Breeding method for improving fish muscle fat content and application
The gene editing technology knocked out the fish bone tuning protein gene, forming a frameshift mutation or termination of translation early, solving the problem of low muscle fat content in fish, achieving a significant increase in muscle fat content, and improving the taste and nutritional value of fish products.
Patent Information
- Application Number
- CN202510343438.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art is difficult to effectively increase the fat content in fish muscles, affecting the taste and nutritional value of fish products.
Gene editing technology is used to knock out the osteopin gene of fish, so that it forms a frameshift mutation or terminates translation early, and obtains the osteopin gene mutant. The target site is designed through the CRISPR/Cas9 system and microinjected to obtain a new fish species with high muscle fat content.
Significantly improve the fat content in fish muscles, improve the taste and nutritional value of fish products, and do not affect the growth rate and health of fish.
Smart Images
Figure CN120249383A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of gene editing breeding, and specifically relates to a breeding method and application for increasing the muscle fat content of fish. Background Art
[0002] Fat is composed of fatty acids and glycerol, also known as triglyceride, which is a form for the body to store fatty acids. Fatty acids are the most important components of fat and one of the main energy sources of the body. Fatty acids are not only important precursor substances for meat flavor, but also nutrients that the human body cannot synthesize and must rely on food supply.
[0003] From a nutritional perspective, the fatty acids stored in the muscle fat of fish are mainly polyunsaturated fatty acids, which play an important role in the normal operation of the body. From a taste perspective, the muscle fat of fish has a better taste than the intramuscular fat, and the increase in muscle fat content has a greater effect on improving the quality of fish products such as sashimi, steamed fish, and pickled fish.
[0004] In view of this, it is necessary to breed new fish varieties with high muscle fat content to meet the actual needs. Summary of the Invention
[0005] In view of the technical problems in the background art, the present application provides a breeding method and application for increasing the muscle fat content of fish. The present application uses the osteomodulin gene of fish as the gene target for regulating the muscle fat content of fish, and effectively increases the fat content in the muscle tissue of fish by knocking out the osteomodulin gene.
[0006] In a first aspect, an embodiment of the present application provides a breeding method for increasing the muscle fat content of fish, including the following steps:
[0007] Using gene editing technology to knock out the osteomodulin gene of fish, so that the osteomodulin gene forms a frameshift mutation or terminates translation prematurely, to obtain an osteomodulin gene mutant.
[0008] In some embodiments, the fish is a cyprinid fish.
[0009] In some embodiments, the cyprinid fish is zebrafish, common carp or grass carp.
[0010] In some embodiments, the coding region sequence of the osteomodulin gene of the zebrafish is as shown in SEQ ID NO:1.
[0011] In some embodiments, the coding region sequence of the osteomodulin gene of the common carp is as shown in SEQ ID NO:2.
[0012] In some embodiments, the coding region sequence of the osteomodulin gene of the grass carp is as shown in SEQ ID NO:3.
[0013] In some embodiments, the osteomodulin gene mutant is a homozygous mutant of the osteomodulin gene or a chimeric mutant of the osteomodulin gene.
[0014] In some embodiments, the steps for obtaining the homozygous mutant of the osteomodulin gene include:
[0015] S1. Using gene editing technology to knockout the osteomodulin gene of fish to obtain F0 generation individuals with chimeric mutations of the osteomodulin gene;
[0016] S2. Crossing the F0 generation individuals with wild-type fish to obtain an F1 generation strain;
[0017] S3. Self-crossing the F1 generation strain and screening the homozygous mutant of the osteomodulin gene as F2 generation individuals.
[0018] In some embodiments, the use of gene editing technology to knockout the osteomodulin gene of fish includes the following steps:
[0019] S11. Based on the CRISPR / Cas9 system, designing an editing target site for the osteomodulin gene of fish;
[0020] S12. Designing corresponding primers according to the editing target site of the osteomodulin gene of fish and synthesizing an amplification fragment containing the editing target site of the osteomodulin gene of fish, denoted as gRNA;
[0021] S13. Preparing Cas9 mRNA by in vitro transcription;
[0022] S14. Preparing an injection mixture containing the gRNA and the Cas9 mRNA and performing microinjection on the fertilized eggs of fish with the injection mixture.
[0023] In a second aspect, the embodiments of the present application also provide the application of the above method in fish breeding.
[0024] The beneficial effects of the present application are:
[0025] By knocking out the osteomodulin gene of fish through gene editing, the present application can significantly increase the muscle fat content of fish, and the growth of fish is not affected. This osteomodulin gene can be used as a gene target for genetic breeding and gene editing breeding, which is of great significance for cultivating new fish varieties with high muscle fat content.
[0026] The above description is only an overview of the technical solution of the present application. In order to better understand the technical means of the present application, it can be implemented according to the content of the specification. In order to make the above and other purposes, features, and advantages of the present application more obvious and understandable, the following specific embodiments of the present application are given. Brief Description of the Drawings
[0027] In order to more clearly illustrate the technical solution of the present application, the drawings used in the present application will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0028] Figure 1 It is a comparison diagram of the gene mutation situations between the homozygous mutant of the zebrafish osteomodulin gene and the wild-type zebrafish in Example 1 of the present application;
[0029] Figure 2 It is a comparison diagram of the fat content and body length and weight at different parts between the homozygous mutant of the zebrafish osteomodulin gene and the wild-type zebrafish in Example 1 of the present application;
[0030] Figure 3 It is a schematic diagram of the editing target site and primer design of the osteomodulin gene of the common carp in Example 2 of the present application;
[0031] Figure 4 It is a schematic diagram of the editing target site and primer design of the osteomodulin gene of the grass carp in Example 3 of the present application;
[0032] Figure 5 It is a comparison diagram of the muscle fat content between the chimeric mutants of the osteomodulin gene of the common carp and the grass carp and the wild-type common carp and grass carp in Examples 2-3 of the present application. Detailed Embodiments
[0033] The embodiments of the technical solution of the present application will be described in detail below with reference to the drawings. The following embodiments are only used to more clearly illustrate the technical solution of the present application, so they are only examples and cannot be used to limit the protection scope of the present application.
[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs; the terms used herein are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "including" and "having" and any variations thereof in the specification and claims of this application and the above description of the drawings are intended to cover non-exclusive inclusion.
[0035] References to "embodiments" in this specification mean that specific features, structures, or characteristics described in connection with the embodiments can be included in at least one embodiment of the present application. The phrase appears in various places in the specification and does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment mutually exclusive with other embodiments. It is explicitly and implicitly understood by those skilled in the art that the embodiments described herein can be combined with other embodiments.
[0036] In order to breed new fish varieties with high muscle fat content, the present application has discovered a gene locus that can regulate the fat content in fish muscle, and this gene is negatively correlated with the synthesis and accumulation of fat in fish muscle tissue. This gene is the osteomodulin gene of fish (osteomodulin, i.e., the omd gene). Based on the discovery in the present application, this gene can be applied to the regulation of fish muscle fat content and is specifically used to increase the fish muscle fat content.
[0037] Specifically, in a first aspect, the embodiments of the present application provide a breeding method for increasing the fish muscle fat content, including the following steps:
[0038] Using gene editing technology to knockout the osteomodulin gene of fish, so that the osteomodulin gene forms a frameshift mutation or terminates translation prematurely, to obtain an osteomodulin gene mutant.
[0039] In the technical solution of the embodiments of the present application, by using gene editing to knockout the osteomodulin gene of fish, the osteomodulin gene forms a frameshift mutation or terminates translation prematurely. The muscle fat content in the obtained osteomodulin gene mutant can be significantly increased compared with that of conventional fish with an unmutated osteomodulin gene, and the growth of the fish is not affected.
[0040] Further, in some embodiments, the fish targeted is a Cyprinidae fish, more preferably zebrafish, common carp or grass carp.
[0041] More specifically, the coding region sequence of the osteomodulin gene of zebrafish is as shown in SEQ ID NO:1, the coding region sequence of the osteomodulin gene of common carp is as shown in SEQ ID NO:2, and the coding region sequence of the osteomodulin gene of grass carp is as shown in SEQ ID NO:3, specifically as follows:
[0042] Further, in some embodiments, the osteomodulin gene mutant is a homozygous mutant of the osteomodulin gene or a chimeric mutant of the osteomodulin gene. For example, the osteomodulin gene mutant with a high muscle fat content can be a homozygous mutant of the osteomodulin gene of zebrafish or a chimeric mutant of the osteomodulin gene of common carp and grass carp.
[0043] Furthermore, in some embodiments, by using gene editing technology to knockout the osteocalcin gene in fish, F0 individuals with chimeric mutations in the osteocalcin gene can be screened; if individuals with homozygous mutations in the osteocalcin gene need to be screened, the following steps can be adopted:
[0044] S1. Use gene editing technology to knockout the osteocalcin gene in fish to obtain F0 individuals with chimeric mutations in the osteocalcin gene;
[0045] S2. Cross the F0 individuals with wild-type fish to obtain the F1 line;
[0046] S3. Self-cross the F1 line and screen for homozygous mutants of the osteocalcin gene as F2 individuals.
[0047] Furthermore, in some embodiments, using gene editing technology to knockout the osteocalcin gene in fish includes the following steps:
[0048] S11. Based on the CRISPR / Cas9 system, design the editing target site for the osteocalcin gene in fish;
[0049] S12. Design corresponding primers according to the editing target site of the osteocalcin gene in fish and synthesize an amplification fragment containing the editing target site of the osteocalcin gene in fish, denoted as gRNA;
[0050] S13. Prepare Cas9 mRNA by in vitro transcription;
[0051] S14. Prepare an injection mixture containing the gRNA and the Cas9 mRNA, and microinject the fertilized eggs of fish with the injection mixture.
[0052] Among them, for the gene editing of the osteocalcin gene in fish, by using target site design, the osteocalcin gene is caused to form a frameshift mutation or premature termination of translation, so that the osteocalcin gene loses its function and undergoes an effective mutation to increase the fat content in the muscle tissue of fish.
[0053] In a second aspect, an embodiment of the present application provides an application of a breeding method for increasing the muscle fat content of fish in fish breeding.
[0054] In the technical solution of the embodiment of the present application, the breeding method for increasing the muscle fat content of fish provided by the embodiment of the present application can breed fish with higher muscle fat content due to mutations in the osteocalcin gene, which is of great significance for fish breeding.
[0055] Some specific embodiments are listed below. It should be noted that the embodiments described below are exemplary and are only used to explain the present application, and should not be construed as a limitation of the present application. For those technologies or conditions not specified in the embodiments, they shall be carried out according to the technologies or conditions described in the literature in this field or according to the product specifications. For reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.
[0056] Example 1
[0057] In this embodiment, a breeding method for increasing the muscle fat content of fish is provided for zebrafish, which specifically includes the following steps:
[0058] S1. Using gene editing technology to knockout the osteocalcin gene of fish to obtain F0 generation individuals with chimeric mutations in the osteocalcin gene. The specific steps are as follows:
[0059] S11. Clone the coding region sequence of the osteocalcin gene of zebrafish, and design the editing target sites of the zebrafish osteocalcin gene based on the CRISPR / Cas9 system.
[0060] Among them, the coding region sequence of the osteocalcin gene of zebrafish is shown in SEQ ID NO:1, and the designed editing target sites of the zebrafish osteocalcin gene are located on exon 1 and exon 2 respectively. Among them, the sequence of the first target site is: CCACTTGTACATCCAGCA; the sequence of the second target site is: CCACCCAAATATGCTGACCTACA.
[0061] S12. Design corresponding primers according to the above zebrafish osteocalcin gene editing target sites, and synthesize the amplification fragment gRNA containing the above zebrafish osteocalcin gene editing target sites.
[0062] Among them, the sequences of the upstream cloning primer and the downstream cloning primer of the first target site are: GCTCCACCACTTTCTGTAAC, GAGAAGGGATGTCTTCCAGA; the sequences of the upstream cloning primer and the downstream cloning primer of the second target site are: CCTCATCTTGTTGCAGATCTG, GCATGACACATCTCAGACCT. Dilute the concentration of gRNA to 250 ng / μL and store it at -80 °C for standby.
[0063] S13. Using the linearized Cas9 plasmid as a template, transcribe Cas9 mRNA in vitro, dilute its concentration to 750 ng / μL, and store it at -80 °C for standby.
[0064] S14. Mix 2 μL of the gRNA obtained in step S12, 2 μL of the Cas9 mRNA obtained in step S13 with 1 μL of water to obtain an injection mixture. The injection concentration of the gRNA is 100 ng / μL, and the injection concentration of the Cas9 mRNA is 300 ng / μL; collect the fertilized eggs of zebrafish, and inject the prepared injection mixture into the fertilized eggs at the 1- or 2-cell stage through a microinjector, with an injection volume of 1 nL.
[0065] S15. Incubate and cultivate the injected fertilized eggs. After they grow for 2 months, cut the tail fins to screen out the F0 generation individuals with osteomodulin gene mutations.
[0066] S2. Cross the F0 generation individuals with wild-type zebrafish to screen out the F1 generation strains with effective mutations and stable inheritance.
[0067] S3. Self-cross the F1 generation strains to screen out the F2 generation individuals with homozygous mutations in the osteomodulin gene, that is, the homozygous mutant of the zebrafish osteomodulin gene.
[0068] Compare the genes of the homozygous mutant of the zebrafish osteomodulin gene obtained in this example with those of the wild-type zebrafish. The results are as Figure 1 shown. Figure 1 In it, WT represents the wild-type zebrafish, and Mutant represents the homozygous mutant of the zebrafish osteomodulin gene. It can be Figure 1 seen that obvious mutations have occurred in both exon 1 and exon 2 of the mutant, and the formed protein sequence is also significantly deleted by a large segment (from 401 aa to 103 aa), and there are some protein sequences that did not exist before (the marked red part), proving that the osteomodulin gene in the mutant has indeed mutated.
[0069] Cultivate the homozygous mutant of the zebrafish osteomodulin gene obtained in this example and the wild-type zebrafish under the same conditions. When their individuals grow to 90 days old, detect the content of triglycerides in the liver, muscle, and plasma, as well as the body length and body weight of the homozygous mutant of the zebrafish osteomodulin gene and the wild-type zebrafish. The results are as Figure 2 shown.
[0070] Figure 2 In it, omd+ / + represents the wild-type zebrafish, and omd- / - represents the homozygous mutant of the zebrafish osteomodulin gene. It can be Figure 2 seen that the difference in the content of triglycerides in the liver between the wild-type zebrafish and the homozygous mutant of the zebrafish osteomodulin gene is not significant, but the content of triglycerides in the muscle of the mutant is significantly increased, and the content of triglycerides in the plasma is significantly decreased, and the difference in body length and body weight between the two kinds of fish is not significant.
[0071] Therefore, in this embodiment, a homozygous mutant of zebrafish osteocalcin gene is obtained by gene editing, which can effectively increase the fat content in its muscle and reduce the fat content in the blood, and the growth of fish is not affected. This provides an important reference for cultivating new fish varieties with high muscle fat content and low blood fat content, and has broad application prospects.
[0072] Examples 2 - 3
[0073] Examples 2 - 3 respectively provide a breeding method for increasing the muscle fat content of fish for common carp and grass carp. The methods provided in Examples 2 - 3 both include the following steps:
[0074] S1. Clone the coding region sequence of the osteocalcin gene of the fish, and design the osteocalcin gene editing target site based on the CRISPR / Cas9 system.
[0075] S2. Design corresponding primers according to the above osteocalcin gene editing target site, and synthesize an amplification fragment gRNA containing the above osteocalcin gene editing target site. Dilute the concentration of gRNA to 250 ng / μL and store it at -80 °C for later use.
[0076] S3. Using the linearized Cas9 plasmid as a template, transcribe Cas9 mRNA in vitro, dilute its concentration to 750 ng / μL, and store it at -80 °C for later use.
[0077] S4. Mix 4 μL of the gRNA obtained in step S12, 4 μL of the Cas9 mRNA obtained in step S13 with 2 μL of water to obtain an injection mixture. The injection concentration of gRNA is 100 ng / μL, and the injection concentration of Cas9 mRNA is 300 ng / μL; collect the fertilized eggs of the fish, and inject the prepared injection mixture into the fertilized eggs at the 1 - or 2 - cell stage through a microinjector, and the injection volume is 1 nL.
[0078] S5. Incubate and cultivate the injected fertilized eggs. When they grow to 90 days old, cut the tail fin to screen out the osteocalcin gene chimeric mutants.
[0079] Specifically, in Example 2, the common carp used is the Yellow River carp, and the coding region sequence of its osteocalcin gene is as shown in SEQ ID NO:2. The design methods of the corresponding osteocalcin gene editing target site and primers in steps S1 - S2 are as Figure 3 shown. In Example 3, the coding region sequence of the osteocalcin gene of the grass carp used is as shown in SEQ ID NO:3. The design methods of the corresponding osteocalcin gene editing target site and primers in steps S1 - S2 are as Figure 4 shown.
[0080] In Figure 3 、Figure 4 Among them, the green-labeled part is the cloning primer, the red-labeled part is the gene editing target site, the blue-labeled part is the PAM region of the gene editing target site, and the brown-labeled part is the exon sequence. The sequences of the osteocalcin gene editing target sites and their cloning primers in Example 2 and Example 3 are shown in Table 1.
[0081] Table 1 Sequences of target sites and cloning primers in Examples 2-3
[0082]
[0083] The muscle fat contents of the common carp osteocalcin gene chimeric mutants obtained in Example 2, the grass carp osteocalcin gene chimeric mutants obtained in Example 3, wild common carp and wild female fish cultured under the same conditions were detected, and the results are as Figure 5 shown.
[0084] Figure 5 Among them, ctrl represents wild fish as a control, omd mutant represents osteocalcin gene mutant, grass carp represents grass carp, and common carp represents common carp. It can be Figure 5 seen that in grass carp and common carp, the mutants have higher muscle fat contents than wild fish.
[0085] Therefore, the breeding method for increasing the muscle fat content of fish provided in this application is applicable to different species of fish, can significantly increase the muscle fat content of the corresponding fish, and has good application prospects.
[0086] In summary, this application provides a breeding method and application for increasing the muscle fat content of fish, belonging to the technical field of gene editing breeding. Among them, the breeding method for increasing the muscle fat content of fish includes: using gene editing technology to knockout the osteocalcin gene of fish, so that the osteocalcin gene forms a frameshift mutation or premature termination of translation, and obtaining an osteocalcin gene mutant. The breeding method for increasing the muscle fat content of fish provided in this application can significantly increase the muscle fat content of fish by knocking out the osteocalcin gene by gene editing, and the growth of fish is not affected. This osteocalcin gene can be used as a gene target for genetic selection and gene editing breeding. The breeding method for increasing the muscle fat content of fish based on this gene target can be applied to fish breeding, which is of great significance for cultivating new fish varieties with high muscle fat content.
[0087] It should be noted that the present application is not limited to the above-described embodiments. The above embodiments are merely examples, and embodiments having the same constitution and achieving the same effects as the technical idea within the scope of the technical solution of the present application are all included in the technical scope of the present application. In addition, within the scope of not departing from the gist of the present application, various modifications that can be conceived by those skilled in the art to the embodiments, and other ways constructed by combining some constituent elements in the embodiments are also included in the scope of the present application.
[0088] The sequence listing involved in the present application is specifically as follows:
[0089] SEQ ID NO:1
[0090]
[0091] SEQ ID NO:2
[0092]
[0093] SEQ ID NO:3
[0094]
Claims
1. A breeding method for increasing the muscle fat content of fish, characterized in that, It includes the following steps: Using gene editing technology to knockout the osteomodulin gene of fish, causing a frameshift mutation or premature termination of translation in the osteomodulin gene, and obtaining an osteomodulin gene mutant.
2. The breeding method for increasing the muscle fat content of fish according to claim 1, characterized in that, The fish is a Cyprinidae fish.
3. The breeding method for increasing the muscle fat content of fish according to claim 2, characterized in that, The Cyprinidae fish is zebrafish, carp or grass carp.
4. The breeding method for increasing the muscle fat content of fish according to claim 3, characterized in that, The coding region sequence of the osteomodulin gene of the zebrafish is as shown in SEQ ID NO:
1.
5. The breeding method for increasing the muscle fat content of fish according to claim 3, characterized in that, The coding region sequence of the osteomodulin gene of the carp is as shown in SEQ ID NO:
2.
6. The breeding method for increasing the muscle fat content of fish according to claim 3, characterized in that, The coding region sequence of the osteomodulin gene of the grass carp is as shown in SEQ ID NO:
3.
7. The breeding method for increasing the muscle fat content of fish according to claim 1, characterized in that, The osteomodulin gene mutant is an osteomodulin gene homozygous mutant or an osteomodulin gene chimeric mutant.
8. The breeding method for increasing the muscle fat content of fish according to claim 7, characterized in that, The steps for obtaining the osteomodulin gene homozygous mutant include: S1. Using gene editing technology to knockout the osteomodulin gene of fish to obtain F0 generation individuals with osteomodulin gene chimeric mutations; S2. Hybridizing the F0 generation individuals with wild-type fish to obtain an F1 generation strain; S3. Self-crossing the F1 generation strain and screening for osteomodulin gene homozygous mutants as F2 generation individuals.
9. The breeding method for increasing the muscle fat content of fish according to claim 8, characterized in that, The use of gene editing technology to knockout the osteomodulin gene of fish includes the following steps: S11. Based on the CRISPR / Cas9 system, designing an editing target site for the osteomodulin gene of fish; S12. Designing corresponding primers according to the editing target site of the osteomodulin gene of fish and synthesizing an amplification fragment containing the editing target site of the osteomodulin gene of fish, denoted as gRNA; S13. Preparing Cas9 mRNA by in vitro transcription; S14. Formulating an injection mixture containing the gRNA and the Cas9 mRNA, and microinjecting the fertilized eggs of fish with the injection mixture.
10. Application of the breeding method for increasing the muscle fat content of fish according to any one of claims 1-9 in fish breeding.