22q11 microdeletion syndrome mutation detection kit

Abstract

The invention discloses a 22q11 microdeletion syndrome mutation detection kit, which comprises: 1) 11 pairs of multiple PCR primers aiming at different 22q11 region target sites to be detected, one primer in each pair of primers being provided with a fluorescent label; 2) 5 pairs of multiple PCR primers of reference genes, wherein one primer in each pair of primers is provided with a fluorescent mark; and 3) aiming at different to-be-detected 22q11 region target sites and internal control DNA fragments of reference genes, the internal control DNA fragments are highly consistent with amplification products of the corresponding multiple PCR primers in the step 1) and the step 2), and the internal control DNA fragments are sequences obtained by deleting or inserting a small number of 1-50 basic groups into the sequences of the corresponding amplification products. The kit disclosed by the invention can be used for effectively detecting the mutation condition of the 22q11 microdeletion syndrome, and is rapid, accurate and efficient in detection, so that effective early diagnosis, early intervention and genetic counseling can be realized, and the life quality of child patients is improved.

Description

Technical Field

[0001] The invention belongs to the technical field of biological detection and relates to a detection kit, and specifically to a 22q11 microdeletion syndrome mutation detection kit. Background Art

[0002] 22q11 microdeletion syndrome (22q11 DS), caused by microdeletions in the 22q11 region on chromosomes, is a common hereditary mental retardation disease. Clinically, DGS (Digeorge syndrome), VCFS (velocardiofacial syndrome) and CAFS (cone-truncal facial syndrome) have all been clearly proven to belong to 22q11 DS. Digeorge syndrome was first proposed by Cooper and Digeorge in a related article published in 1965. The article specifically described a group of patients with upper branchial arch development defects, characterized by conotruncal malformations, absence or dysplasia of the parathyroid glands and thymus. With the development of cytogenetics, especially molecular genetics technology, in the 1990s, Carey AH et al. published an article pointing out that 90% of patients with DGS phenotypes have a deletion of the Digeorge chromosome region (DGCR) on chromosome 22, band 1, region 1.

[0003] Most 22q11 DS are new mutations, but can be inherited in an autosomal dominant manner. According to Mendel's law of inheritance, the inheritance rate of offspring is 50%, and the symptoms of offspring are more severe. About 8%-28% of children are transmitted from parents with mild symptoms. At present, according to the most widely accepted epidemiological research results, the minimum prevalence of 22q11 DS is inferred to be 1 / 4000 live births. The clinical symptoms caused by 22q11 DS are complex and diverse. There are currently more than 180 types, mainly concentrated in congenital heart disease, immune diseases, special facial features (typically: narrow palpebral fissures, helmet-shaped eyelids, protruding nasal root, hypertrophic nasal tip, square external ear, small mouth and chin), feeding difficulties in infancy, and mental cognition and intellectual disabilities. Patients often have abnormalities in multiple systems, with complex clinical manifestations. In addition, there is no treatment at the genetic level. Traditional treatment and intervention must pay more attention to the stages of growth and development and the complexity of the life systems involved. As a gene deletion disease, 22q11 DS has not yet been cured at the genetic level. However, early diagnosis, early intervention and genetic counseling can improve the quality of life of children, prevent serious diseases or death in children, and prevent the birth of the next generation with the same disease, which will undoubtedly reduce birth defects, improve the quality of the population, and be more conducive to the implementation of my country's eugenics policy. Therefore, it is of great significance to carry out timely, economical and effective screening and diagnosis in clinical practice.

[0004] Most 22q11 DS patients have microdeletions in the 22q11.2 region. Further studies have shown that a series of highly homologous genomic elements, called low copy repeats (LCRs), exist in a region of about 3Mb in 22q11, and are named LCR-A, LCR-B, LCR-C and LCR-D. Due to the high homology between LCRs, if LCRs are incorrectly combined during chromosome meiosis, non-allelic homologous recombination (NAHR) will occur, resulting in abnormal chromosome sequences.

[0005] In the common deletion region of 22q11, researchers have found multiple genes. There are many methods for detecting 22q11 microdeletion / microduplication, mainly including chromosome karyotype analysis, restriction fragment length polymorphism detection, Southern hybridization, FISH, gene chip technology and other methods. Among them, FISH method is the most sensitive and reliable, and has been used in clinical diagnosis, but due to high cost, long time consumption, and high technical difficulty, it cannot be used as a screening method for a large range of high-risk populations. Chromosome karyotype analysis includes ordinary banding analysis and high-resolution technology. It can not only detect 22q11 microdeletion / microduplication, but also observe other chromosomal abnormalities at the same time. The technology is mature and the operation is simple, but the detection rate is only 10% to 20%. Gene chip technology uses gDNA clones or cDNAs microarrays instead of metaphase chromosome spreads as hybridization targets, and uses the fluorescence ratio of the two signals on each target point of the microarray to reflect the copy number changes of the genomic DNA to be tested in the corresponding sequence or gene. This technology can be operated automatically, has high sensitivity and accuracy, and has the advantages of automation and programming. However, it also has limitations such as high price, a certain amount of special equipment and professionals with certain skills to operate, and cannot be widely used. Similar array-CGH, ​​SNP typing chip, Affymetrix microarray technology, second-generation sequencing technology, etc. are mainly used to detect unknown CNVs in the whole genome. These whole-genome CNVs detection technologies are advanced, accurate and efficient, but relatively expensive, especially when detecting certain specific genes or specific regions. It is not the best choice. Microsatellite DNA is widely distributed in the genome and has the advantages of high polymorphism and high genetic stability. Selecting these microsatellite DNA markers in the 22q11 region and performing PCR amplification can quickly and cost-effectively detect small deletions / duplications and roughly define the scope of the deletion. However, the disadvantage is that DNA samples from both parents must be available, and it is difficult to draw a diagnostic conclusion when the amount of polymorphic information is not high; and when performing PCR amplification, there is a phenomenon of allele loss, and the results need to be repeatedly verified. Although the RT-qPCR method is classic, its efficiency is too low, and multiple fragments cannot be detected simultaneously in one reaction system.

[0006] MLPA is mainly a technology for copy number detection of specific genes or specific regions, but it has relatively high requirements for the DNA quality of the tested specimens, and the MLPA method is not easy to establish. In addition, due to its reliance on ligation reactions, it does not have a time advantage over (multiple) PCR-type systems. Since the above technologies all have their own limitations, they cannot become commonly used or reliable diagnostic methods in clinical practice.

[0007] Like MLPA, AccuCopy technology can detect copy numbers of multiple exons in the same reaction tube. Moreover, AccuCopy has greater advantages and application prospects in diagnosing CNVs of specific genes or specific regions. AccuCopy technology is relatively simple to operate, requiring only a conventional PCR instrument and ABI3130XL sequencer, and the quality requirements for template DNA are not as high as MLPA. DNA extracted by various methods can meet the test requirements, and only 10-20ng of template DNA is required. At the same time, using AccuCopy technology, it only takes 4 hours to complete the entire test process, while MLPA takes 24 hours, which significantly improves efficiency. More importantly, AccuCopy technology has high precision and the accuracy of the results is also high.

[0008] In view of the above technical problems, the present invention combines AccuCopy technology to develop a 22q11 microdeletion variation detection kit, which can effectively detect 22q11 microdeletion variation and has high accuracy. Summary of the invention

[0009] The purpose of the present invention is to provide a 22q11 microdeletion syndrome mutation detection kit, which can effectively detect the 22q11 microdeletion variation, and the kit has high accuracy, so that it can effectively diagnose and intervene in early stage and carry out genetic counseling, improve the quality of life of children with the disease, avoid serious diseases or death of children with the disease, and avoid the birth of the next generation with the same disease. These can undoubtedly reduce birth defects, improve the quality of the population, and are more conducive to the implementation of my country's eugenics policy.

[0010] In order to achieve the above object, a technical solution provided by a specific embodiment of the present invention is as follows:

[0011] On the one hand, the present invention provides a primer combination for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome, including 11 pairs of multiplex PCR primers targeting different target sites in the 22q11 region to be detected. The 11 pairs of multiplex PCR primers targeting different target sites in the 22q11 region to be detected include 11 upstream multiplex PCR primers and 11 downstream multiplex PCR primers. The sequences of the 11 upstream multiplex PCR primers are shown in SEQ ID NO: 1-11 respectively, and the sequences of the 11 downstream multiplex PCR primers are shown in SEQ ID NO: 12-22 respectively.

[0012] On the other hand, the present invention also provides a kit for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome, including:

[0013] 1) The above-mentioned 11 pairs of multiplex PCR primers targeting different target sites in the 22q11 region to be detected, with a fluorescent label on one primer in each pair of primers;

[0014] 2) 5 pairs of multiplex PCR primers for reference genes, with a fluorescent label on one primer in each pair of primers;

[0015] 3) Internal control DNA fragments for different target sites in the 22q11 region to be detected and reference genes. The internal control DNA fragments are highly consistent with the amplification products of the corresponding multiplex PCR primers in 1) and 2), and are sequences with 1-50 bases deleted or inserted in the sequences of the corresponding amplification products.

[0016] In one or more embodiments of the present invention, the 11 pairs of multiplex PCR primers are all designed within or between LCR-A to LCR-D. Among them, 4 pairs are designed for the hotspot gene TBX1, and 1 pair of primers is designed for each of the remaining seven genes (MED15, CLTCL1, LZTR1, ZNF74, MAPK1, BID, DGCR8); or

[0017] The 5 pairs of multiplex PCR primers for reference genes include 5 upstream multiplex PCR primers and 5 downstream multiplex PCR primers. The sequences of the 5 upstream multiplex PCR primers are shown in SEQ ID NO: 23-27 respectively, and the sequences of the 5 downstream multiplex PCR primers are shown in SEQ ID NO: 28-32 respectively; the 5 pairs of multiplex PCR primers for reference genes are respectively designed on chromosomes 1, 10, 11, 14, and 18.

[0018] Preferably, the 22q11 microdeletion syndrome is DiGeorge syndrome, VCFS (velo-cardio-facial syndrome), and CAFS (conotruncal anomaly face syndrome).

[0019] In one or more embodiments of the present invention, the kit further comprises a pair of PCR primers for sex loci, and one of the primers in this pair is provided with a fluorescent label; the PCR primers for sex loci include an upstream sex locus primer and a downstream sex locus primer. The nucleotide sequence of the upstream sex locus primer is preferably as shown in SEQ ID NO:33, and the nucleotide sequence of the downstream sex locus primer is preferably as shown in SEQ ID NO:34.

[0020] In one or more embodiments of the present invention, the internal control DNA fragments are mixed in equal amounts;

[0021] Preferably, the kit further comprises a fluorescently labeled 2×Mastermix.

[0022] On the other hand, the present invention also provides an application of the above reagent for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome in detecting copy number variation in the 22q11 region;

[0023] Preferably, the 22q11 microdeletion syndrome is DiGeorge syndrome, VCFS (velo-cardio-facial syndrome), and CAFS (conotruncal anomaly face syndrome).

[0024] On yet another aspect, the present invention also provides a method for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome, comprising the following steps:

[0025] (1) Design 11 pairs of multiplex PCR primers for different target sites in the 22q11 region to be tested, and design 5 pairs of multiplex PCR primers for reference genes. At least one primer in each pair of multiplex PCR primers is designed with a fluorescent label, and the lengths of the amplification products corresponding to the multiplex PCR primers with the same fluorescent label are different;

[0026] (2) Design internal control DNA fragments for different target sites in the 22q11 region to be tested and reference genes. The internal control DNA fragments are highly consistent with the amplification products of the corresponding multiplex PCR primers in (1), and are sequences with 1-50 fewer or more bases deleted or inserted in the sequences of the corresponding amplification products;

[0027] (3) Extract the DNA of the sample to be tested and the reference sample to obtain the DNA of the sample to be tested and the reference sample. Then, mix the DNA of the sample to be tested and the reference sample with the internal control DNA fragments, 11 pairs of multiplex PCR primers, and 5 pairs of multiplex PCR primers respectively, and perform multiplex PCR amplification to obtain a PCR amplification product of the sample to be tested and a PCR amplification product of the reference sample, both of which include the amplification product of the internal control DNA.

[0028] (4) After separating the PCR amplification products by capillary electrophoresis, calculate the peak area according to the fluorescence intensity to obtain the copy numbers of different target sites in the 22q11 region to be detected.

[0029] In one or more embodiments of the present invention, the 11 pairs of multiplex PCR primers include 11 upstream multiplex PCR primers and 11 downstream multiplex PCR primers. The sequences of the 11 upstream multiplex PCR primers are shown in SEQ ID NO: 1 to 11 respectively, and the sequences of the 11 downstream multiplex PCR primers are shown in SEQ ID NO: 12 to 22 respectively; or

[0030] The 5 pairs of multiplex PCR primers include 5 upstream multiplex PCR primers and 5 downstream multiplex PCR primers. The sequences of the 5 upstream multiplex PCR primers are shown in SEQ ID NO: 23 to 27 respectively, and the sequences of the 5 downstream multiplex PCR primers are shown in SEQ ID NO: 28 to 32 respectively;

[0031] Preferably, the 22q11 microdeletion syndrome is DiGeorge syndrome, VCFS (velo-cardio-facial syndrome), and CAFS (conotruncal anomaly face syndrome).

[0032] In one or more embodiments of the present invention, in step (3), perform multiplex PCR amplification to obtain a PCR amplification product, and then fluorescently label and amplify the PCR product through a fluorescently labeled 2×Mastermix to obtain a fluorescently labeled amplified PCR amplification product.

[0033] In one or more embodiments of the present invention, in step (4), calculate the peak area by a method including the following steps to obtain the copy numbers of different target sites in the 22q11 region to be detected:

[0034] A. Calculate the fluorescence peak area ratio of the sample band / inner control DNA band for each target site in the 22q11 region to be detected according to the following formula:

[0035] R = S / I,

[0036] where S is the peak area value of the sample band and I is the peak area value of the corresponding inner control DNA band;

[0037] B. Then calculate the relative gene copy number of the target site in the 22q11 region to be detected according to the following formula:

[0038] Relative gene copy number = [T (RR) / R (RR) × 2,

[0039] where RR represents the ratio of the R value of the target site to the R value of the reference site, and T (RR)Represents the RR value of the target site of the sample to be tested, R (RR) Represents the RR value of the corresponding target site of the reference sample.

[0040] In one or more embodiments of the present invention, in step (3), after mixing each internal control DNA fragment in equal amounts, it is further mixed with 11 pairs of multiplex PCR primers and 5 pairs of multiplex PCR primers;

[0041] Preferably, before mixing each internal control DNA fragment in equal amounts, it further includes the step of strictly quantifying each internal control DNA fragment.

[0042] Compared with the prior art, the 22q11 microdeletion syndrome mutation detection kit of the present invention combines the AccuCopy technology to develop a detection kit for 22q11 microdeletion variations. 11 pairs of primers are designed for the 22q11 region within or between LCR-A to LCR-D, 5 pairs of reference primers are designed for chromosomes 1, 10, 11, 14, 18, and internal control DNA fragments are designed for 11 pairs of primers and 5 pairs of reference primers. When this kit is used for 22q11 microdeletion syndrome mutation detection, it has the following advantages:

[0043] 1. Rapid detection: As long as the sample DNA is mixed with the internal control DNA and then subjected to multiplex PCR, and then the PCR product is directly loaded onto a capillary fluorescence electrophoresis instrument (such as an ABI sequencer), the entire experimental process only requires a conventional PCR reaction and one-step capillary electrophoresis, and the time-consuming is less than 6 hours;

[0044] 2. High accuracy: Since there are only a few base differences between the target gene fragment and its internal control DNA, the amplification efficiencies of these two templates will show a high degree of consistency. Therefore, the final amplification product truly reflects the concentration ratio of the two templates before amplification. According to our pre-test results, when the target gene fragment and the internal control DNA fragment are mixed at different dilution gradients for competitive PCR, we found that the correlation between the ratio of the sample peak area to the internal control peak area and the original concentration ratio of the two templates reaches more than 99.9%;

[0045] 3. Low cost: The kit of the present invention is based on a first-generation sequencing platform for detection, and the cost is lower compared with the second-generation platform;

[0046] 4. High resolution: The kit of the present invention can accurately quantify sites within 6 copies.

[0047] Therefore, the kit of the present invention can effectively detect the mutation of 22q11 microdeletion syndrome, thereby enabling effective early diagnosis, early intervention and genetic counseling, improving the quality of life of children with the disease, avoiding serious diseases or death in children, and avoiding the birth of the next generation with the same disease. It can undoubtedly reduce birth defects, improve the quality of the population, and is more conducive to the implementation of my country's eugenics policy. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments recorded in the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0049] Figure 1 It is a schematic diagram of the principle of the detection method of the present invention;

[0050] Figure 2 Schematic diagram of the capillary electrophoresis detection results of two samples in Example 2 of the present invention. DETAILED DESCRIPTION

[0051] In order to enable those skilled in the art to better understand the technical solutions in the present invention, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0052] Unless otherwise specified, the reagents and materials herein can be purchased from conventional channels.

[0053] Unless otherwise specified, the term "competitor DNA" herein refers to the "internal control DNA fragment".

[0054] Example 1 Design and synthesis of primers and internal control DNA fragments

[0055] 1. Eleven pairs of multiplex PCR primers were optimized and designed within or between LCR-A to LCR-D in the 22q11 region, and five pairs of multiplex PCR primers for reference genes on chromosomes 1, 10, 11, 14, and 18 were designed, one of which was labeled with a fluorescent primer sequence; a pair of PCR primers for gender loci was designed, one of which was labeled with a fluorescent primer sequence; the lengths of the corresponding amplification products of the above-mentioned multiplex PCR primers with the same fluorescent label were different.

[0056] 2. For the internal control DNA fragments of different target sites and reference genes in the 22q11 region to be measured, the internal control DNA fragments are highly consistent with the amplification products of the corresponding multiplex PCR primers in 1, and are sequences with a deletion or insertion of a small number of 1 - 50 bases in the sequences of the corresponding amplification products.

[0057] 3. Synthesize 11 pairs of multiplex PCR primers, 5 pairs of reference primers, and the designed internal control DNA fragments.

[0058] The sequences of the above primers are as follows:

[0059] The sequences of 11 upstream multiplex PCR primers are shown in SEQ ID NO: 1 - 11 respectively, specifically as follows:

[0060] 22q11 - 1 - F: GTTTCTTTAGGGTGACCCAAGGCCTCAT (SEQ ID NO: 1)

[0061] 22q11 - 2 - F: ACACGACCGGTAACGCTTAGATGCCCAACTCATCCAGGAAACT (SEQ ID NO: 2)

[0062] 22q11 - 3 - F: GTTTCTTTGTTCCAGGGGGCACAATGACAGT (SEQ ID NO: 3)

[0063] 22q11 - 4 - F: GTTTCTTTTTGTCAAGGCCCTCTGGGTTCA (SEQ ID NO: 4)

[0064] 22q11 - 5 - F: ACACGACCGGTAACGCTTAGACTTTGAGCCATGGTCAGTCTGGTAG (SEQ ID NO: 5)

[0065] 22q11 - 6 - F: GTTTCTTACTTGGTCCAGGCTCCCTACCT (SEQ ID NO: 6)

[0066] 22q11 - 7 - F: ACACGACCGGTAACGCTTAGAAGGGGGTTACACTGGGGACATT (SEQ ID NO: 7)

[0067] 22q11 - 8 - F: GTTTCTTCCTTTGGAACCATGGACACAGAAT (SEQ ID NO: 8)

[0068] 22q11-9-F: GTTAAAAATACCTTCCAATAAGGAGCTTGGA (SEQ ID NO:9)

[0069] 22q11-10-F: ACACGACCGGTAACGCTTAGACACGTAGGTGCGTAGGTTCTGGT (SEQ ID NO:10)

[0070] 22q11-11-F:

[0071] ACACGACCGGTAACGCTTAGAGAAAATGAAGGACAACGAGGAACG (SEQ ID NO:11)

[0072] The sequences of 11 downstream multiplex PCR primers are shown in SEQ ID NO:12-22 respectively:

[0073] 22q11-1-R: ACACGACCGGTAACGCTTAGAAGCATCGCAGGTGCCTAAAGAG (SEQ ID NO:12)

[0074] 22q11-2-R: GTTTCTTTTTCCTCACCCGATGGTTCTGGTA (SEQ ID NO:13)

[0075] 22q11-3-R: ACACGACCGGTAACGCTTAGACACGTGCACTTCCCGTTCAT (SEQ ID NO:14)

[0076] 22q11-4-R: ACACGACCGGTAACGCTTAGATTCATCCACTGCGCGCCCTT (SEQ ID NO:15)

[0077] 22q11-5-R: GTTTCTTGGCACCAAGGCTACCCATCC (SEQ ID NO:16)

[0078] 22q11-6-R: ACACGACCGGTAACGCTTAGATGGATCACTTTGCTTGGCACAT (SEQ ID NO:17)

[0079] 22q11-7-R: GTTTCTTACCAATCCCAAGCTCCCTGCTA (SEQ ID NO:18)

[0080] 22q11-8-R:

[0081] ACACGACCGGTAACGCTTAGATTTTACCTAGGGCAAGAAGGTTCTGGTA(SEQ ID NO:19)

[0082] 22q11-9-R:

[0083] ACACGACCGGTAACGCTTAGATAAATGTTTTGTTTTCTTTTAAAGCCCATC(SEQ ID NO:20)

[0084] 22q11-10-R: GTTTCTTAGGTTCTGTGTGCCCCTCTGTG(SEQ ID NO:21)

[0085] 22q11-11-R: GTTTCTTTGTTTTTCCCATAGAGTCAGGCTCATCCA(SEQ ID NO:22)

[0086] The multiplex PCR primers for 5 reference genes include 5 upstream multiplex PCR primers and 5 downstream multiplex PCR primers. Among them,

[0087] The sequences of the 5 upstream multiplex PCR primers are shown in SEQ ID NO:23 - 27 respectively:

[0088] Reference gene primer 1:

[0089] ACACGACCGGTAACGCTTAGATGTGTTCAAGAGGGAGGGGAGTT(SEQ ID NO:23)

[0090] Reference gene primer 2:

[0091] ACACGACCGGTAACGCTTAGAGTGATGGCTGAGGTATGGAGCA(SEQ ID NO:24) Reference gene primer 3:

[0092] ACACGACCGGTAACGCTTAGACAAAGGTATGGTTGGTGGATGGA(SEQ ID NO:25)

[0093] Reference gene primer 4:

[0094] ACACGACCGGTAACGCTTAGACAAGCACAGGCTGCCCTGAC(SEQ ID NO:26) Reference gene primer 5:

[0095] ACACGACCGGTAACGCTTAGAGCAGAGGCCAAGAAATGCTGA(SEQ ID NO:27)

[0096] The sequences of the five downstream multiplex PCR primers are shown in SEQ ID NOs: 28-32 respectively:

[0097] Reference gene primer 1': GTTTCTTACCGACTGGTGCCGTCAAGT (SEQ ID NO: 28) Reference gene primer 2': GTTTCTTGCTCCACTGCTGGTCACAGG (SEQ ID NO: 29) Reference gene primer 3': GTTTCTTCTGCTTCGGGGACTGTGAGG (SEQ ID NO: 30) Reference gene primer 4': GTTCTTTAGAAAGAACATCACCAGGCCCCTA (SEQ ID NO: 31) Reference gene primer 5': GTTTCTTTCTGACATGAAGAATGGAGATTTGCT (SEQ ID NO: 32) The PCR primers for the sex site include an upstream sex site primer and a downstream sex site primer, as follows:

[0098] Upstream sex locus primers:

[0099] ACACGACCGGTAACGCTTAGATCCCTGGGCTCTGTAAAGAATAGTG(SEQ ID NO:33)

[0100] Downstream sex locus primers:

[0101] GTTTCTTGAGGCCAACCATCAGAGCTTA (SEQ ID NO: 34).

[0102] Example 2 Sample Detection

[0103] 1. Sample pretreatment: 9 female samples and 4 male samples were tested using the kit of the present invention, where sample 1 (Digeorge-Y1) was a reference sample, DNA was extracted from these samples, and the DNA of these samples was quantitatively diluted to 20 ng / μL;

[0104] 1.1 Take out the "DNA pre-denaturation solution" from the kit, melt it at room temperature, and gently shake to mix, centrifuge at low speed for a few seconds, and place it on ice or in an ice box for later use.

[0105] 1.2 Aliquot 5 μL of DNA pre-denaturation solution into each PCR tube; then sequentially add 1 μL of the test sample DNA (total 20 ng), reference sample DNA (total 20 ng), and blank control to the corresponding PCR tubes. After adding, immediately cover with a lid or PCR cover film, centrifuge slightly, and place on a PCR instrument (such as ABI 2720 PCR instrument), and immediately start the following program: 98 °C for 5 minutes; hold at 4 °C.

[0106] Note: If the sample concentration is lower than 20 ng / μL, adjust the volume of the sample DNA so that the total amount of DNA in the system is 20 ng. The normal control DNA can be selected from 1 to 4 normal sample DNAs of the same type as the test sample and with the same extraction method.

[0107] 2. Multiplex competitive PCR amplification reaction: Then, according to the following ratio "10 μL of 2×PCR Mastermix, add each substance synthesized in Example 1 according to the following ratio, 2 μL of internal control DNA fragment (1×), and 2 μL of multiplex PCR primers (including 11 pairs of multiplex PCR primers and 5 pairs of reference gene multiplex PCR primers)", prepare the DNA pre-denaturation solutions prepared in 1 above into test sample DNA, reference sample DNA, and blank control PCR reaction mixtures respectively; gently shake and mix well, centrifuge at low speed for a few seconds, aliquot 14 μL / well into the reaction wells that have completed pre-denaturation, immediately cover with a lid, centrifuge slightly, and place on a PCR instrument, and immediately start the following thermal cycling program: 95 °C for 10 min, (94 °C for 20 s, 64 °C - 0.5 °C / cycle for 40 s, 72 °C for 1.5 min) × 7, (94 °C for 20 s, 60 °C for 30 s, 72 °C for 1.5 min) × 28, 72 °C for 2 min, hold at 16 °C.

[0108] 3. Fluorescent labeling reaction: Prepare a fluorescent labeling reaction mixture according to the ratio "5 μL of fluorescent labeling 2×Mastermix, 4 μL of sterile pure water", gently shake and mix well, centrifuge at low speed for a few seconds, aliquot 9 μL / well into new PCR reaction wells, and sequentially add 1 μL of PCR reaction product. Immediately cover with a lid, centrifuge slightly, and place on a PCR instrument, and immediately start the following thermal cycling program: 95 °C for 2 min, (94 °C for 20 s, 56 °C for 40 s, 72 °C for 3 min) × 30, hold at 16 °C, to obtain the PCR amplification products of the test sample and the reference sample, both of which include the internal control DNA amplification product.

[0109] 4. Capillary electrophoresis: Take 1 μL of the product and mix it with 8.9 μL of HiDi and 0.1 μL of Liz500, with a total volume of 10 μL. After denaturation at 95 °C for 5 min, perform capillary electrophoresis on an ABI3730XL sequencer;

[0110] 5. Copy number calculation: Calculate the fluorescence peak area ratio of the sample band to the internal control DNA band at each target site in the 22q11 region, then divide the ratio of the target site of the sample to be tested by the ratio of the reference gene and then divide by the above corresponding ratio of the reference sample, and finally multiply by the copy number of the target site of the reference sample to obtain the relative copy number of the target site of the sample to be tested.

[0111] Specifically, the peak area can be calculated by a method including the following steps to obtain the copy numbers of different target sites in the 22q11 region to be tested:

[0112] A. Calculate the fluorescence peak area ratio of the sample band to the internal control DNA band at each target site in the 22q11 region to be tested according to the following formula:

[0113] R = S / I,

[0114] where S is the peak area value of the sample band and I is the peak area value of the corresponding internal control DNA band;

[0115] B. Then calculate the relative gene copy number of the target site in the 22q11 region to be tested according to the following formula:

[0116] Relative gene copy number = [T (RR) / R (RR) × 2,

[0117] where RR represents the ratio of the R value of the target site to the R value of the reference site, T (RR) represents the RR value of the target site of the sample to be tested, and R (RR) represents the RR value of the corresponding target site of the reference sample.

[0118] Specific original peak maps and calculation results are shown in Figure 2 and Table 1-2.

[0119] Table 1

[0120]

[0121] Table 2

[0122]

[0123] From Figure 2As can be seen from Table 1-2 above, the 2nd (Y2) and 7th (Y7) samples clearly show copy number variations at some loci: Y2 is DEL(Chr22:19220820-21342323), indicating that the copy numbers of the CLTCL1, TBX1, DGCR8, ZNF74, MED15, and LZTR1 genes in the corresponding system are 1 copy; Y7 is DEL(Chr22:19220820-20077607), indicating that the copy numbers of the CLTCL1, TBX1, and DGCR8 genes in the corresponding system are 1 copy. In addition, the other loci are all normal with two copies. Therefore, the peak patterns of this system detected by the method of the present invention are uniform, the amplification status of each locus is good, and the calculation results also show high data quality, which indicates that the detection accuracy of the kit of the present invention is high and the resolution is high, and it can accurately quantify the loci within 6 copies.

[0124] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above-described exemplary embodiments, and can be implemented in other specific forms without departing from the spirit or basic characteristics of the present invention. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-limiting. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be included in the present invention. Any reference signs in the claims should not be regarded as limiting the claimed invention.

[0125] In addition, it should be understood that although this specification is described according to embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A primer combination for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome, comprising 11 pairs of multiplex PCR primers targeting different target sites in the 22q11 region to be detected. The 11 pairs of multiplex PCR primers targeting different target sites in the 22q11 region to be detected include 11 upstream multiplex PCR primers and 11 downstream multiplex PCR primers. The sequences of the 11 upstream multiplex PCR primers are shown as SEQ ID NO:1 to 11 respectively, and the sequences of the 11 downstream multiplex PCR primers are shown as SEQ ID NO:12 to 22 respectively.

2. A kit for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome, comprising: 1) The 11 pairs of multiplex PCR primers targeting different target sites in the 22q11 region to be detected in claim 1, with a fluorescent label on one primer of each pair of primers; 2) 5 pairs of multiplex PCR primers for reference genes, with a fluorescent label on one primer of each pair of primers; 3) Internal control DNA fragments for different target sites in the 22q11 region to be detected and reference genes. The internal control DNA fragments are highly consistent with the amplification products of the corresponding multiplex PCR primers in 1) and 2), and are sequences with 1 - 50 bases deleted or inserted in the sequences of the corresponding amplification products.

3. The kit for detecting copy number variation of the 22q11 region for the detection of 22q11 microdeletion syndrome according to claim 2, characterized in that, The 5 pairs of multiplex PCR primers for reference genes include 5 upstream multiplex PCR primers and 5 downstream multiplex PCR primers. The sequences of the 5 upstream multiplex PCR primers are shown as SEQ ID NO:23 to 27 respectively, and the sequences of the 5 downstream multiplex PCR primers are shown as SEQ ID NO:28 to 32 respectively; Preferably, the 22q11 microdeletion syndrome is DiGeorge syndrome, VCFS (velo - cardio - facial syndrome), and CAFS (conotruncal anomaly face syndrome).

4. The kit for detecting copy number variation of the 22q11 region for the detection of 22q11 microdeletion syndrome according to claim 2 or 3, characterized in that, The kit further includes a pair of PCR primers for sex loci, with a fluorescent label on one primer of this pair of primers. The PCR primers for sex loci include an upstream sex locus primer and a downstream sex locus primer. The nucleotide sequence of the upstream sex locus primer is preferably shown as SEQ ID NO:33, and the nucleotide sequence of the downstream sex locus primer is preferably shown as SEQ ID NO:34; Preferably, the internal control DNA fragments are mixed in equal amounts; More preferably, the kit also contains a fluorescently labeled 2×Mastermix.

5. Use of the reagent for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome according to any one of claims 2 to 4 in detecting copy number variation in the 22q11 region; Preferably, the 22q11 microdeletion syndrome is DiGeorge syndrome, VCFS (velo - cardio - facial syndrome), and CAFS (conotruncal anomaly face syndrome).

6. A method for detecting copy number variation in the 22q11 region of 22q11 microdeletion syndrome, comprising the following steps: (1) Design 11 pairs of multiplex PCR primers for different target sites in the 22q11 region to be tested, and design 5 pairs of multiplex PCR primers for reference genes. Fluorescent labels are designed on at least one primer in each pair of multiplex PCR primers, and the lengths of the amplified products corresponding to the multiplex PCR primers with the same fluorescent label are different; (2) Design internal control DNA fragments for different target sites in the 22q11 region to be tested and reference genes. The internal control DNA fragments are highly consistent with the amplified products of the corresponding multiplex PCR primers in (1), and are sequences with 1 - 50 bases deleted or inserted in the sequences of the corresponding amplified products; (3) Extract the DNA of the sample to be tested and the reference sample to obtain the DNA of the sample to be tested and the reference sample. Then, mix the DNA of the sample to be tested and the reference sample with the internal control DNA fragments, 11 pairs of multiplex PCR primers and 5 pairs of multiplex PCR primers respectively, and perform multiplex PCR amplification to obtain the PCR amplification products of the sample to be tested and the reference sample, both of which include the amplified products of the internal control DNA; (4) Then, separate the PCR amplification products by capillary electrophoresis, calculate the peak area according to the fluorescence intensity, and obtain the copy number of different target sites in the 22q11 region to be tested.

7. The method for detecting copy number variation of the 22q11 region in 22q11 microdeletion syndrome according to claim 6, wherein The 11 pairs of multiplex PCR primers include 11 upstream multiplex PCR primers and 11 downstream multiplex PCR primers. The sequences of the 11 upstream multiplex PCR primers are shown in SEQ ID NO: 1 - 11 respectively, and the sequences of the 11 downstream multiplex PCR primers are shown in SEQ ID NO: 12 - 22 respectively; or The 5 pairs of multiplex PCR primers include 5 upstream multiplex PCR primers and 5 downstream multiplex PCR primers. The sequences of the 5 upstream multiplex PCR primers are shown in SEQ ID NO: 23 - 27 respectively, and the sequences of the 5 downstream multiplex PCR primers are shown in SEQ ID NO: 28 - 32 respectively; Preferably, the 22q11 microdeletion syndrome is DiGeorge syndrome, VCFS (velo - cardio - facial syndrome) and CAFS (conotruncal anomaly face syndrome).

8. The method for detecting copy number variation of the 22q11 region in 22q11 microdeletion syndrome according to claim 6 or 7, characterized in that, In step (3), perform multiplex PCR amplification to obtain PCR amplification products, and then perform fluorescence - labeled amplification on the PCR products through fluorescence - labeled 2×Mastermix to obtain fluorescence - labeled amplified PCR amplification products.

9. The method for detecting copy number variation of the 22q11 region for 22q11 microdeletion syndrome according to any one of claims 6 to 8, characterized in that, In step (4), calculate the peak area by the following method to obtain the copy number of different target sites in the 22q11 region to be tested: A. Calculate the fluorescence peak area ratio of the sample band / internal control DNA band for each target site in the 22q11 region to be tested according to the following formula: R = S / I, where S is the peak area value of the sample band, and I is the peak area value of the corresponding internal control DNA band; B. Then calculate the relative gene copy number of the target site in the 22q11 region to be tested according to the following formula: Relative gene copy number = [T (RR) / R (RR) × 2, Among them, RR represents the ratio of the R value of the target site to the R value of the reference site, and T (RR) represents the RR value of the target site of the sample to be tested, and R (RR) represents the RR value of the corresponding target site of the reference sample.

10. The method for detecting copy number variation of the 22q11 region for the detection of 22q11 microdeletion syndrome according to any one of claims 6 to 9, characterized in that, In step (3), after mixing each internal control DNA fragment in equal amounts, mix it with 11 pairs of multiplex PCR primers and 5 pairs of multiplex PCR primers; Preferably, before mixing each internal control DNA fragment in equal amounts, it further includes the step of strictly quantifying each internal control DNA fragment.

Images