Genetic engineering vector, tumor chemotactic engineering cell and application of tumor chemotactic engineering cell in solid tumor

Abstract

The invention provides a genetic engineering vector, a tumor chemotactic engineering cell and application of the tumor chemotactic engineering cell in solid tumors, and belongs to the technical field of biological medicines. According to the invention, an overexpression vector or a SynNotch CAR activated expression vector, a B2M / IDO / IL-10-Cas9 three-knock vector, a CAR targeting vector and a SynNotch CAR targeting vector are constructed. A tumor chemotaxis cell line is transfected based on the gene engineering vector to obtain training immune induction cells and targeting training immune vector cells. Therefore, a memory induction and reactivation system constructed by the invention not only can induce controllable memory or memory-like immune cells in vitro, but also can mediate a tumor killing effect and deliver'memory induction factors' or'training agents' to a tumor site in a targeting manner at the same time, stimulate in-vivo reactivation of the induced memory immune cells, and improve the tumor killing effect. Therefore, the efficient and lasting tumor killing effect is realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to a genetic engineering vector, a tumor chemotactic engineering cell, and their applications in solid tumors. Background Art

[0002] Adoptive cell immunotherapy is to activate and expand autologous or allogeneic immune cells of a patient in vitro and then infuse them into the patient's body to achieve the effect of treating tumors. Although immune cells such as cytotoxic T lymphocytes, CD3 + CD56 + NK cell-like T lymphocytes, natural killer cells (NK cells) and other types of immune cells have the ability to rapidly kill tumors, but due to their limited survival and short effector time in vivo, they cannot form a continuous tumor-killing effect, so their curative effects do not yet meet the clinical expectations.

[0003] Immune memory is the ability of immune cells to form after being stimulated by antigens and produce a faster and stronger response when re-stimulated by antigens. Recent studies have found that not only can the adaptive immunity mediated by T and B cells form and maintain immune memory through gene rearrangement and gene mutation, but innate immune cells represented by NK cells and NK cell-like T lymphocytes can also undergo long-term epigenetic modification and metabolic reprogramming under the induction of antigens or cytokines and co-stimulatory molecules, thereby establishing immune memory. This innate immune memory that does not rely on gene recombination or gene mutation is also called "trained immunity". Trained immunity helps to resist re-infection by the same or different pathogens and plays an important role in physiological processes such as the body's prevention of infection and the induction of non-specific protection of vaccines.

[0004] Immune memory is usually associated with three activation signals. The first includes the activation of the T cell receptor (TCR) of T cells mediated by the antigen complex of the major histocompatibility complex (MHC), and the activation of killer cell immunoglobulin-like receptors (KIR) of natural killer (NK) cells in the absence of MHC class I molecules; the second is the activation signal mediated by co-stimulatory molecules; the third is the activation signal mediated by cytokines. Currently, most therapeutic immune cells cultured in vitro are regulated in terms of their differentiation and proliferation using cytokines. Although cytokine combinations can induce memory-like immune cells, given the extensive immunomodulatory effects of cytokines, it is difficult to use cytokines for the reactivation of memory-like cells in vivo. Moreover, free cytokines can only provide the third activation signal, while the first and second signals require the participation of target cells or antigen-presenting cells. Therefore, there is a need to construct a memory induction and reactivation system that can not only induce controllable memory immune cells in vitro but also target and deliver "memory induction factors" or "training agents" to the tumor site to stimulate the in vivo reactivation of the induced memory immune cells, thereby achieving an efficient and long-lasting tumor-killing effect. Summary of the Invention

[0005] In view of this, the object of the present invention is to provide a genetic engineering vector, a tumor chemotactic engineering cell, and their applications in solid tumors. The genetic engineering vector and the tumor chemotactic engineering cell constructed in the present invention can stimulate the in vivo reactivation of induced memory immune cells, thereby achieving an efficient and long-lasting tumor-killing effect.

[0006] To solve the above technical problems, the present invention provides the following technical solutions:

[0007] The present invention provides a genetic engineering vector, and the genetic engineering vector comprises a genetic engineering vector 1 and a genetic engineering vector 2; the genetic engineering vector 1 comprises an overexpression vector and a knockout vector; the overexpression vector encodes a membrane-bound / membrane-anchored cytokine and a co-stimulatory molecule that induce memory-like characteristics in immune cells; the membrane-bound / membrane-anchored cytokine is expressed by fusing the cytokine with a transmembrane protein or a membrane-anchored protein; the membrane-bound / membrane-anchored cytokine and the co-stimulatory molecule are linked by one or more of furin-GSG-P2A, furin-GSGS-T2A, and furin-GSGS-F2A; the knockout vector is a B2M / IDO / IL-10-Cas9 triple knockout vector; the genetic engineering vector 2 comprises a CAR targeting vector, a SynNotch CAR targeting vector, a SynNotch CAR activation expression vector, and a knockout vector; the CAR targeting vector consists of an antigen receptor, a transmembrane domain, and an intracellular activation domain; the SynNotch CAR targeting vector consists of an antigen receptor, a Notch core transmembrane region, and an intracellular transcription domain; the SynNotch CAR activation expression vector encodes any one of the proteins encoded by the overexpression vector through synNotch CAR activation drive; the knockout vector is a B2M / IDO / IL-10-Cas9 triple knockout vector.

[0008] Preferably, the overexpression vector encodes any one of the following proteins: IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L; the nucleotide sequences of the proteins encoded by the overexpression vector are as shown in SEQ ID NO: 1-7 in sequence.

[0009] Preferably, the sgRNA sequence for knocking out the B2M gene in the B2M / IDO / IL-10-Cas9 triple knockout vector is as shown in SEQ ID NO: 8, the sgRNA sequence for knocking out the IDO gene is as shown in SEQ ID NO: 9, and the sgRNA sequence for knocking out the IL-10 gene is as shown in SEQ ID NO: 10.

[0010] Preferably, the CAR vector encodes any one of the following proteins: CD19-CAR-CD8TM-CD28-CD3ζ, HER2-CAR-CD8TM-CD28Z-CD3ζ, HER2-CAR-CD8TM-CD28Z-CD3ζ; the synNotch CAR targeting vector encodes any one of the following proteins: CD19-CAR-Gal4-VP64, HER2-CAR-Gal4-VP64.

[0011] The present invention also provides tumor chemotactic engineered cells, which include trained immune induction cells and targeted trained immune carrier cells; the trained immune induction cells are transfected with the genetic engineering vector 1; the targeted trained immune carrier cells are transfected with the genetic engineering vector 2.

[0012] Preferably, the cells used for constructing the tumor chemotactic engineered cells are tumor chemotactic cell lines or embryonic stem cell lines.

[0013] Preferably, the B2M / IDO / IL-10-Cas9 triple knockout vector in the genetic engineering vector 1 and the genetic engineering vector 2 is introduced into the tumor chemotactic cell line or embryonic stem cell line by electroporation.

[0014] Preferably, the overexpression vector in the genetic engineering vector 1 and the CAR targeting vector, SynNotch CAR targeting vector, and SynNotch CAR activation expression vector in the genetic engineering vector 2 are introduced into the tumor chemotactic cell line by lentiviral infection.

[0015] The present invention provides a targeted trained immune carrier vesicle. During the construction process of the trained immune induction cells, on the basis of sorting out MHC-I molecule-negative and cytokine / costimulatory molecule-positive cells, the CAR targeting vector is transfected, CAR-positive cells are sorted, and the targeted trained immune carrier vesicle is obtained through hypotonic treatment, ultrasound, membrane extrusion, and ultrafiltration operations.

[0016] The present invention provides the application of the genetic engineering vector, or the tumor chemotactic engineered cells, or the targeted trained immune carrier vesicle in the preparation of products for treating tumors.

[0017] Compared with the prior art, the present invention has the following beneficial effects:

[0018] (1) The present invention combines in vitro memory induction and in vivo reactivation of memory immune cells for the treatment of malignant tumors, overcoming the defects of traditional adoptive cell immunotherapy such as short effector time and easy exhaustion of effector cells.

[0019] (2) The trained immune induction cells or targeted trained immune carrier cells based on tumor chemotactic cells provided by the present invention can not only exert the CAR-targeted tumor-killing effect and the broad-spectrum tumor-killing effect independent of MHC, but also induce the generation of memory immune cells in patients and stimulate the in vivo reactivation of memory immune cells.

[0020] (3) The cytokines, co-stimulatory molecules and combinations provided by the present invention that can induce the generation of memory in immune cells can meet the requirements of three types of activation signals related to immune memory for different immune cell types. The cytokines and co-stimulatory molecules are tandemly connected by furin protein and self-cleaving 2A peptide, and can maintain nearly equal expression.

[0021] (4) The trained immune induction cells provided by the present invention can long-term expand various immune cells in vitro, and are suitable for large-scale culture of universal immune cells.

[0022] (5) By driving the expression of memory induction factors and co-stimulatory molecules through synNotch CAR, the present invention can avoid the activation of immune cells at non-tumor sites and reduce the risk of toxic and side reactions.

[0023] (6) By sequentially infusing the induced and cultured memory T cells / NK cell-like T cells / NK cells and targeted trained immune carrier cells, the present invention can not only exert the advantages of individualized treatment but also produce universal immunotherapy products through large-scale production, reducing the cost of tumor immunotherapy.

[0024] (7) The targeted trained immune carrier vesicles provided by the present invention can efficiently target and deliver memory induction factors and co-stimulatory molecules to the tumor site, can cross the blood-brain barrier, and can also be used as other drug carriers. Description of the Drawings

[0025] Figure 1It is a map of membrane-bound / membrane-anchored cytokines and costimulatory molecules encoded in an overexpression vector that induce memory-like properties in immune cells. From top to bottom, they are IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L.

[0026] Figure 2 It is a vector map of overexpressing IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L (left figure) and IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86 (right figure).

[0027] Figure 3Vector maps for overexpressing IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40 (left figure) and IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48 (right figure).

[0028] Figure 4 Vector maps for overexpressing IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40 (left figure) and IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48 (right figure).

[0029] Figure 5 Vector map for overexpressing IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L.

[0030] Figure 6 Plasmid map of B2M-Cas9 constructed by ligating B2M oligonucleotide fragment to lentiCRISPR v2 digested with BsmBI.

[0031] Figure 7 Plasmid maps of pX330A-1x3, pX330S-2, and pX330S-3 digested with BbsI into which B2M, IDO, and IL-10 oligonucleotide fragments were respectively cloned, and plasmid map of the B2M / IDO / IL-10-Cas9 triple knockout vector obtained by Golden Gate cloning using BsaI enzyme.

[0032] Figure 8 Plasmid maps of CAR targeting vectors CD19-CAR-CD8TM-CD28-CD3ζ (left figure) and HER2-CAR-CD8TM-CD28-CD3ζ (right figure).

[0033] Figure 9Plasmid maps of SynNotch CAR targeting vectors HER2-CAR-Gal4-VP64 (left figure) and CD19-CAR-Gal4-VP64 (right figure).

[0034] Figure 10 Plasmid map of the SynNotch CAR activation expression vector pCCL-GAL4 / UAS-mCMV-Insert, where Insert represents Figure 1 the sequence shown.

[0035] Figure 11 Flow cytometry plots of overexpressed cytokines and costimulatory molecules after transfection of TALL-104 with the overexpression vector.

[0036] Figure 12 Proliferation curves of peripheral blood mononuclear cells after co-culture with NK-92, NK-92MI, TALL-104, THP-1, HUMSC, MSC induced by H9 differentiation, and macrophages induced by H9 differentiation, which were modified with the overexpression vector.

[0037] Figure 13 Flow cytometry plots of CAR detection after amplification of CAR-T from three donor sources with memory-inducing cells mIL-21-CD137L-OX40L-TALL-104 or mIL-7-mIL-12-mIL-15-CD86-TALL-104.

[0038] Figure 14 Flow cytometry plots of CD3 + and CD56 + double-positive NK-like T cells after amplification of peripheral blood mononuclear cells (PBMC) from three donor sources with mIL-21-CD137L-CD40-THP-1 or mIL-7-mIL-12-mIL-15-CD40-THP-1.

[0039] Figure 15 Flow cytometry plots of CD3 - and CD56 + of NK cells after amplification of PBMC from three donor sources with mIL-21-CD137L-CD48-K562 or mIL-21-CD137L-CD48-NK92 or mIL-12-mIL-15-mIL-18-OX40L-NK92.

[0040] Figure 16Flow cytometry detection charts of cytokines and costimulatory molecules. The upper chart is the flow cytometry detection chart of cytokines and costimulatory molecules after CD19-CAR-Gal4-VP64-NK92MI is co-incubated with Nalm-6 or K562; the lower chart is the flow cytometry detection chart of cytokines and costimulatory molecules after HER2-CAR-Gal4-VP64-THP-1 is co-incubated with SKOV3 or TC-1.

[0041] Figure 17 Electron microscopy image (left) and particle size distribution chart (right) of the targeted training immune carrier vesicles.

[0042] Figure 18 Cytotoxicity diagrams of each group of cells against SKOV3 or Nalm-6. Among them, the left diagram is the cytotoxicity diagram of groups 1-5 against SKOV3 at a low effector-to-target ratio of 0.5:1; the right diagram is the cytotoxicity diagram of groups 6-10 against Nalm-6 at a low effector-to-target ratio of 0.5:1.

[0043] Figure 19 Images showing tumor burden by in vivo imaging of each group of mice in the SKOV3 tumor-bearing mouse model.

[0044] Figure 20 Images showing tumor burden by in vivo imaging of each group of mice in the Nalm6 tumor-bearing mouse model. Detailed implementation manners

[0045] The present invention provides a genetic engineering vector, characterized in that the genetic engineering vector comprises genetic engineering vector 1 and genetic engineering vector 2. The genetic engineering vector 1 of the present invention is a training immune induction genetic engineering vector, and the genetic engineering vector 2 is a targeted training immune reactivation engineering vector.

[0046] In the present invention, the genetic engineering vector 1 includes an overexpression vector and a knockout vector; the overexpression vector of the present invention encodes a membrane-bound / membrane-anchored cytokine and a costimulatory molecule that induce memory-like characteristics in immune cells; the membrane-bound / membrane-anchored cytokine is expressed by fusing a cytokine with a transmembrane protein or a membrane-anchoring protein; the membrane-bound / membrane-anchored cytokine and the costimulatory molecule are linked by one or three of furin-GSG-P2A, furin-GSGS-T2A, and furin-GSGS-F2A. The cytokines of the present invention include one or several of IL-7, IL-12, IL-15, IL-18, and IL-21; the costimulatory molecules include one or several of CD86, CD40, CD48, OX40L, and 4-1BBL; the transmembrane protein is the transmembrane domain of CD8 or CD28; the membrane-anchoring protein is the GPI membrane-anchoring domain. When the cytokines of the present invention are composed of subunits, the subunits are connected in series by a flexible linker, and the linker is more preferably (Gly4Ser)3, i.e., (G4S)3. The overexpression vector of the present invention preferably encodes any one of the following proteins: IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L. The nucleotide sequences of the above proteins of the present invention are shown as SEQ ID NO:1-7 in sequence.

[0047] In the present invention, the knockout vector is a B2M / IDO / IL-10-Cas9 triple knockout vector; the sgRNA sequence for knocking out the B2M gene in the B2M / IDO / IL-10-Cas9 triple knockout vector is as shown in SEQ ID NO:8, the sgRNA sequence for knocking out the IDO gene is as shown in SEQ ID NO:9, and the sgRNA sequence for knocking out the IL-10 gene is as shown in SEQ ID NO:10.

[0048] In the present invention, the genetic engineering vector 2 includes a CAR targeting vector, a SynNotch CAR targeting vector, a SynNotch CAR activation expression vector, and a knockout vector; the CAR targeting vector is composed of an antigen receptor, a transmembrane domain, and an intracellular activation domain, encoding a chimeric antigen receptor that specifically recognizes tumor-associated antigens and mediates activation signal transduction; the SynNotch CAR targeting vector is composed of an antigen receptor, a Notch core transmembrane region, and an intracellular transcription domain, encoding a chimeric antigen receptor that specifically recognizes tumor-associated antigens and drives transcription signal transduction; the SynNotch CAR activation expression vector contains a transcriptional recognition domain and a sequence encoding a membrane-bound / membrane-anchored cytokine and a co-stimulatory molecule that induces memory-like characteristics in immune cells, and releases a transcriptional activator after SynNotch CAR activation to drive the expression of the membrane-bound / membrane-anchored cytokine and the co-stimulatory molecule; the knockout vector is a B2M / IDO / IL-10-Cas9 triple knockout vector, and the sgRNA sequence for knocking out the B2M gene in the B2M / IDO / IL-10-Cas9 triple knockout vector is as shown in SEQ ID NO:8, the sgRNA sequence for knocking out the IDO gene is as shown in SEQ ID NO:9, and the sgRNA sequence for knocking out the IL-10 gene is as shown in SEQ ID NO:10.

[0049] In the present invention, the CAR vector preferably encodes any one of the following proteins: CD19-CAR-CD8TM-CD28-CD3ζ, HER2-CAR-CD8TM-CD28Z-CD3ζ, and the nucleotide sequences of the above proteins are shown in SEQ ID NO:11-12 in sequence; the synNotch CAR targeting vector preferably encodes any one of the following proteins: CD19-CAR-Gal4-VP64, HER2-CAR-Gal4-VP64, and the nucleotide sequences of the above proteins are shown in SEQ ID NO:13-14 in sequence; the SynNotch CAR activation expression vector is preferably encoded by any one of the following proteins after being activated and driven by synNotch CAR: IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L. The nucleotide sequences of the above proteins in the present invention are shown in SEQ ID NO:1-7 in sequence.

[0050] In the present invention, the construction steps of the SynNotch CAR activation expression vector include: gene synthesis of 5 copies of the GAL4 upstream activation sequence and the minimal CMV promoter cPPT / CTS-GAL4 / UAS-mCMV, and constructing the synthesized sequence into the overexpression vector digested with NotI and EcoRI to obtain pCCL-GAL4 / UAS-mCMV-IL-21-CD8TM-furin-GSGS-P2A-4-1BBL-furin-GSGS-F2A-OX40L, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-F2A-IL-7-GPI-furin-GSGS-F2A-CD86, pCCL-GAL4 / UAS-mCMV-IL-21-CD8TM-furin-GSGS-P2A-4-1BBL-furin-GSGS-F2A-CD40, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-F2A-IL-7-GPI-furin-GSGS-F2A-CD48, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-F2A-IL-7-GPI-furin-GSGS-F2A-CD40, pCCL-GAL4 / UAS-mCMV-IL-21-CD8TM-furin-GSGS-P2A-4-1BBL-furin-GSGS-F2A-CD48, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L. The nucleotide sequence of the synthesized sequence in the present invention is as shown in SEQ ID NO:15. In the SynNotch CAR activation expression vector of the present invention, the target gene is not directly expressed. After CAR activation, Gal4-VP64 binds to the GAL4 upstream activation sequence to drive the expression of the target gene.

[0051] The present invention also provides tumor chemotactic engineered cells, which include trained immune induction cells and targeted trained immune carrier cells; the trained immune induction cells are transfected with the genetic engineering vector 1; the targeted trained immune carrier cells are transfected with the genetic engineering vector 2. The tumor chemotactic cell line used for constructing the tumor chemotactic engineered cells of the present invention is THP-1 or HUMSC, and the embryonic stem cell line used is embryonic stem cell H9 (purchased from WiCell). By expressing membrane-bound / membrane-anchored cytokines, co-stimulatory molecules and combinations thereof that can induce memory-like characteristics in T cells / NK-like T cells / NK cells in the tumor chemotactic cell line or embryonic stem cell line, the present invention can induce memory-like characteristics in the patient's immune cells and achieve long-term in vitro expansion.

[0052] The present invention also provides a method for constructing the trained immune induction cells and inducing memory / memory-like immune cells, including the following steps: (1) constructing an overexpression vector of a combination of membrane-bound / membrane-anchored cytokines and co-stimulatory molecules, and a B2M / IDO / IL-10-Cas9 triple knockout vector; (2) electrotransfecting the B2M / IDO / IL-10-Cas9 triple knockout vector and the lentiviral packaging overexpression vector, and then infecting THP-1, HUMSC or embryonic stem cell H9; (3) sorting cells that are negative for MHC class I molecules and positive for cytokines / co-stimulatory molecules by flow cytometry; (4) differentiating the modified THP-1 and HUMSC after sorting or the positive cells of the modified embryonic stem cell H9 into mesenchymal-like stem cells or macrophages by embryoid body (EB) induction differentiation method, and then irradiating with 10-100 Gy γ-rays to obtain trained immune induction cells; (5) inoculating and incubating peripheral blood PBMC or cord blood PBMC or tumor-infiltrating lymphocytes or bone marrow-infiltrating lymphocytes with the trained immune induction cells at a ratio of 16:1-4:1 (cell number); (6) performing cell expansion culture, and repeating the stimulation of the proliferation and activation of T cells / NK-like T cells / NK cells with the trained immune induction cells at a ratio of 16:1-4:1 (cell number) every 7-14 days; (7) harvesting memory / memory-like immune cells on the 13th to 45th day.

[0053] In the present invention, the cells used for constructing the tumor chemotactic engineered cells are a tumor chemotactic cell line and an embryonic stem cell line. The tumor chemotactic cell line of the present invention includes THP-1 or HUMSC, and the embryonic stem cell line includes embryonic stem cell H9. By expressing membrane-bound / membrane-anchored cytokines, co-stimulatory molecules and combinations thereof that can induce memory-like characteristics in T cells / NK-like T cells / NK cells after the targeted trained immune carrier cells target tumor cells, the present invention can achieve targeted killing of tumors while stimulating the activation of endogenous immune cells.

[0054] The present invention also provides a method for constructing a targeted trained immune carrier cell and stimulating the reactivation of memory T cells / NK-like T cells / NK cells in vivo, including the following steps: (1) constructing a CAR targeting vector, a SynNotch CAR targeting vector, a SynNotch CAR activation expression vector, and a gene knockout vector; (2) electrotransfecting the gene knockout vector and packaging the CAR targeting vector, the SynNotch CAR targeting vector, or the SynNotch CAR activation expression vector with lentivirus, and then infecting THP-1, HUMSC, or embryonic stem cell H9; (3) co-incubating with irradiated target cells (tumor cells), and sorting out MHC-I molecule-negative and CAR / cytokine / costimulatory molecule-positive cells by flow cytometry; (4) inducing the sorted THP-1 and HUMSC to differentiate into mesenchymal-like stem cells or macrophages by amplification, or inducing the positive cells of embryonic stem cell H9 to differentiate into mesenchymal-like stem cells or macrophages through embryoid bodies (EBs) to obtain targeted trained immune carrier cells; (5) infusing the targeted trained immune carrier cells to treat malignant tumors.

[0055] The present invention also provides a method for in vitro culture and amplification of immune cells based on trained immune-induced cells. In the present invention, when the target cells for co-incubation culture are T cells, 50-1000 ng / mL of anti-CD3 / CD28 monoclonal antibody or CD3 / CD28-conjugated magnetic beads at a ratio of 1 / 8-1 / 1 and 300-2000 U / mL of IL-2 are added during inoculation culture, and 300-2000 U / mL of IL-2 is added during amplification culture; when the target cells for co-incubation culture are NK-like T cells, 1000-5000 U / mL of IFN-γ, 50-1000 ng / mL of anti-CD3 / CD28 monoclonal antibody or CD3 / CD28-conjugated magnetic beads at a ratio of 1 / 8-1 / 1, and 300-2000 U / mL of IL-2 are added during inoculation culture, and 200-1000 U / mL of IL-2 is added during amplification culture; when the target cells for co-incubation culture are NK cells, 50-300 U / mL of IL-2 is added during both inoculation culture and amplification culture.

[0056] The present invention also provides a targeted trained immune carrier vesicle. During the construction process of the trained immune-induced cells, on the basis of sorting out MHC-I molecule-negative and cytokine / costimulatory molecule-positive cells, the CAR targeting vector is transfected, CAR-positive cells are sorted, and the targeted trained immune carrier vesicle is obtained through hypotonic treatment, ultrasound, membrane extrusion, and ultrafiltration operations. The targeted trained immune carrier vesicle prepared from mesenchymal-like stem cells or macrophages induced from THP-1, HUMSC, or embryonic stem cell H9 by the present invention has natural chemotaxis to tumor cells and is easily taken up by tumor cells.

[0057] The present invention also provides the use of the gene engineering vector combination, or the tumor chemotactic engineering cells, or the targeted training immune vector vesicles in the preparation of tumor therapeutic products. The tumors in the present invention include, but are not limited to, solid tumors.

[0058] In the present invention, unless otherwise specified, all components, reagents or culture media are commercially available products well-known to those skilled in the art.

[0059] The technical solutions of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without any creative work belong to the scope of protection of the present invention.

[0060] Example 1 Vector Construction

[0061] 1. Construction of overexpression vectors

[0062] Cytokine combinations IL-21-CD8TM-furin-GSG-P2A-4-1BBL, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI, and costimulatory molecules furin-GSGS-F2A-OX40L, furin-GSGS-F2A-CD86, furin-GSGS-F2A-CD40, furin-GSGS-F2A-CD48 were synthesized by gene synthesis.

[0063] The above synthesized sequences were combined and spliced using overlapping PCR. Primers required for overlapping PCR were designed, and the primers used are shown in Table 1. Primers 1 / 3 used the synthesized IL-21-CD8TM-furin-GSG-P2A-4-1BBL as the template, and primers 2 / 4 used furin-GSGS-F2A-OX40L as the template for the first-round PCR amplification. Then, the product of the first-round PCR amplification was used as the template for annealing and extension to combine the two templates, and primers 1 / 4 were used for the second-round PCR amplification to obtain IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L. Primers 5 / 7 used the synthesized IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI as the template, and primers 6 / 8 used furin-GSGS-F2A-CD86 as the template for the first-round PCR amplification. Then, the product of the first-round PCR amplification was used as the template for annealing and extension to combine the two templates, and primers 5 / 8 were used for the second-round PCR amplification to obtain IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86. Primers 1 / 10 used the synthesized IL-21-CD8TM-furin-GSG-P2A-4-1BBL as the template, and primers 9 / 11 used furin-GSGS-F2A-CD40 as the template for the first-round PCR amplification. Then, the product of the first-round PCR amplification was used as the template for annealing and extension to combine the two templates, and primers 1 / 11 were used for the second-round PCR amplification to obtain IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40. Primers 5 / 13 used the synthesized IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI as the template, and primers 12 / 14 used furin-GSGS-F2A-CD48 as the template for the first-round PCR amplification. Then, the product of the first-round PCR amplification was used as the template for annealing and extension to combine the two templates, and primers 5 / 14 were used for the second-round PCR amplification to obtain IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48.The primer 5 / 16 used the synthesized IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI as the template, and the primer 15 / 11 used furin-GSGS-F2A-CD40 as the template for the first round of PCR amplification. Then, the product of the first round of PCR amplification was used as the template for annealing and extension to combine the two templates, and then the primer 5 / 11 was used for the second round of PCR amplification to obtain IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD 8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40. The primer 1 / 18 used the synthesized IL-21-CD8TM-furin-GSG-P2A-4-1BBL as the template, and the primer 17 / 14 used furin-GSGS-F2A-CD48 as the template for the first round of PCR amplification. Then, the product of the first round of PCR amplification was used as the template for annealing and extension to combine the two templates, and then the primer 1 / 14 was used for the second round of PCR amplification to obtain IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48. The primer 19 / 21 used the synthesized IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI as the template, and the primer 20 / 4 used furin-GSGS-F2A-OX40L as the template for the first round of PCR amplification. Then, the product of the first round of PCR amplification was used as the template for annealing and extension to combine the two templates, and then the primer 19 / 4 was used for the second round of PCR amplification to obtain IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L. The conditions for the first and second rounds of PCR amplification were pre-denaturation at 95°C for 30 s, denaturation at 95°C for 15 s, annealing at 60°C for 30 s, extension at 72°C for 1.5 min, for a total of 35 cycles, and finally extension at 72°C for 5 min. The conditions for annealing and extension to combine the two templates were pre-denaturation at 95°C for 1 min, denaturation at 95°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, for 5 cycles. The nucleotide sequences of the above-mentioned combined proteins constructed are shown in SEQ ID NO:1-7 in sequence, and the map is as follows. Figure 1 as shown

[0064] Table 1 Gene synthesis primers

[0065] Primer Serial Number Primer Sequence 1 GAATTCATGCGGTCATCGCCGG(SEQ ID NO:22) 2 TGCCTTCCCCAAGAAGCGAGCGCGCCAAGCGCAGC(SEQ ID NO:23) 3 GCTGCGCTTGGCGCGCTCGCTTCTTGGGGAAGGCA(SEQ ID NO:24) 4 GTCGACTCACAGCACGCAGAACTCTCCC(SEQ ID NO:25) 5 GAATTCATGTGTCACCAGCAGCTG(SEQ ID NO:26) 6 ATCGTGCTCTACATGAATGTGCTGAGAGCCAAGAGGAGCGGG(SEQ ID NO:27) 7 CCCGCTCCTCTTGGCTCTCAGCACATTCATGTAGAGCACGAT(SEQ ID NO:28) 8 GTCGACTCAAAAGCAGGTGTCGGACTTGT(SEQ ID NO:29) 9 TGCCTTCCCCAAGAAGCGAGCGCGCTAAGCGCTCTGG(SEQ ID NO:30) 10 CCAGAGCGCTTAGCGCGCTCGCTTCTTGGGGAAGGCA(SEQ ID NO:31) 11 GTCGACTCACTGTCTTTCCTGCACGCTGA(SEQ ID NO:32) 12 ATCGTGCTCTACATGAATGTGCTGCGCGCCAAGCGGTCT(SEQ ID NO:33) 13 AGACCGCTTGGCGCGCAGCACATTCATGTAGAGCACGAT(SEQ ID NO:34) 14 GTCGACTCACATGCCGGTCGGAAAGC(SEQ ID NO:35) 15 ATCGTGCTCTACATGAATGTGCTGCGCGCTAAGCGCTCTGG(SEQ ID NO:36) 16 CCAGAGCGCTTAGCGCGCAGCACATTCATGTAGAGCACGAT(SEQ ID NO:37) 17 TGCCTTCCCCAAGAAGCGAGCGCGCCAAGCGGTCT(SEQ ID NO:38) 18 AGACCGCTTGGCGCGCTCGCTTCTTGGGGAAGGCA(SEQ ID NO:39) 19 GAATTCATGTGCCACCAGCAGCT(SEQ ID NO:40) 20 ATTGTCCTGTACATGAACGTGCTGCGCGCCAAGCGCAGC(SEQ ID NO:41) 21 GCTGCGCTTGGCGCGCAGCACGTTCATGTACAGGACAAT(SEQ ID NO:42)

[0066] The above seven final amplification products were respectively digested with EcoRI and SalI, and were respectively constructed into the lentiviral vector pCCL-c-MNDU3-X (Addgene #81071) digested with the same EcoRI and SalI double enzymes, and overexpression vectors capable of expressing the above seven combined proteins were respectively obtained. The maps of the overexpression vectors are respectively as Figures 2 - 5 shown. The digestion reactions all used Lightning series fast restriction enzymes. The plasmid vector digestion reaction system was: 15 μL ddH2O, 2 μL 10×cutOne Buffer, 2 μL plasmid, 1 μL restriction enzyme, inactivated at 80 °C for 20 min after digestion at 37 °C for 15 min. The digestion reaction system for the seven final amplification products was: 16 μL ddH2O, 3 μL 10×cutOne Buffer, 10 μL PCR substrate, 1 μL restriction enzyme, inactivated at 80 °C for 20 min after digestion at 37 °C for 30 min.

[0067] 2. Construction of gene knockout vectors

[0068] Gene synthesis of B2M, IDO, and IL-10 gene knockout primers. The three groups of primer pairs were annealed to form oligonucleotide fragments respectively. The primer sequences were as follows: B2M sgRNA-F: 5’-CACCGGCCGAGATGTCTCGCTCCG-3’ (SEQ ID NO:16), B2M sgRNA-R: 5’-AAACCGGAGCGAGACATCTCGGCC-3’ (SEQ ID NO:17), IDO sgRNA-F: 5’-CACCGTACAAGAATGGCACACGCTA-3’ (SEQ ID NO:18), IDO sgRNA-R: 5’-AAACTAGCGTGTGCCATTCTTGTAC-3’ (SEQ ID NO:19), IL-10 sgRNA-F: 5’-CACCGTGAAAACAAGAGCAAGGCCG-3’ (SEQ ID NO:20), IL-10 sgRNA-R: 5’-AAACCGGCCTTGCTCTTGTTTTCAC-3’ (SEQ ID NO:21). The sgRNA sequence for knocking out the B2M gene formed was GGCCGAGATGTCTCGCTCCG (SEQ ID NO:8); the sgRNA sequence for the IDO gene was TACAAGAATGGCACACGCTA (SEQ ID NO:9); the sgRNA sequence for the IL-10 gene was TGAAAACAAGAGCAAGGCCG (SEQ ID NO:10).

[0069] The annealed B2M oligonucleotide fragment containing cohesive ends complementary to the vector was ligated to the BsmBI-digested lentiCRISPR v2 vector plasmid to construct the B2M-Cas9 vector, and the B2M knockout vector was obtained ( Figure 6 ). Then, the B2M, IDO, and IL-10 oligonucleotide fragments were respectively constructed into the pX330A-1x3, pX330S-2, and pX330S-3 vector plasmids, and the three sequences were ligated into pX330A-1x3 by Golden Gate cloning using BsaI enzyme to obtain the B2M / IDO / IL-10-Cas9 triple knockout vector ( Figure 7 ).

[0070] 3. Construction of CAR vector

[0071] CD19-CAR-CD8TM-CD28-CD3ζ and HER2-CAR-CD8TM-CD28-CD3ζ were synthesized by gene synthesis, and the synthesized nucleotide sequences are shown in SEQ ID NO:11-12 in sequence. The synthesized sequences were introduced with EcoRI and SalI double digestion sites and constructed into the pCCL-MNDU3-X lentiviral vector digested with EcoRI and SalI ( Figure 8 ).

[0072] 4. Construction of SynNotch CAR targeting vector

[0073] CD19-CAR-Gal4-VP64 and HER2-CAR-Gal4-VP64 were synthesized by gene synthesis, and the synthesized nucleotide sequences are shown in SEQ ID NO:13-14 in sequence. The synthesized sequences were introduced with EcoRI and SalI double digestion sites and constructed into the pCCL-MNDU3-X lentiviral vector digested with EcoRI and SalI ( Figure 9 )

[0074] 5. Construction of SynNotch CAR activation expression vector

[0075] Gene synthesis of 5 copies of the GAL4 upstream activating sequence and the minimal CMV promoter cPPT / CTS-GAL4 / UAS-mCMV, and the synthesized nucleotide sequence is shown in SEQ ID NO:15. The synthesized sequence was digested with NotI and EcoRI and cloned into the overexpression vector obtained in Step 1 that was also digested with NotI and EcoRI, to obtain pCCL-GAL4 / UAS-mCMV-IL-21-CD8TM-furin-GSGS-P2A-4-1BBL-furin-GSGS-F2A-OX40L, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-F2A-IL-7-GPI-furin-GSGS-F2A-CD86, pCCL-GAL4 / UAS-mCMV-IL-21-CD8TM-furin-GSGS-P2A-4-1BBL-furin-GSGS-F2A-CD40, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-F2A-IL-7-GPI-furin-GSGS-F2A-CD48, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-F2A-IL-7-GPI-furin-GSGS-F2A-CD40, pCCL-GAL4 / UAS-mCMV-IL-21-CD8TM-furin-GSGS-P2A-4-1BBL-furin-GSGS-F2A-CD48, pCCL-GAL4 / UAS-mCMV-IL-12p35-(G4S)3-IL-12p40-CD28TM-furin-GSGS-P2A-IL-15-CD8TM-furin-GSG-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L. The target gene in the SynNotch CAR activation expression vector is not directly expressed. After CAR activation, Gal4-VP64 binds to the GAL4 upstream activating sequence to drive the expression of the target gene ( Figure 10 ).

[0076] 6. Lentivirus packaging

[0077] Culture 293T cells. When they grow and fuse to 80%, add 7 overexpression vector plasmids / 2 CAR vector plasmids / 2 SynNotch CAR targeting vectors / 7 SynNotch CAR activation expression vectors respectively to the auxiliary plasmids (pCMV-dR8.9, pCMV-VSV-G) and transfection reagent mixture. Change the medium after 24 hours, and collect the virus fluids of each group at 48 hours. The virus supernatant is concentrated by ultrafiltration and ultracentrifugation for subsequent transfection experiments.

[0078] Example 2 Construction and Application of Trained Immune Inducing Cells

[0079] 1. Construction of Trained Immune Inducing Cells

[0080] Electroporate TALL-104, NK-92, NK-92MI with the B2M-Cas9 knockout vector, or electroporate THP-1, primary human umbilical cord-derived mesenchymal stem cells (HUMSC), human embryonic stem cell H9 (purchased from WiCell) with the B2M / IDO / IL-10-Cas9 triple knockout vector. After culturing for two weeks, obtain HLA-ABC negative cells by flow sorting.

[0081] Add the virus concentrates of each group (MOI = 20) and co-infection reagents to the RetroNectin pre-coated plates, centrifuge at 2000g for 2 hours at 32 °C, and add K562 (control cells), B2M-knockout TALL-104, NK-92, NK-92MI, or B2M / IDO / IL-10-knockout THP-1, HUMSC, H9 cells respectively. Change the medium after 24 hours. After culturing to obtain a sufficient number of cells, obtain mIL-21-CD137L-OX40L, mIL-7-mIL-12-mIL-15-CD86, mIL-21-CD137L-CD40, mIL-7-mIL-12-mIL-15-CD48, mIL-7-mIL-12-mIL-15-CD40, mIL-21-CD137L-CD48, mIL-12-mIL-15-mIL-18-OX40L positive TALL-104, THP-1, NK-92, NK-92MI, HUMSC, H9 cells by flow cytometry sorting and perform monoclonal screening. The H9 positive cells are induced to differentiate into mesenchymal-like stem cells or macrophages by the embryoid body (EB) induction differentiation method. Cytokines and co-stimulatory molecules can both be detected by flow cytometry ( Figure 11 ). Irradiate the sorted cells of each group with 100 Gy and co-culture them with the mononuclear cells extracted from healthy donors. Use lymphocyte medium containing 500 U / mL IL-2 for culture, and maintain the cell density at 1×10 6 / mL. The results showed that each group could effectively stimulate the expansion of peripheral blood mononuclear cells ( Figure 12 ).

[0082] 2. In vitro induction of anti-HER2-CAR-T (anti-human epidermal growth factor receptor 2 chimeric antigen receptor T cells) expansion by trained immune-induced cells

[0083] Isolate mononuclear cells from healthy donors, further enrich T cells using CD3 microBeads, count them, and add CD3 / CD28-conjugated magnetic beads and 300 U / mL IL-2 at a ratio of 1:4 of conjugated magnetic beads to cell number. After 24 hours, infect T cells with lentivirus carrying the HER2-CAR-CD8TM-CD28-CD3ζ vector. On the 7th day, add 10 Gy-irradiated mIL-21-CD137L-OX40L-TALL-104 or mIL-7-mIL-12-mIL-15-CD86-TALL-104 at a ratio of 1:8 according to the cell number, count and replenish the medium every other day, and amplify and culture in lymphocyte medium containing 700 U / mL IL-2 to maintain the cell density at 1×10 6 / mL, and repeat the stimulation on the 14th day. On the 21st day, label the cells with protein L and detect the expression of HER2-CAR (anti-human epidermal growth factor receptor 2 chimeric antigen receptor) by flow cytometry. The positive rate of HER2-CAR in the experimental stimulation group was significantly higher than that in the control group ( Figure 13 ), indicating that TALL-104-trained immune-induced cells can effectively induce the activation and expansion of CAR-T cells.

[0084] 3. In vitro induction of NK-like T cell expansion by trained immune-induced cells

[0085] Isolate mononuclear cells from healthy donors, resuspend them in lymphocyte medium containing 2000 U / mL IFN-γ, 50 ng / mL anti-CD3 / CD28 monoclonal antibody, and 1000 U / mL IL-2, count them, and add 20 Gy-irradiated mIL-21-CD137L-CD40-THP-1 or mIL-7-mIL-12-mIL-15-CD40-THP-1 at a ratio of 1:8 according to the cell number. Repeat the stimulation on the 7th and 14th days. On the 21st day, detect CD3 / CD56 double-positive cells by flow cytometry. The results showed that the proportion of double-positive NKT cells in the experimental group increased significantly after stimulation ( Figure 14 ), indicating that THP-1-trained immune-induced cells can promote the generation of NK-like T cells and increase the proportion of NK-like effector cells.

[0086] 4. In vitro induction of NK cell expansion by trained immune-induced cells

[0087] Isolate mononuclear cells from healthy donors, resuspend them in lymphocyte medium containing 200 U / mL IL-2, and add 25 Gy-irradiated mIL-21-CD137L-CD48-K562 or mIL-21-CD137L-CD48-NK92 or mIL-12-mIL-15-mIL-18-OX40L-NK92 at a cell count ratio of 1:8. Repeat the stimulation on days 7 and 14. On day 21, use flow cytometry to detect CD3- / CD56 + cells. The results show that the proportion of NK cells in the experimental group is significantly higher than that in the control group, and mIL-21-CD137L-CD48-NK92 expands NK cells with higher purity than mIL-21-CD137L-CD48-K562( Figure 15 ), indicating that NK92-trained immune-induced cells can preferentially expand NK cells in mononuclear cells and obtain NK cells with ultra-high purity.

[0088] Example 3 Construction of a targeted trained immune carrier cell and expression of a synNotch CAR targeting HER2 to drive memory inducer

[0089] NK-92MI or THP-1 was infected with viruses carrying CD19-CAR-Gal4-VP64 and HER2-CAR-Gal4-VP64 vectors respectively, and CD19synNtochCAR-NK92MI, HER2synNtochCAR-NK92MI, CD19synNtochCAR-THP1, and HER2synNtochCAR-THP1 positive cells were sorted. CD19synNtochCAR-NK92MI, HER2synNtochCAR-NK92MI, CD19synN tochCAR-THP1, and HER2synNtochCAR-THP1 were further infected with 7 viruses carrying SynNotch CAR activation expression vectors, and co-cultured with 100 Gy irradiated CD19 / HER2 positive Nalm-6 / SK OV3 to express the SynNotch CAR activation expression vector. Cells positive for cytokines were sorted by flow cytometry and further subjected to monoclonal screening. The sorted CD19 synNotchCAR-NK-92MI and CD19 synNotchCAR-THP-1 were co-cultured with Nalm-6 or K562, and HER2 synNotch CAR-NK-92MI and HER2 synNotch CAR-THP-1 were co-cultured with SKOV3 or TC-1. The results showed that CD19 positive Nalm-6 could drive the expression of cytokines and co-stimulatory molecules in CD19-CAR-Gal4-VP64-NK92MI, and HER2 positive SKOV3 could drive the expression of cytokines and co-stimulatory molecules in HER2-CAR-Gal4-VP64-THP-1, while the corresponding antigen-negative cells could not drive the expression of cytokines and co-stimulatory molecules( Figure 16 ), indicating that synNotch CAR could effectively control the expression of memory-induced cytokines / co-stimulatory molecules, thus achieving precise targeted delivery of memory-inducing factors. This indicated that under the stimulation of tumor cells without target antigens, the targeted trained immune carrier cells did not express memory-inducing factors, and under the stimulation of tumor cells carrying target antigens, the targeted trained immune carrier cells could express memory-inducing factors.

[0090] Example 4 Preparation and Application of Targeted Trained Immune Carrier Vesicles

[0091] 1. Preparation of Targeted Trained Immune Carrier Vesicles

[0092] On the basis of the above-mentioned training of immune-induced cells, lentiviruses carrying CD19-CAR-CD8TM-CD28-CD3ζ and HER2-CAR-CD8TM-CD28-CD3ζ vectors were used to infect and sort CAR-positive cells. mIL-21-CD137L-CD48-K562, mIL-21-CD137L-CD48-NK92, mIL-21-CD137L-CD48-MSC, mIL-7-mIL-12-mIL-15-CD40-THP-1, and mIL-7-mIL-12-mIL-15-CD86-TALL-104 were treated with a hypotonic solution and homogenized in a glass homogenizer. After centrifugation at 1000 g to obtain the supernatant, it was sonicated for 20 seconds at 40% power, and then passed through 10 μm / 5 μm / 1 μm polycarbonate membranes in sequence using a mini-extruder. After filtration through a 0.22 μm filter, it was concentrated through a 100 KD ultrafiltration column. The results of NTA analysis showed that the vesicle diameter was concentrated between 100 - 300 nm, and the vesicles had obvious membrane boundaries under the electron microscope( Figure 17 ). Vesicle structures with a diameter of approximately 100 - 200 nm can be seen from the figure. Therefore, a large number of nano-scale engineered vesicles can be further obtained in the present invention.

[0093] 2. Tumor-killing effect of targeted training immune carrier cells and targeted training immune carrier vesicles on enhancing NK / CAR-T cells

[0094] Mononuclear cells from healthy donors were extracted, resuspended in lymphocyte medium containing 200 U / mL IL-2, and counted. mIL-21-CD137L-CD48-NK92MI irradiated with 100 Gy was added at a cell number ratio of 1:8. Stimulation was repeated on the 7th day. On the 13th day, at a low effector-to-target ratio of 0.5:1, the expanded NK cells were used in combination with mIL-21-CD137L-CD48-NK92MI training immune-induced cells irradiated with 10 Gy (Group 1), HER2-targeted expressing mIL-21-CD137L-CD48 NK92MI training immune carrier cells (Group 2), HER2-targeted expressing mIL-21-CD137L-OX40L THP-1 training immune carrier cells (Group 3), HER2-targeted carrying mIL-21-CD137L-CD48 NK92MI training immune carrier vesicles (Group 4), and HER2-targeted carrying mIL-21-CD137L-OX40L THP-1 training immune carrier vesicles (Group 5) to kill SKOV3. The control group was treated with NK cells alone.

[0095] mIL-7-mIL-12-mIL-15-CD86-TALL-104 amplified CD19-CART cells combined with 25Gy irradiated mIL-7-mIL-12-mIL-15-CD86-TALL-104 trained immune induction cells (Group 6), CD19-targeted TALL-104 trained immune carrier cells expressing mIL-7-mIL-12-mIL-15-CD86 (Group 7), CD19-targeted THP-1 trained immune carrier cells expressing mIL-7-mIL-12-mIL-15-CD40 (Group 8), CD19-targeted TALL-104 trained immune carrier vesicles carrying mIL-7-mIL-12-mIL-15-CD86 (Group 9), CD19-targeted THP-1 trained immune carrier vesicles carrying mIL-7-mIL-12-mIL-15-CD40 (Group 10) killed Nalm-6. The control group was treated with CD19-CART cells alone.

[0096] CD19-CAR-T combined with CD19-targeted trained immune carrier cells and CD19-targeted trained immune carrier vesicles killed Nalm-6. The results showed that both targeted trained immune carrier cells and targeted trained immune carrier vesicles could enhance the anti-tumor effects of NK cells / CD19 CAR-T cells ( Figure 18 ).

[0097] 3. Trained immune induction cells / targeted trained immune carrier vesicles promote the anti-tumor effect of NK cells

[0098] SKOV3 tumor cells carrying luciferase and green fluorescent protein (GFP) dual reporter genes were injected into the tail veins of NSG mice. On the second day, 100Gy mIL-21-CD137L-CD48-NK92MI amplified NK cells were injected into the tail veins. The control group was injected with an equal amount of PBS. Subsequently, PBS or targeted trained immune carrier vesicles HER2CAR-mIL-21-CD137L-CD48-THP-1-EVs, or targeted trained immune carrier cells HER2synNotchCAR-mIL-21-CD137L-CD48-THP1 were injected every 3 days for 3 times. The in vivo imaging results of the mice showed that both trained immune induction cells and targeted trained immune carrier vesicles could promote the clearance of tumor cells in the mice ( Figure 19 ).

[0099] NSG mice were injected with Nalm-6 tumor cells carrying the dual reporter genes of luciferase and green fluorescent protein (GFP) via the tail vein. On the second day, 100 Gy of mIL-7-mIL-12-mIL-15-CD40-THP-1-expanded NK-like T cells were injected via the tail vein. The control group was injected with an equal amount of PBS. Subsequently, the targeted trained immune carrier vesicles CD19CAR-mIL-21-CD137L-CD48-THP-1-EVs, or the targeted trained immune carrier cells CD19synNotchCAR-mIL-21-CD137L-CD48-THP1, CD19synNotchCAR-mIL-21-CD137L-CD48-NK-92MI were injected every 3 days for 3 times. The in vivo imaging results of the mice showed that the trained immune-induced cells and the targeted trained immune carrier vesicles could promote the clearance of tumor cells in the mice( Figure 20 ).

[0100] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. A genetic engineering vector, characterized in that, The genetic engineering vectors include genetic engineering vector 1 and genetic engineering vector 2; The genetic engineering vector 1 includes an overexpression vector and a knockout vector; the overexpression vector encodes a membrane-bound / membrane-anchored cytokine and a co-stimulatory molecule that induce memory-like properties in immune cells; the membrane-bound / membrane-anchored cytokine is expressed by fusing the cytokine with a transmembrane protein or a membrane-anchored protein; the membrane-bound / membrane-anchored cytokine and the co-stimulatory molecule are linked by one or more of furin-GSG-P2A, furin-GSGS-T2A, and furin-GSGS-F2A; the knockout vector is a B2M / IDO / IL-10-Cas9 triple knockout vector; The genetic engineering vector 2 includes a CAR targeting vector, a SynNotch CAR targeting vector, a SynNotch CAR activation expression vector, and a knockout vector; the CAR targeting vector consists of an antigen receptor, a transmembrane domain, and an intracellular activation domain; the SynNotch CAR targeting vector consists of an antigen receptor, a Notch core transmembrane region, and an intracellular transcription domain; the SynNotch CAR activation expression vector drives the encoding of any one of the proteins encoded by the corresponding overexpression vector through synNotch CAR activation; the knockout vector is a B2M / IDO / IL-10-Cas9 triple knockout vector.

2. The genetic engineering vector according to claim 1, characterized in that, The overexpression vector encodes any one of the following proteins: IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-OX40L, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD86, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD40, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-7-GPI-furin-GSGS-F2A-CD40, IL-21-CD8TM-furin-GSG-P2A-4-1BBL-furin-GSGS-F2A-CD48, IL-12p40-(G4S)3-IL-12p35-CD28TM-furin-GSG-P2A-IL-15-CD8TM-furin-GSGS-T2A-IL-18-GPI-furin-GSGS-F2A-OX40L; the nucleotide sequences of the proteins encoded by the overexpression vector are as shown in SEQ ID NO:1-7 in sequence.

3. The genetic engineering vector according to claim 1, characterized in that, In the B2M / IDO / IL-10-Cas9 triple knockout vector, the sgRNA sequence for knocking out the B2M gene is as shown in SEQ ID NO:8, the sgRNA sequence for knocking out the IDO gene is as shown in SEQ ID NO:9, and the sgRNA sequence for knocking out the IL-10 gene is as shown in SEQ ID NO:

10.

4. The genetic engineering vector according to claim 1, characterized in that, The CAR vector encodes any one of the following proteins: CD19-CAR-CD8TM-CD28-CD3ζ, HER2-CAR-CD8TM-CD28Z-CD3ζ, HER2-CAR-CD8TM-CD28Z-CD3ζ; the synNotch CAR targeting vector encodes any one of the following proteins: CD19-CAR-Gal4-VP64, HER2-CAR-Gal4-VP64.

5. Tumor chemotactic engineered cells, characterized in that, The tumor chemotactic engineered cells include trained immune induction cells and targeted trained immune carrier cells; The trained immune induction cells are transfected with the genetic engineering vector 1 described in claim 1; the targeted trained immune carrier cells are transfected with the genetic engineering vector 2 described in claim 1.

6. The tumor chemotactic engineered cell according to claim 5, wherein The cells used for constructing the tumor chemotactic engineering cells are a cell line with tumor chemotaxis or an embryonic stem cell line.

7. The tumor chemotactic engineered cell according to claim 5, characterized in that, The B2M / IDO / IL-10-Cas9 triple knockout vector in the genetic engineering vector 1 and the genetic engineering vector 2 is introduced into the tumor chemotactic cell line by electroporation.

8. The tumor chemotactic engineered cell according to claim 5, wherein The overexpression vector in the genetic engineering vector 1 or the CAR targeting vector, SynNotch CAR targeting vector, and SynNotch CAR activation expression vector in the genetic engineering vector 2 are introduced into the tumor chemotactic cell line by lentiviral infection.

9. A targeted training immune carrier vesicle, characterized in that, In the process of constructing the trained immune induction cells described in claim 5, on the basis of sorting out MHC-I molecule-negative and cytokine / costimulatory molecule-positive cells, the CAR targeting vector described in claim 1 is transfected, CAR-positive cells are sorted, and targeted trained immune carrier vesicles are obtained through hypotonic treatment, ultrasound, membrane extrusion, and ultrafiltration operations.

10. Use of the genetic engineering vector according to any one of claims 1 to 4, or the tumor chemotactic engineering cells according to any one of claims 5 to 8, or the targeted trained immune carrier vesicles according to claim 9 in the preparation of a product for treating tumors.

Images