for positive clones, add glycerol and store at -80℃ for later use.

[0020] Example 3: Agrobacterium-mediated plant genetic transformation and transgenic plant screening The transgenic recipient of this experiment was tobacco. Tobacco seeds were soaked in 75% alcohol for 30 seconds, washed with sterile water, and then soaked in 0.1% HgCl2 for 8 minutes. Then, they were washed several times with sterile water and sown on 1 / 2 MS medium. They were cultured in the dark at 28°C for 6 days. After germination, they were transferred to a light incubator (25°C, 16 h / d light) and subcultured once a month using 1 / 2 MS medium.

[0021] Take out the pCAMBIA2300S- ​ Agrobacterium tumefaciens LBA4404, carrying the plasmid, was inoculated into 5 mL of LB liquid medium containing 50 mg / L Km and 20 mg / L rifampicin and cultured at 28°C until the medium became turbid. 1 mL of the turbid bacterial solution was transferred to LB solid medium containing 50 mg / L Km and cultured at 28°C for 48 h. An appropriate amount of Agrobacterium was then scraped from the LB solid medium and inoculated into MGL liquid medium supplemented with 20 mg / L acetosyringone. The culture was shaken at 28°C for 2-3 h to activate the Agrobacterium.

[0022] Take the leaves of sterile tobacco seedlings and cut them into 1 cm 2 The leaf discs were completely immersed in the MGL liquid culture medium containing activated Agrobacterium for 15 min. The bacterial liquid on the surface of the leaves was dried with sterile filter paper. The leaf discs were placed on the co-culture medium for room temperature culture. The co-culture medium for tobacco transformation was MS + 0.02 mg / L 6-BA + 2.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar. The culture was carried out in the dark at 22°C for 2 days.

[0023] After co-cultivation, leaf discs were transferred to MS selection medium supplemented with antibiotics to differentiate into seedlings, and transgenic plants were screened simultaneously. The tobacco selection medium consisted of MS + 0.5 mg / L 6-BA + 0.1 mg / L NAA + 30 g / L sucrose + 6 g / L agar + 50 mg / L Km + 200 mg / L cefotaxime sodium salt (Cef). For selection, the culture flasks were transferred to a light incubator (25°C, 16 h / d light, 8 h / d dark). After tobacco buds emerged, they were subcultured in MS medium supplemented with 50 mg / L Km and 200 mg / L Cef. Regenerated tobacco seedlings were transferred to MS medium supplemented with 50 mg / L Km to allow rooting. Rooted regenerated seedlings were then selected for PCR analysis.

[0024] The genomic DNA of the transgenic tobacco plant leaves was extracted by CTAB method. 1 μL of the extracted genomic DNA was tested for its integrity and concentration by agarose gel electrophoresis. The genomic DNA of the transgenic plant was used as a template for amplification. ​ After the PCR was completed, 8 μL of the product was used for agarose gel electrophoresis to detect positive transgenic plants. The amplification results of some tobacco transgenic plants are shown in Figure 2. ​ As shown, a total of 19 positive transgenic plants were screened.

[0025] Example 4: Transgenic tobacco ​ Expression analysis Total RNA was extracted from the young leaves of positive transgenic plants and non-transgenic tobacco (wild type), and reverse transcribed to generate the first chain of cDNA, which was used as a template for amplification. ​ Real-time fluorescence quantitative PCR (qPCR) was performed using specific primers, and the expression of 5-mercaptoethanol in each transgenic plant was analyzed based on the qPCR results. ​ Transcriptional expression levels; total RNA extraction and reverse transcription methods were the same as in Example 1; the qPCR system consisted of 1.0 μL cDNA, 10 μL 2× Go Taq® qPCR Master Mix, 0.2 μL CXR Reference Dye, 7.6 μL RNase-Free ddH2O, 0.6 μL Primer QF (10 mM), and 0.6 μL PrimerQR (10 mM). qPCR reactions were performed using the following parameters: 95°C for 2 min; 95°C for 5 s; and 60°C for 30 s (40 cycles). The qPCR reaction for each sample was repeated three times. ​ The expression level was 2 -ΔΔCt The test results of some individual plants are as follows ​ shown.

[0026] Example 5: ​ Functional analysis of fungal resistance in transgenic tobacco The laboratory-stored Fusarium rubrum, Fusarium rubrum, Humicola rutaecarpa and Cylindrospermum spp. were inoculated on PDA solid medium (200 g / L potato / carrot, 15 g / L agar, 20 g / L glucose) and cultured in the dark at 28°C for 7 days. ​The transgenic tobacco leaves were cut from the petiole with surgical scissors. A sterile plastic gun tip was used to create wounds of the same size at approximately the same position on the leaves, and equal-sized mycelial blocks of Fusarium rubrum, Fusarium rubrum, Humicola rufina, and Cylindrospermum destructum were inoculated. The inoculated leaves were placed on filter paper soaked with sterile water and cultured in a light incubator at 28°C. Sterile water was added every day to keep them moist. After 7 days of culture, the leaves were collected and the disease conditions of the leaves of each strain were observed. The results are as follows. ​ As shown in the figure, after being inoculated with Fusarium rubrum, Fusarium rubrum, Humicola rufa and Cylindrospermum spp., the leaves of wild-type tobacco developed large lesions, while the symptoms of transgenic tobacco leaves were very mild, and the area of ​​lesions was much smaller than that of wild-type tobacco. Obviously, ​ The transgenic tobacco showed significant resistance to Fusarium rubrum, Fusarium rubrum, Humicola rufipogon and Cylindrospermum destructum.

Claims

1. A Panax notoginseng bHLH transcription factor gene PnbHLH2 , characterized in that: Its nucleotide sequence is shown in SEQ ID NO:

1.

2. The application of the Panax notoginseng bHLH transcription factor gene according to claim 1 PnbHLH2 in improving the resistance of tobacco to Fusarium lateritium Fusarium lateritium Fusarium incarnatum Fusarium incarnatum Humicola fuscoatra Humicola fuscoatra Cylindrocarpon destructans and Cylindrocladium destructans

Images