Marker for treating and / or diagnosing renal tubule injury of diabetic nephropathy, kit, treatment target spot and application
By using circARHGAP39 as a biomarker and therapeutic target, quantitative detection and siRNA technology are used to solve the diagnosis and treatment problems of renal tubular injury in diabetic nephropathy, significantly alleviating renal tubular injury and fibrosis, and improving the therapeutic effect.
Patent Information
- Application Number
- CN202510411073.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-02
- Publication Date
- 2025-07-04
AI Technical Summary
The existing biomarkers and therapeutic targets for the treatment and diagnosis of tubular injury in diabetic nephropathy lack specificity and effectiveness, resulting in limited efficacy and affecting the quality of life and survival of patients.
circARHGAP39 is used as a new biomarker and therapeutic target, and is diagnosed by a kit that quantitatively detects circARHGAP39 and is treated by knockdown or inhibiting circARHGAP39 expression, including siRNA sequences, to alleviate tubular damage and fibrosis.
The expression level of circARHGAP39 is significantly increased in diabetic nephropathy, by knocking down or inhibiting circARHGAP39 expression, it significantly reduces tubular damage and fibrosis, providing new diagnostic and therapeutic means, improving renal function and fibrosis status in patients.
Smart Images

Figure CN120249475A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the fields of biotechnology and medical technology, and particularly relates to a biomarker, a kit, a therapeutic target and an application for treating and / or diagnosing renal tubular injury in diabetic nephropathy. Background Art
[0002] Diabetic Kidney Disease (DKD) is one of the common complications of diabetic patients, seriously affecting the quality of life and survival rate of patients. With the increasing number of diabetic patients, the incidence of DKD is also rising year by year, becoming a public health problem worldwide. As one of the serious complications of diabetes, DKD has the risk of progressing to end-stage renal failure, and currently there is a lack of effective means for treating DKD clinically. Although DKD was formerly known as "podocytopathy", recent studies have shown that compared with glomerular pathological changes, the pathological damage of the renal tubulointerstitial has a greater impact on the long-term prognosis of DKD. The existing treatment methods mainly focus on controlling blood sugar and blood pressure, but for the already-occurred renal tubular injury, the curative effect is limited, resulting in a serious impact on the quality of life and survival rate of patients. For DKD, the existing biomarkers and therapeutic targets lack specificity and effectiveness. Therefore, there is an urgent need for new biomarkers and treatment strategies to more effectively treat and / or diagnose the renal tubular injury of DKD. Summary of the Invention
[0003] Aiming at the deficiencies of the above-mentioned prior art, the present invention aims to provide a biomarker, a kit, a therapeutic target and an application for treating and / or diagnosing renal tubular injury in diabetic nephropathy, providing a new biomarker for the diagnosis and treatment of renal tubular injury in diabetic nephropathy.
[0004] To solve the above problems, the present invention adopts the following technical solutions:
[0005] In the first aspect, the present invention provides a biomarker for treating and / or diagnosing renal tubular injury in diabetic nephropathy, and the biomarker is circARHGAP39.
[0006] As an implementable mode, the human gene sequence of the circARHGAP39 is as shown in SEQ ID NO.1; the murine gene sequence of the circARHGAP39 is as shown in SEQ ID NO.2.
[0007] In the second aspect, the present invention provides the application of a reagent for quantitatively detecting the circARHGAP39 in the preparation of a diagnostic reagent or an auxiliary diagnostic reagent for renal tubular injury in diabetic nephropathy.
[0008] As an implementable mode, the reagent includes primers shown in SEQ ID NO.3 and SEQ ID NO.4 or primers shown in SEQ ID NO.5 and SEQ ID NO.6.
[0009] In a third aspect, the present invention provides a kit for diagnosing or assisting in diagnosing diabetic nephropathy-induced renal tubular injury, including a reagent for quantitatively detecting the above-mentioned circARHGAP39.
[0010] In a fourth aspect, the present invention provides a therapeutic target for diabetic nephropathy-induced renal tubular injury, and the therapeutic target is circARHGAP39.
[0011] In a fifth aspect, the present invention provides an application of a reagent for knocking down or inhibiting the expression of the above-mentioned circARHGAP39 in the preparation of a reagent for treating or assisting in treating diabetic nephropathy-induced renal tubular injury.
[0012] As an implementable mode, the reagent for knocking down or inhibiting the expression of circARHGAP39 includes an siRNA sequence; the siRNA sequence includes:
[0013] The sequences for knocking down human circARHGAP39 are shown in SEQ ID NO.7 and SEQ ID NO.8;
[0014] The sequences for knocking down murine circArhgap39 are shown in SEQ ID NO.9 and SEQ ID NO.10.
[0015] As an implementable mode, knocking down or inhibiting the expression of circARHGAP39 alleviates the up-regulation of profibrotic gene expression in renal tubular epithelial cells induced by AGE-BSA.
[0016] As an implementable mode, knocking down or inhibiting the expression of circARHGAP39 alleviates renal tubular injury and renal fibrosis caused by diabetic nephropathy.
[0017] The beneficial effects of the present invention are as follows: Through circRNA microarray technology, the present invention screens out differentially expressed circRNAs in renal tubular epithelial cells under the condition of diabetic nephropathy. Among them, the expression level of circARHGAP39 is significantly increased in the renal cortex tissue of diabetic nephropathy mice, providing a new biomarker for the treatment and / or diagnosis of diabetic nephropathy-induced renal tubular injury. Description of the Drawings
[0018] Figure 1 It is a volcano plot of dysregulated circRNAs in cells treated with AGE-BSA compared with the control group HK2 for circRNA chip detection.
[0019] Figure 2 Sequence alignment analysis of circARHGAP39 in humans and mice.
[0020] Figure 3 Detection of the expression level of circARHGAP39 in AGE-BSA-treated HK2 cells.
[0021] Figure 4 Detection of the expression level of circARHGAP39 in the renal cortex of diabetic nephropathy mice induced by high-fat diet combined with streptozocin (STZ) injection.
[0022] Figure 5 Efficiency graph of knocking down circARHGAP39.
[0023] Figure 6 Immunoblotting was used to detect the effect of knocking down circARHGAP39 on the expression of profibrotic molecules in AGE-BSA-treated HK2 cells.
[0024] Figure 7 Graph showing the results of the determination of urinary albumin / creatinine ratio in mice of each group.
[0025] Figure 8 Pathological diagrams of renal fibrosis and statistical graphs of renal fibrosis scores in mice of each group.
[0026] Figure 9 Immunoblotting results graph of the expression of renal fibrosis molecules (FN, Collagen I, αSMA) in the renal cortex tissue of diabetic nephropathy mice after knocking down circARHGAP39.
[0027] Figure 10 Immunohistochemical diagrams and quantitative analysis of the expression of renal fibrosis molecules (FN, Collagen I, αSMA) in the renal cortex tissue of diabetic nephropathy mice after knocking down circARHGAP39. Detailed implementation manners
[0028] The present invention will be further described in detail below with reference to specific embodiments.
[0029] It should be noted that these embodiments are only used to illustrate the present invention, rather than limiting the present invention. Any simple improvement of this method under the premise of the concept of the present invention falls within the scope of protection required by the present invention.
[0030] Example 1
[0031] Culture and treatment of human proximal tubular HK2 cells
[0032] Human proximal tubular HK2 cells (ATCC, catalog number CRL-2190TM) were cultured in DMEM basal medium (Invitrogen) supplemented with 10% fetal bovine serum and placed in an incubator (Thermo Fisher Scientific) at 37°C with a 5% carbon dioxide concentration.
[0033] To mimic the damaging effect of advanced glycation end products (AGE-BSA) on renal tubular epithelial cells in a diabetic state, commercial AGEs-BSA was used to treat and observe its effect on TECs. When the confluence of HK2 cells reached 60 - 80%, the cells were treated with non-glycated control bovine serum albumin (NGC-BSA; Sigma Aldrich, B2064) or AGE-BSA (Abcam, ab51995) at a concentration of 30 μg / ml. NGC-BSA or AGE-BSA was removed at the corresponding time points for subsequent experiments.
[0034] Establishment of a mouse model of diabetic nephropathy
[0035] Six-week-old male C57BL / 6 mice (Beijing SPF Biotechnology Co., Ltd.) were fed a high-fat diet (60% fat energy high-fat diet, Jiangsu Xietong Bioengineering Co., Ltd., XTHF60) or a control diet (Jiangsu Xietong Bioengineering Co., Ltd., XTCON50J) for 4 weeks. Then, after 12 h of fasting, the mice received intraperitoneal injection of low-dose STZ (50 mg / kg body weight, for 5 consecutive days) dissolved in 50 mM sodium citrate buffer (pH 4.5), causing partial insulin deficiency. Control group mice received the same dose and number of injections of the solvent. After STZ injection, the mice continued to maintain a high-fat diet or a control diet for 24 weeks to induce chronic kidney injury. All mice had unrestricted access to food and water. At the end of the experiment, whole blood and 24-h urine samples of the mice were collected for biochemical analysis. The renal tissues of the mice were used for histopathological analysis. The renal cortex of the mice was used to extract proteins or RNA.
[0036] qRT-PCR
[0037] Total RNA was extracted from HK2 cells and mouse kidney tissues, and the complementary DNA strand of total RNA was synthesized according to the kit II 1 st Strand cDNA Synthesis Kit (Vazyme). Fluorescent quantitative PCR was performed according to TB Premix ExTaq TM(Tli RNaseH Plus) (Takara) instruction manual operation. The qRT-PCR primers related to the present invention are shown in Table 1.
[0038] Table 1 Primer Sequence Table
[0039]
[0040] Masson Staining and Fibrosis Degree Evaluation
[0041] Masson staining was performed and fibrosis was evaluated according to the instruction manual of the Masson trichrome staining solution kit (Nanjing Jiancheng Bioengineering Institute, China):
[0042] (1) Dewax the sections and hydrate the tissues with alcohol of gradient concentrations.
[0043] (2) Drop distilled water onto the sections to moisten the tissues for 30 s.
[0044] (3) Drop phosphomolybdic acid staining solution onto the tissues for 5 min, and then gently shake off the slides.
[0045] (4) Drop Masson aniline blue staining solution onto the tissues to stain for 5 min, and gently rinse the slides with distilled water.
[0046] (5) Drop the differentiating solution onto the tissues for 30 s, twice.
[0047] (6) Dehydrate with 95% alcohol and absolute ethanol for 3 min each in turn. Clear the tissues with xylene for 2 min and then mount the slides with neutral resin.
[0048] For kidney tissue sections, the method for evaluating the kidney fibrosis index is as follows: Experienced pathologists gave the following scores according to the percentage of the area occupied by renal interstitial fibrosis (under a 400× microscope lens): 0, no renal interstitial fibrosis; 1, <25% of the fields showed renal fibrosis; 2, 25 - 50% of the fields showed renal fibrosis; 3, >50% of the fields showed renal fibrosis. The score of each kidney sample was shown as the average value of the scores of at least 10 random fields.
[0049] Example 2
[0050] Identification of DKD-Related circRNAs by circRNA Microarray Technology
[0051] HK2 cells were treated with AGE-BSA (30 μg / ml) to simulate the damage stimulation of TEC by AGEs in the DKD state in vitro. Subsequently, circRNA microarray was used to detect the dysregulated circRNAs in HK2 cells treated with AGE-BSA.
[0052] The results showed that AGE-BSA induced an increase in the expression of 249 circRNAs and a decrease in the expression of 70 circRNAs (fold change > 1.5, P < 0.05, Figure 1 ). Among the 319 dysregulated circRNAs, circARHGAP39 was identified to be significantly upregulated in HK2 cells treated with AGE-BSA, with a fold increase of more than 7-fold.
[0053] The BLAST tool showed that the sequence conservation of circARHGAP39 between humans and mice was as high as 81% ( Figure 2 ).
[0054] It was detected that circARHGAP39 was significantly upregulated in HK2 cells treated with AGE-BSA and in the renal cortex of DKD mice induced by high-fat feeding combined with streptozocin (STZ) injection ( Figure 3 、 4 , ***, P < 0.001).
[0055] The human sequence of circARHGAP39 is shown in SEQ ID NO.1:
[0056] >hsa_circ_0086154|NM_025251|ARHGAP39(432nt) Human
[0057] GTTGGAGTGGGTGGAGATCATCGAACCGCGCACCCGCGAGCGCATGTACGCCAACCTGGTCACCGGTGAGTGCGTGTGGGACCCGCCGGCCGGCGTCCGCATCAAGCGCACCAGCGAGAACCAGTGGTGGGAGCTGTTCGACCCCAACACGTCCCGCTTCTACTACTACAATGCCAGCACGCAGCGCACGGTGTGGCACCGGCCGCAGGGCTGCGACATCATCCCGCTGGCCAAGCTGCAGACGCTGAAGCAGAACACGGAGTCCCCGCGCGCCTCGGCGGAGAGCAGCCCCGGGCGCGGCAGCAGCGTCAGCCGTGAGGGCAGCACCAGCTCCTCCCTGGAGCCCGAGCCCGACACTGAGAAAGCGCAGGAGTTGCCAGCGAGGGCCGGGCGGCCCGCGGCGTTTGGGACAGTGAAGGAGGACAGCGGCAG.
[0058] The murine sequence of circARHGAP39 is shown in SEQ ID NO.2:
[0059] >mmu_circ_0005813|ENSMUST00000036176|Arhgap39(420nt) Mouse
[0060] GTTGGAGTGGGTGGAGATTATCGAACCACGCACGCGCGAACGTATGTATGCCAACCTGGTCACCGGAGAGTGCGTGTGGGATCCACCAGCCGGTGTGCGCATCAAGCGCACCAGCGAGGACCAGTGGTGGGAGCTCTTTGACCCCAATACATCACGCTTCTACTACTACAGTGCTGCTTCCCAGCGCACCGTGTGGCATCGCCCACAGAACTGCGACATCATTCCTCTGGCCAAACTGCAGACGCTGAAACAGAACACTGAGTCTCCTCGTGCCTCTGCGGACAACAGCCCAGGGAGGGGCAGCCGTGATGGTAGCACTGGCTCCTCGCTGGAGCCAGAGCTGGAAGAAAGGACACAGGAGCTGCCAGTTCGCAGTGGGCGGGCAACAACCTTGGTCACGTCAAAGGAGGATACTAGCAG。
[0061] Example 3
[0062] Knockdown of circARHGAP39 significantly alleviates the profibrotic effect of renal tubular epithelial cells
[0063] To study the effect of circARHGAP39 on renal tubular epithelial cells, specific siRNAs were designed against the circARHGAP39 circularization site and their knockdown efficiency was detected ( Figure 5 , ***, P<0.001), and it was found that knockdown of circARHGAP39 alleviated the high expression of collagen fibers in renal tubular epithelial cells treated with AGE-BSA in vitro ( Figure 6 ).
[0064] The specific siRNA sequences are as follows:
[0065] The sequence for knocking down human circARHGAP39 is as follows:
[0066] Sense sequence(SEQ ID NO.7):CAGCGGCAGGTTGGAGTGGAA,
[0067] Antisense sequence(SEQ ID NO.8): TTCCACTCCAACCTGCCGCTG;
[0068] The sequence for knocking down mouse circArhgap39 is as follows:
[0069] Sense sequence(SEQ ID NO.9): ATACTAGCAGGTTGGAGTGAA,
[0070] Antisense sequence(SEQ ID NO.10): TTCACTCCAACCTGCTAGTAT.
[0071] To clearly determine in vivo whether inhibiting the expression of circARHGAP39 can improve DKD kidney fibrosis, circARHGAP39 in the kidneys was knocked down in DKD model mice. To knockdown circARHGAP39 in vivo, siRNAs targeting the specific sequence of the circARHGAP39 cyclization site were inserted into an adeno-associated virus (AAV) vector. After obtaining the adeno-associated virus, AAV-sicircARHGAP39 or AAV-siNC (control) was injected via the tail vein 2 weeks after modeling in HFD / STZ model mice. The mice were euthanized 24 weeks after HFD / STZ modeling, and kidney tissue specimens, as well as blood and urine specimens, were collected to evaluate the effect of knocking down circARHGAP39 on kidney injury and kidney fibrosis in DKD mice.
[0072] The results of mouse urinary albumin / creatinine ratio measurement showed that after knocking down circARHGAP39, the kidney injury in STZ / HDF mice was significantly improved and renal function was protected ( Figure 7 , ***, P < 0.001). The results of Masson staining showed that inhibiting circARHGAP39 reduced renal interstitial fibrosis in STZ / HDF mice ( Figure 8 , ***, P < 0.001).
[0073] The changes of profibrotic molecules αSMA, Collagen I, and FN in the renal cortex homogenate of STZ / HDF mice with knocked-down circARHGAP39 were detected by immunoblotting experiments. The results showed that knocking down circARHGAP39 could effectively inhibit the expression of αSMA, Collagen I, and FN proteins ( Figure 9 ). Immunohistochemical results showed that knocking down circARHGAP39 inhibited the expression of αSMA, Collagen I, and FN in the renal interstitium of kidney sections from STZ / HDF mice ( Figure 10, ***, P < 0.001).
[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit them. Although the present invention has been described by referring to the preferred embodiments of the present invention, those of ordinary skill in the art should understand that various changes can be made in form and details without departing from the spirit and scope of the present invention defined by the appended claims.
Claims
1. A marker for treating and / or diagnosing diabetic nephropathy tubulointerstitial injury, characterized in that, The biomarker is circARHGAP39.
2. The biomarker for treating and / or diagnosing diabetic nephropathy tubular injury according to claim 1, wherein The human gene sequence of the circARHGAP39 is shown as SEQ ID NO.1; the murine gene sequence of the circARHGAP39 is shown as SEQ ID NO.
2.
3. Use of a reagent for quantitatively detecting the circARHGAP39 described in claim 1 in the preparation of a diagnostic reagent or an auxiliary diagnostic reagent for diabetic nephropathy tubular injury.
4. The application according to claim 3, wherein The reagent includes primers shown as SEQ ID NO.3 and SEQ ID NO.4 or primers shown as SEQ ID NO.5 and SEQ ID NO.
6.
5. A kit for diagnosing or assisting in the diagnosis of diabetic nephropathy-induced renal tubular injury, characterized in that, It includes the reagent described in claim 3.
6. A therapeutic target for diabetic nephropathy, characterized in that, The treatment target is circARHGAP39.
7. Use of a reagent for knocking down or inhibiting the expression of the circARHGAP39 described in claim 6 in the preparation of a therapeutic or auxiliary therapeutic reagent for diabetic nephropathy tubular injury.
8. The application according to claim 7, wherein The reagent for knocking down or inhibiting the expression of the circARHGAP39 described in claim 6 includes siRNA sequences; the siRNA sequences include: The sequences for knocking down human circARHGAP39 are shown as SEQ ID NO.7 and SEQ ID NO.8; The sequences for knocking down murine circArhgap39 are shown as SEQ ID NO.9 and SEQ ID NO.
10.
9. The application according to claim 7, wherein Knockdown or inhibition of circARHGAP39 expression alleviates the up-regulation of the expression of pro-fibrotic genes in renal tubular epithelial cells induced by AGE-BSA.
10. The application according to claim 7, wherein, Knockdown or inhibition of circARHGAP39 expression alleviates tubular injury and renal fibrosis caused by diabetic nephropathy.