Application of OSbZIP39 gene in regulating rice grain size

By inhibiting the OsbZIP39 gene and using CRISPR/Cas9 technology to edit the rice genome, the problem of rice grain size regulation is solved, the grain size is increased, and yield and quality are improved.

CN120249376BActive Publication Date: 2025-08-29HAINAN UNIVERSITY SANYA NANFAN RESEARCH INSTITUTE +1
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510749560.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-06
Publication Date
2025-08-29
Estimated Expiration
2045-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to effectively regulate the size of rice grains, resulting in limited yield and quality.

Method used

By inhibiting the expression or activity of the OsbZIP39 gene, the rice genome was edited using CRISPR/Cas9 technology to construct rice varieties with increased grain size.

Benefits of technology

Significantly increase the size of rice grains, cultivate new rice varieties with large and full grains, and improve yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249376B_ABST
    Figure CN120249376B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of modern agricultural technology and specifically relates to <h2 style=";text-align:left;direction:ltr">OSbZIP39 The application of genes in regulating rice grain size. <h2 style=";text-align:left;direction:ltr"> OsbZIP39 The application of genes in regulating rice grain size is <h2 style=";text-align:left;direction:ltr"> OsbZIP39 Gene editing can significantly increase the size of rice grains, producing rice with large grains. This invention provides a simple and effective technical means for rapidly creating new rice varieties with large grains.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of modern agricultural technology and specifically relates to OSbZIP39 Application of genes in regulating rice grain size. Background Art

[0002] Rice grain size is one of the key agronomic traits that determines rice yield and quality. In agricultural production, larger and fuller grains generally lead to higher yield and better rice quality.

[0003] Therefore, it is necessary to conduct in-depth research on the regulatory mechanism of rice grain size and develop a method to cultivate new rice varieties with large and full grains. Summary of the Invention

[0004] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0005] The first aspect of the present invention provides an inhibitory OsbZIP39 Application of genes to increase rice grain size, including OsbZIP39 The nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0006] In some embodiments of the present invention, the inhibition OsbZIP39 Gene knockout methods include OsbZIP39 Gene, knockdown OsbZIP39 Genes, or OsbZIP39 Methods for generating inactivating mutations.

[0007] The second aspect of the present invention provides and inhibits OsbZIP39 The use of genetically related biomaterials in developing rice varieties with increased grain size, including OsbZIP39 The nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0008] In some embodiments of the present invention, the application is to construct and inhibit OsbZIP39 Genetically related biological materials to obtain rice varieties with increased grain size.

[0009] In some embodiments of the invention, the biological material does not include propagation material.

[0010] In some embodiments of the present invention, the biological material includes nucleic acid molecules, vectors, and cells.

[0011] In some embodiments of the invention, the nucleic acid molecule comprises an inhibitory OsbZIP39 functional microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotides.

[0012] In some embodiments of the present invention, the sequence of the sgRNA is shown in SEQ ID NO: 5.

[0013] In some embodiments of the present invention, the sgRNA is used in conjunction with a CRISPR / Cas9 vector to achieve the purpose of gene knockout.

[0014] In some embodiments of the present invention, the CRISPR / Cas9 vector further includes an expression vector containing the sgRNA, and of course may also include a Cas9 protein or an expression vector for expressing the Cas9 protein.

[0015] In some embodiments of the present invention, the vector includes but is not limited to pCBC-MT1T2 and other common vectors in the art.

[0016] In some embodiments of the present invention, the cell comprises at least one of Escherichia coli and Agrobacterium tumefaciens, wherein Escherichia coli is a common host cell for constructing vectors and plasmids in the art, and Agrobacterium tumefaciens is a common tool for delivering DNA molecules to plants in the art.

[0017] The third aspect of the present invention provides a method for breeding rice varieties with increased grain size, comprising reducing OsbZIP39 The step of measuring the expression level and / or activity of a gene.

[0018] In some embodiments of the present invention, the rice variety comprises the following characteristic: grain size is increased relative to a reference level; the reference level is a wild-type level.

[0019] In some embodiments of the present invention, the reduction of OsbZIP39 The step of increasing the expression level and / or activity of the gene is to increase the expression level and / or activity of the gene according to the second aspect of the present invention. OsbZIP39 Gene-related biological materials are introduced into rice tissues or rice cells.

[0020] In some embodiments of the invention, the biological material does not include propagation material.

[0021] In some embodiments of the present invention, the introduction method comprises using at least one of Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.

[0022] In some embodiments of the present invention, the step of reducing the expression level and / or activity of the OsbZIP39 protein in rice is specifically:

[0023] (1) Design OsbZIP39 Gene target sequence sgRNA, construct rice OsbZIP39 CRISPR / Cas9 vectors for gene editing.

[0024] (2) The CRISPR / Cas9 vector described in step (1) is transferred into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector.

[0025] (3) Infect the cotyledons of common wild-type rice with the Agrobacterium infection solution obtained in step (3), obtain seedlings again through tissue culture, and screen rice OsbZIP39 A stably inherited mutant strain with a gene mutation, no exogenous Cas9 protein, and a target sequence mutation.

[0026] In some embodiments of the present invention, the vector is pCBC-MT1T2.

[0027] In some embodiments of the present invention, the host cell is Agrobacterium GV3101.

[0028] In some embodiments of the present invention, the rice variety is Zhonghua 11.

[0029] The beneficial effects of the present invention are:

[0030] The present invention has discovered OsbZIP39 The application of genes in regulating rice grain size is OsbZIP39 Gene editing can significantly increase the size of rice grains, producing rice with large grains. This invention provides a simple and effective technical means for rapidly creating new rice varieties with large grains. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0032] Figure 1 for OsbZIP39 Gene structure and knockout target information.

[0033] Figure 2 Figure 2 shows the grain phenotype and statistical results of OsbZIP39, where A is the observation result of rice grain size and B is the statistical result. DETAILED DESCRIPTION

[0034] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0035] Example 1 Construction of CRISPR / Cas9-OsbZIP39 expression vector and acquisition of OsbZIP39 mutants

[0036] from OsbZIP39 Two 20bp target sites were selected from the CDS sequence region of the gene for double target knockout by CRISPR / Cas9. The target sequence was connected to the CRISPR / Cas9 vector by PCR, and then the CRISPR / Cas9-OsbZIP39 vector was transformed into rice Zhonghua 11 by Agrobacterium-mediated transformation. OsbZIP39 Deletion mutant rice.

[0037] OsbZIP39 The genome sequence is:

[0038]

[0039] OsbZIP39 The CDS sequence is:

[0040]

[0041] The protein sequence of OsbZIP39 is:

[0042] N-terminal-MAEPALLDPTAAFDLRLYPAHLFDHELPLAGGGGGDDDDDLPLDGLEFDLPGDF-C-terminal (SEQ ID NO: 3).

[0043] 1. The steps for constructing the CRISPR / Cas9-OsbZIP39 expression vector are as follows:

[0044] For gene editing OsbZIP39 The CRISPR vector for this gene expresses two sgRNAs: sgRNA1 and sgRNA2. The coding sequence of the sgRNA1 recognition region is from positions 322 to 341 of sequence 2 (SEQ ID NO: 2), and the coding sequence of the sgRNA2 recognition region is from positions 353 to 372 of sequence 2 (SEQ ID NO: 2). The two designed sgRNA sequences are shown below:

[0045] sgRNA1:GAGTCGGATGAGGGGAGGAG (SEQ ID NO: 4);

[0046] sgRNA2: ACCCCAAGTGGAGCCTGAAG (SEQ ID NO: 5).

[0047] The primer sequences designed based on sgRNA are as follows:

[0048] BsF:

[0049] ATATATGGTCTCTGGCG GAGTCGGATGAGGGGAGGAG GTTTTAGAGCTAGAAATAGC (SEQ ID NO: 6).

[0050] BsR:

[0051] ATTATTGGTCTCTAAAC CTTCAGGCTCCACTTGGGGT CGCTTCTTGGTGCC (SEQ ID NO: 7).

[0052] PCR amplification was performed using a 100-fold dilution of pCBC-MT1T2 as a template and primers BsF and BsR to generate a PCR product. The PCR product was purified and then reconstructed using the following restriction enzyme digestion and ligation protocol to construct the gene-editing vector CRISPR / Cas9-OsbZIP39 carrying sgRNA1 (GAGTCGGATGAGGGGAGGAG) and sgRNA2 (ACCCCAAGTGGAGCCTGAAG). Vector construction methods were followed as described in the literature (Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. A CRISPR / Cas9 toolkit for multiplex genome editing in plants. BMC Plant Biol. 2014 Nov 29;14:327).

[0053] The enzyme digestion reaction system is shown in Table 1.

[0054] Table 1 Enzyme digestion-ligation system

[0055]

[0056] 2. Identification

[0057] Take 5 μL of the ligation product and transform competent E. coli. Select on LB plates containing 50 μg / mL kanamycin. Identify single clones by colony PCR. Select positive clones, extract plasmids, and send for sequencing. Sequencing results indicate that the plasmid of the positive clone is the recombinant CRISPR vector CRISPR / Cas9-OsbZIP39.

[0058] Example 2 CRISPR / Cas9-OsbZIP39-transformed rice callus and identification of positive seedlings

[0059] 1. Agrobacterium transformation

[0060] The correctly sequenced recombinant vector CRISPR / Cas9-OsbZIP39 was transformed into the competent Agrobacterium GV3101 strain by electroporation, and the bacteria were preserved for future use after verification by colony PCR.

[0061] A single colony of correctly identified Agrobacterium GV3101 / CRISPR / Cas9-OsbZIP39 was inoculated into 2-3 mL of liquid culture medium containing 100 μg / mL kanamycin and 50 μg / mL rifampicin, and cultured overnight at 28°C. The next day, the culture was transferred to a large amount of liquid culture medium containing antibiotics and cultured with shaking. After several transfers, the cells were collected and resuspended to an OD of 600 The recombinant strain GV3101 / CRISPR / Cas9-OsbZIP39 was transformed into Zhonghua 11 using Agrobacterium-mediated transformation. Immature embryos were infected with Agrobacterium tumefaciens GV3101. Embryos infected with GV3101 were screened multiple times on selective medium to obtain resistant calli. These calli were then regenerated into seedlings, yielding T0-generation transformed seedlings. The rice Agrobacterium transformation method was described in (Zhao, W., Zheng, S. & Ling, HQ. An efficient regeneration system and Agrobacterium-mediated transformation of Chinese upland rice culture (Handao 297). Plant Cell Tiss Organ Cult 106, 475–483, 2011).

[0062] 2 OsbZIP39 Identification of mutant T0 generation plants

[0063] DNA was extracted from leaves of T0 transgenic rice plants, and PCR amplification and sequencing were performed using genomic DNA as a template, with Zhonghua 11 as a control. The amplified products were sequenced and compared with the Zhonghua 11 sequence, and the effective mutant lines identified were named OsbZIP39-ko-1 andOsbZIP39-ko-2 .in:

[0064] OsbZIP39-ko-1 The first target site (sgRNA1) remains unchanged, and two bases "TA" are inserted into the second target site (sgRNA2) (i.e., insert bases "TA" between positions 17 and 18 of SEQ ID NO.5, such as Figure 1 ), causing the translation to terminate prematurely, thus OsbZIP39 The mutant strains obtained by gene knockout were OsbZIP39 Gene mutants.

[0065] OsbZIP39-ko-2 The first target site (sgRNA1) remains unchanged, and a base "A" is inserted into the second target site (sgRNA2) (i.e., inserting a base "A" between positions 17 and 18 of SEQ ID NO.5, such as Figure 1 ), causing the translation to terminate prematurely, thus OsbZIP39 The mutant strains obtained by gene knockout were OsbZIP39 Gene mutants.

[0066] Example 3 Verification of the Grain Size Function of OsbZIP39 Gene-Edited Plants from Different Strains

[0067] Select wild type Zhonghua 11 (WT), OsbZIP39-ko strain( ko-1 、 ko-2 ) The plump and normal seeds were used to measure the seed phenotype using a Wanshen seed analyzer.

[0068] The results are as follows Figure 2 As shown in A and B, compared with WT, compared with wild type Zhonghua11, the mutant OsbZIP39-ko-1 The length of the wild type is 105.9%, and OsbZIP39-ko-2 The length of the wild type is 105.7%, which is significantly longer than the wild type. OsbZIP39 Gene can significantly increase rice grain size.

[0069] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. Knockout OsbZIP39 Application of genetic reagents in breeding rice with increased grain size, described OsbZIP39 The nucleotide sequence of the gene is shown in SEQ ID NO: 2; the reagent is: 1) Nucleic acid molecules; The nucleic acid molecule includes a knockout OsbZIP39 Functional CRISPR / Cas9 vector and sgRNA; The sequence of the sgRNA is shown in SEQ ID NO: 5; or 2) a cell comprising the nucleic acid molecule described in 1); The cells are Agrobacterium.

2. A method for breeding rice varieties with increased grain size, comprising knocking out rice OsbZIP39 genetic steps; The rice variety with increased grain size comprises the following characteristics: grain size is increased relative to a reference level; the reference level is the level of the wild type; The knockout rice OsbZIP39 The step of knocking out the gene according to claim 1 OsbZIP39 Gene reagents are introduced into rice tissues or rice cells.

3. The method according to claim 2, wherein: The introduction method includes using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.

Citation Information

Patent Citations

  • Application of rice OsbZIP53 gene or protein coded by rice OsbZIP53 gene in increasing rice yield

    CN116144700A