Application of SNP sites of porcine EGF gene in detecting pig fertility
By detecting the SNP sites S7, S8, S9 and S10 of the pig EGF gene, a kit was developed to detect pig fertility, which solved the problem of poor reproductive performance of Duroc pigs and realized an efficient breeding technology system and the screening of high-quality pig breeds.
Patent Information
- Application Number
- CN202510676880.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-26
- Publication Date
- 2025-09-30
- Estimated Expiration
- 2045-05-26
AI Technical Summary
Existing technologies make it difficult to effectively improve the reproductive performance of pig breeds such as Duroc pigs, resulting in defects in their reproductive traits and an imperfect breeding technology system.
The SNP sites S7, S8, S9 and S10 of the porcine EGF gene were used for detection. By designing specific primer pairs and typing primers, a kit was developed to detect pig fertility and screen out high-fertility pig breeds for hybridization combinations.
Significantly improve the reproductive traits of the Duroc pig breed, establish a high-reproductive breeding technology system, screen out high-quality pig hybrid combinations that take into account high reproductive performance, and promote the efficient application of the Duroc pig breed.
Smart Images

Figure CN120249509B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to the application of a SNP site of a porcine EGF gene in detecting pig fertility. Background Art
[0002] Pig reproductive traits are a key factor influencing the production efficiency of modern pig farming and are controlled by a series of major genes or quantitative trait loci. Currently, several major genes have been identified, including the estrogen receptor gene (ESRα), the follicular estrogen β subunit gene (FSHβ), the prolactin gene (PRL), the prolactin receptor gene (PRLR), the epidermal growth factor gene (EGF), the nuclear receptor coactivator protein 1 gene (NCOA1), and the androgen receptor gene (AR). Due to low heritability and late expression of traits, conventional breeding techniques are difficult to improve pig reproductive traits.
[0003] Although existing technologies have reported many candidate genes related to pig reproduction, there are few genes with clear functions, and some genes have different or even contradictory genetic effects in different pig breeds; pig reproductive traits are controlled by multiple genes, and it is difficult to make significant genetic progress through the information of one or a few molecular markers, and there are also few studies on the combined effects of multiple genes.
[0004] The Duroc is a widely used hybrid pig breed in commercial pig production, renowned for its large size, rapid growth, excellent feed-to-weight ratio, and robust meat production. Currently, the Taiwanese and American Duroc breeds dominate my country's pig farming industry. The Taiwanese Duroc boasts a fuller body, a higher lean meat percentage, rapid weight gain, and a superior appearance and conformation. The American Duroc boasts strong reproductive performance, robust limbs and hooves, and a high breeding value. However, compared to the Yorkshire and Landrace pigs, the Duroc has significant reproductive deficiencies, such as low litter size and poor lactation. Summary of the Invention
[0005] The purpose of the present invention is to provide an application of the SNP site of the porcine EGF gene in detecting pig fertility, so as to solve the problems in the prior art of poor reproductive performance, low utilization efficiency and imperfect pig high fertility breeding technology system of pig breeds such as Duroc pigs.
[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0007] The present invention provides an application of SNP sites of the porcine EGF gene in detecting pig fertility for non-disease diagnosis purposes, wherein the SNP sites include one or more of the S7 site, the S8 site, the S9 site and the S10 site;
[0008] The S7 locus is located at position 1615 of the porcine EGF gene, and the allele is A / G;
[0009] The S8 locus is located at position 1715 of the porcine EGF gene, and the allele is A / G;
[0010] The S9 locus is located at position 2257 of the porcine EGF gene, and the allele is A / T;
[0011] The S10 locus is located at position 2383 of the porcine EGF gene, and the allele is A / G;
[0012] The nucleotide sequence of the porcine EGF gene is shown in SEQ ID NO.1.
[0013] Preferably, the genotype of the S7 locus is AA, AG or GG, and the reproductive capacity of pigs with genotype GG is higher than that of pigs with genotype AA or AG;
[0014] The genotype of the S8 locus is AA, AG or GG, and the reproductive capacity of pigs with genotype AA is higher than that of pigs with genotype AG or GG;
[0015] The genotype of the S9 locus is AA, AT or TT, and the reproductive capacity of pigs with genotype AA is higher than that of pigs with genotype AT or TT;
[0016] The genotype of the S10 locus is AA, AG or GG, and the reproductive capacity of pigs with genotype AA or GG is higher than that of pigs with genotype AG.
[0017] Preferably, the S7, S8, and S9 sites constitute the S7-S8-S9 linkage site;
[0018] The genotype of the S7-S8-S9 linkage site is AA-GG-TT, GG-AA-AA or AG-AG-AT, and the reproductive capacity of pigs with the genotype GG-AA-AA is higher than that of the genotype AA-GG-TT or AG-AG-AT.
[0019] The present invention also provides a primer pair for amplifying a nucleic acid molecule containing a SNP site of a porcine EGF gene, comprising an upstream primer and a downstream primer;
[0020] The nucleotide sequence of the upstream primer is shown in SEQ.IDNO.18;
[0021] The nucleotide sequence of the downstream primer is shown in SEQ ID NO.19;
[0022] The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.4;
[0023] The SNP sites include one or more of the S7 site, the S8 site, the S9 site and the S10 site;
[0024] The S7 locus is located at position 1615 of the porcine EGF gene, and the allele is A / G;
[0025] The S8 locus is located at position 1715 of the porcine EGF gene, and the allele is A / G;
[0026] The S9 locus is located at position 2257 of the porcine EGF gene, and the allele is A / T;
[0027] The S10 locus is located at position 2383 of the porcine EGF gene, and the allele is A / G;
[0028] The nucleotide sequence of the porcine EGF gene is shown in SEQ ID NO.1.
[0029] The present invention also provides the use of the primer pair in preparing a product for detecting the SNP site of the pig EGF gene.
[0030] The present invention also provides a kit for detecting SNP sites of the porcine EGF gene, wherein the SNP sites include one or more of the S7 site, the S8 site, the S9 site and the S10 site;
[0031] The S7 locus is located at position 1615 of the porcine EGF gene, and the allele is A / G;
[0032] The S8 locus is located at position 1715 of the porcine EGF gene, and the allele is A / G;
[0033] The S9 locus is located at position 2257 of the porcine EGF gene, and the allele is A / T;
[0034] The S10 locus is located at position 2383 of the porcine EGF gene, and the allele is A / G;
[0035] The nucleotide sequence of the porcine EGF gene is shown in SEQ ID NO.1;
[0036] The kit includes the primer pair.
[0037] The present invention also provides typing primers for identifying SNP sites of the porcine EGF gene, wherein the SNP sites include one or more of the S7 site, the S8 site, the S9 site and the S10 site;
[0038] The S7 locus is located at position 1615 of the porcine EGF gene, and the allele is A / G;
[0039] The S8 locus is located at position 1715 of the porcine EGF gene, and the allele is A / G;
[0040] The S9 locus is located at position 2257 of the porcine EGF gene, and the allele is A / T;
[0041] The S10 locus is located at position 2383 of the porcine EGF gene, and the allele is A / G;
[0042] The nucleotide sequence of the porcine EGF gene is shown in SEQ ID NO.1;
[0043] The nucleotide sequence of the typing primer for the S7 site is shown in SEQ.ID NO.28;
[0044] The nucleotide sequence of the typing primer at the S8 site is shown in SEQ.ID NO.29;
[0045] The nucleotide sequence of the typing primer for the S9 site is shown in SEQ.ID NO.30;
[0046] The nucleotide sequence of the typing primer for the S10 site is shown in SEQ.ID NO.31.
[0047] The present invention also provides the use of the typing primer in preparing a product for identifying the typing of the SNP site of the pig EGF gene.
[0048] The present invention also provides a kit for identifying the typing of SNP sites of the porcine EGF gene, wherein the SNP sites include one or more of the S7 site, the S8 site, the S9 site and the S10 site;
[0049] The S7 locus is located at position 1615 of the porcine EGF gene, and the allele is A / G;
[0050] The S8 locus is located at position 1715 of the porcine EGF gene, and the allele is A / G;
[0051] The S9 locus is located at position 2257 of the porcine EGF gene, and the allele is A / T;
[0052] The S10 locus is located at position 2383 of the porcine EGF gene, and the allele is A / G;
[0053] The nucleotide sequence of the porcine EGF gene is shown in SEQ ID NO.1;
[0054] The kit includes the typing primers.
[0055] The present invention also provides the use of the kit in detecting pig fertility for non-disease diagnosis purposes.
[0056] The present invention also provides the use of the kit in assisted breeding for improving pig fertility.
[0057] The present invention has the following technical effects and advantages:
[0058] The genotypes corresponding to the S7, S8, S9 and S10 sites of the porcine EGF gene can significantly improve the reproductive traits of the Duroc pig breed, and can be used to establish a high-fertility breeding technology system, carry out high-fertility Duroc pig hybrid combination experiments and high-quality breed breeding. It can not only provide ideas for solving the problem of the "introduction-degeneration-re-introduction" vicious circle, but also combine growth performance, meat quality and reproductive performance measurements to screen out high-quality Duroc pig hybrid combinations with high reproductive performance, thereby promoting the efficient application of the Duroc pig breed. BRIEF DESCRIPTION OF THE DRAWINGS
[0059] Figure 1 The genotype determination results of the S1 to S6 sites of the EGF gene. The peaks in the figure represent the S1, S3, S2, S5, S6, and S4 sites from left to right, respectively. The genotype represented by A is AA-GG-AG-CC-GG-CG, the genotype represented by B is AG-AG-AG-CT-AG-CC, the genotype represented by C is AA-GG-GG-CC-GG-CC, and the genotype represented by D is AG-AG-AA-CT-AG-CG.
[0060] Figure 2 The genotype determination results of the S7, S9-S12 sites of the EGF gene. The peaks in the figure represent the S7, S12, S10, and S9 sites from left to right, respectively. The genotype represented by A is GG-TT-AA-AA, the genotype represented by B is AA-TT-GG-TT, and the genotype represented by C is AG-TT-AG-AT.
[0061] Figure 3 The genotype determination results of the EGF gene S8 site are shown, representing the AA, GG, and AG genotypes from left to right.
[0062] Figure 4 The results of linkage disequilibrium analysis of EGF gene S1~S6 loci, where Figure A is the D' value and Figure B is the r 2 value;
[0063] Figure 5 The results of linkage disequilibrium analysis of the EGF gene S7-S9 loci, where Figure A is the D' value and Figure B is the r 2 value. DETAILED DESCRIPTION
[0064] The technical solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0065] Among the test animals of the present invention, 203 local pig breeds (31 Bamei pigs, 76 Shengxian Hua pigs, and 96 Jiaxing black pigs), 322 Duroc pigs, 95 New York pigs, and 78 Landrace pigs were obtained from the Haining Science and Technology Ranch of the Institute of Animal Husbandry and Veterinary Medicine of Zhejiang Academy of Agricultural Sciences. Duroc pigs, New York pigs, and Landrace pigs had complete valid farrowing and weaning data records for 2256 parities, including 1802 parities for Duroc pigs, 296 parities for New York pigs, and 158 parities for Landrace pigs.
[0066] In the reagents of the present invention, Taq DNA polymerase and dNTPs were purchased from MBI Fermentas, Canada.
[0067] Example 1: Sample collection and segment amplification
[0068] (1) Sample collection: Ten pigs were selected from each of the following pig breeds: Bamei pig (BM), Shengxian flower pig (SXHZ), Jiaxing black pig (JXHZ), Duroc pig (D), Yorkshire pig (Y), and Landrace pig (L). Ear samples of each pig breed were collected using ear tongs, and DNA of each pig breed was extracted using the phenol-chloride method published by Sambrook et al. (Sambrook J, Green MR. Molecular Cloning Laboratory Manual [M]. Beijing: Science Press, 1992).
[0069] (2) Primer synthesis: Based on the DNA sequence of the porcine EGF gene (NCBI ID: NC010450.3, as shown in SEQ ID NO. 1), primers for amplifying the R1 to R4 segments of the EGF gene were designed and commissioned to Shanghai Jierui Bioengineering Co., Ltd. for synthesis. The nucleotide sequences of the primers are shown in Table 1.
[0070] Table 1 Primer sequences for amplifying various segments of the EGF gene
[0071]
[0072] SEQ ID NO.1:
[0073]
[0074] (3) PCR amplification: The EGF gene R1 to R4 segments were amplified using the DNA of each pig breed obtained in step (1) as a template. The PCR amplification system was 25 μL, including 1 μL of Taq DNA polymerase (1 U / μL), 1 μL of DNA of each pig breed, 10× buffer (Mg 2+ free)2.5μL、25mmol / L Mg 2+ 2μL, 2.5mmol / L dNTPs 1μL, 1μL of upstream and downstream primers and the balance deionized water; the PCR amplification program was as follows: 94℃ pre-denaturation for 3min, followed by 9 Tm decrease cycles (94℃ denaturation for 30s→65-55℃ annealing for 30s→72℃ extension for 30s), and then 28 amplification cycles (94℃ denaturation for 30s→55℃ annealing for 30s→72℃ extension for 50s / kb), and finally extension at 72℃ for 3min to obtain the various segments of the EGF gene.
[0075] Example 2: Screening and typing of SNP sites
[0076] (1) Screening of SNP sites: The nucleotide sequences of the R1 to R4 segments of the EGF gene of each pig breed obtained in Example 1 were compared with each other, and SNP mutation scanning was performed in pig breeds such as Bamei pig (BM), Shengxian Hua pig (SXHZ), Jiaxing Black pig (JXHZ), Duroc pig (D), Yorkshire pig (Y) and Landrace pig (L). 11 SNP sites were screened and the results are shown in Table 2.
[0077] Table 2 Scanning results of each SNP site of EGF gene
[0078]
[0079] (2) Primer synthesis: Since the SNP sites of the EGF gene are numerous and relatively concentrated, the S1-S4 sites are close, the S5-S6 sites are close, and the S7-S10 sites are close, the primers for amplifying the S1-S4 nucleic acid molecules of the EGF gene and the typing primers for each SNP site were designed based on the DNA sequence of the EGF gene. Among them, the S1 nucleic acid molecule covers the S1-S4 sites, the S5 nucleic acid molecule covers the S5-S6 sites, the S7 nucleic acid molecule covers the S7-S10 sites, and the S11 nucleic acid molecule covers the S11 site. The primers were commissioned to Shanghai Jierui Bioengineering Co., Ltd. for synthesis. The nucleotide sequences of the primers are shown in Tables 3-4. In Table 4, the description format of the sequencing parameters is: sequencing direction + typing primer length + SNP site mutation type.
[0080] Table 3 Primer sequences for amplifying each nucleic acid molecule of the EGF gene
[0081]
[0082] Table 4 Typing primer sequences for each SNP site of EGF gene
[0083]
[0084] The nucleotide sequence of the S1 nucleic acid molecule is shown in SEQ ID NO.2.
[0085] SEQ ID NO.2:
[0086] CATTCTGAGTCTTGCGTCCAGAAAACAATGGAATATTCCGCGTATCTCCCCACATGACTTCTGCTGCCCCTTAGGGTCTGTTTCTCCTATGAGGGGTCAGAGCTGCCTGACAGCCCGACTGAAATCAGAGGAGTCTTGATTTTAGCCATTTCAGAAAAGAGACCCAGTATTTGAGGAATGATG AGGATATAATTCAACATAAGAAAAGGGCTTGCCGTCGTTCCCATTCTCCATAAGGGGTGTCCGCTAGTGTGACTGTTATTTTTGTGACTATCGCTTATCTACATTTGGACTAGCCCTTGGAACACTACCTCCGGGCCACTTAAATGAAAGCTTGTTTTCTAGAATGAAGTAAGCTGGCAGAA
[0087] The nucleotide sequence of the S5 nucleic acid molecule is shown in SEQ ID NO.3.
[0088] SEQ ID NO.3:
[0089] TGTTGACATTTGGTCACATCACAAGCTGAAGGTCAATTTTCTGTAGTATTCCTCGGGCGAATGATCAATGGCTCCAAGTCTGAATTATCAGCAGTGCTATTCACCGTTGATTTATGCAACATGGTTTAACTTTGTCTCCATCCTTCCAGATAGTAAAACATAGCCCGGATTCAGCAGGTACCTCGCAGACACCAGGAGCAACTCCACA
[0090] The nucleotide sequence of the S7 nucleic acid molecule is shown in SEQ ID NO.4.
[0091] SEQ ID NO.4:
[0092]
[0093] The nucleotide sequence of the S11 nucleic acid molecule is shown in SEQ ID NO.5.
[0094] SEQ ID NO.5:
[0095] TCACATCTTCTATTCAACATGGAAAAAGAAGACAATTTGGGTAGCTAACAAGCACACTGGGAAGGATATGGTTAAAATGAACCTCAATCCAGCATTTGTACCACCTGGTGGAATTAAAGTAGTGCATCCACTTGTTCAGCCCAAGGCAGAGGGTGATGCTTGGGCCTCTGATCAGAAACTCTGCAAACTGAGGAAGGGTAACTGCAGAGGCAGCATGTGTGGGCAAGAGCCAAAGTCCCAC
[0096] (3) SNP site typing: Using the DNA of each pig breed described in Example 1 as a template, the primers described in Table 3 were used to amplify each nucleic acid molecule of the EGF gene according to the PCR amplification system and procedure described in Example 1. Then, the typing primers described in Table 4 were used to perform SNP site typing and genotyping on each nucleic acid molecule. The results are shown in FIG. Figures 1-2 shown.
[0097] Example 3: Analysis of S1 to S6 sites of the EGF gene
[0098] (1) Gene frequency analysis: Mutation scanning of the S1-S6 sites of the EGF gene in pig breeds such as Yorkshire pig (Y), Bamei pig (BM), Shengxian flower pig (SXHZ), and Jiaxing black pig (JXHZ) was performed. Hardy-Weinberg equilibrium chi-square test was performed using SAS8.0. 2 Test, haplotype analysis and linkage disequilibrium analysis were performed using Shesis software, and the results were as follows Figure 3 As shown in Tables 5 to 10.
[0099] (2) Analysis of genetic effects: The effective farrowing and weaning data of large Yorkshire pig breeds with an effective total litter size of not less than 4 pigs were selected, and the reproductive traits such as total litter size (TNB), number of live piglets born (NBA), litter weight at birth (BLW), litter weight at weaning (WLW), number of piglets weaned (WN), average weight at weaning (AWW), survival rate during lactation (SRS), and gestation length (GL) were sorted and recorded. A least squares effect model was established for each pig breed for analysis. The UNIVARIATE procedure of SAS8.0 was used to test the normal distribution of GL. The NPARIWAY procedure of SAS8.0 was used to perform non-parametric one-way analysis of variance on GL factors that did not conform to the normal distribution. The GLM procedure of SAS8.0 was used to analyze the factors affecting GL such as birth year, birth season, parity, and pedigree. The results are shown in Tables 11 and 12.
[0100] The least squares effect model for first birth is: ijklm =μ+M i +Y j +S l +e ijkl ;
[0101] Where: Y ijkl is the gestational age (GL), μ is the overall mean, M i is the ancestry effect, Y j = birth year effect + strain effect, S l is the birthing season effect, e ijkl is the residual effect (haplotype effect + residual);
[0102] The least squares effect model of multiparity is: ijklm =μ+M i +Y j +P k +S l +e ijkl ;
[0103] Where: Y ijkl is the gestational age (GL), μ is the overall mean, M i is the ancestry effect, Y j = birth year effect + strain effect, P k is the parity effect, S l is the birthing season effect, e ijkl is the residual effect (haplotype effect + individual effect + residual);
[0104] The delivery season is January, February, November and December as season one, March, April, September and October as season two, and May, June, July and August as season three.
[0105] Table 5 Genotype and allele frequencies of EGF gene S1 locus
[0106]
[0107] Table 6 Genotype and allele frequencies of EGF gene S2 locus
[0108]
[0109] Table 7 Genotype and allele frequencies of EGF gene S3 locus
[0110]
[0111] Table 8 Genotype and allele frequencies of EGF gene S4 locus
[0112]
[0113] Table 9 Genotype and allele frequencies of EGF gene S5 locus
[0114]
[0115] Table 10 Genotype and allele frequencies of EGF gene S6 locus
[0116]
[0117] Table 11 Association analysis between EGF gene S5 locus and reproductive traits of first-parity large Yorkshire pigs
[0118]
[0119] Table 12 Association analysis between EGF gene S5 locus and reproductive traits of large Yorkshire pigs
[0120]
[0121] Gene frequency analysis results showed that only the S5 locus was polymorphic in the Yorkshire pig breed, while the other five SNP loci were not polymorphic. In local pig breeds, all six SNP loci showed abundant polymorphism. The distribution of the six SNP loci in different pig breeds conformed to the Hardy-Weinberg equilibrium law.
[0122] The allele frequencies of S1, S3, and S6 sites were completely consistent, and linkage disequilibrium analysis showed that these three SNP sites were linked (S1-S3-S6 linkage site, D'=1, r 2>0.985), forming H1 (GAA) and H2 (AGG) haplotypes; among them, Yorkshire pig breeds are H1 haplotype; H1H2 diplotype is the most common in Bamei pig breeds (54.8%), and H1 and H2 haplotypes are equally distributed; in Shengxian spotted pig breeds, H2H2 and H1H2 diplotypes each account for half, there is no H1H1 diplotype, and H2 haplotype is the dominant haplotype (77.8%); in Jiaxing black pig breeds, H1H1 diplotype is the most common (76.1%), there is no H2H2 diplotype, and H1 haplotype is the dominant haplotype (88%);
[0123] The results of genetic effect analysis showed that in Yorkshire pigs, different haplotypes or diplotypes of the S5 locus had no significant association with the reproductive traits, and there was no significant difference between the haplotypes or diplotypes.
[0124] In conclusion, the S1-S6 loci of the EGF gene have no practical application significance in improving the reproductive traits of Duroc pigs.
[0125] Example 4: Analysis of S7-S9 sites of the EGF gene
[0126] (1) Gene frequency analysis: The method described in Example 3 was used to perform mutation scanning and gene frequency analysis on the S7 to S9 sites of the EGF gene in pig breeds such as Duroc (D), Yorkshire (Y), Landrace (L), Jiaxing Black (JXHZ), Bamei (BM), and Shengxian Flower (SXHZ). The results are as follows: Figure 4 As shown in Tables 13 to 15.
[0127] (2) Genetic effect analysis: The method described in Example 3 was used to conduct genetic effect analysis on Duroc pigs with an effective total litter size of not less than 4 pigs. The results are shown in Tables 16 and 17.
[0128] Table 13 Genotype and allele frequencies of EGF gene S7 locus
[0129]
[0130] Table 14 Genotype and allele frequencies of EGF gene S8 locus
[0131]
[0132] Table 15 Genotype and allele frequencies of EGF gene S9 locus
[0133]
[0134] Table 16 Association analysis between EGF gene S7-S8-S9 linkage loci and primiparous reproductive traits of Duroc pigs
[0135]
[0136] Table 17 Association analysis between EGF gene S7-S8-S9 linkage loci and reproductive traits of Duroc pig breed
[0137]
[0138] The results of gene frequency analysis showed that the dominant allele of S7 locus was A in Duroc, Yorkshire and Landrace pigs, and G in Shengxian Hua pigs, Bamei pigs and Jiaxing Black pigs. The dominant allele of S8 and S9 loci was G in Duroc, Yorkshire and Landrace pigs, and A in Shengxian Hua pigs, Bamei pigs and Jiaxing Black pigs, and the distribution patterns were exactly the same.
[0139] The genotype frequencies of S7, S8, and S9 loci are completely consistent with the allele frequencies. Linkage disequilibrium analysis shows that these three loci are in a completely linked state (S7-S8-S9 linkage loci, D'=1, r 2 =1), forming H1 (AGT) and H2 (GAA) haplotypes; genotypes are homozygous H1H1 (AA-GG-TT), homozygous H2H2 (GG-AA-AA) and heterozygous H1H2 (AG-AG-AT);
[0140] The results of genetic effect analysis showed that in primiparous Duroc pigs, different haplotypes or genotypes of the S7-S8-S9 linkage locus had no significant association with various reproductive traits, and there were no significant differences between the genotypes. In multiparous Duroc pigs, the S7-S8-S9 linkage locus achieved significant differences in the AWW trait, and the AWW trait of the homozygous H2H2 was 0.64 kg higher than that of the homozygous H1H1 (P<0.05). There were no significant differences in other reproductive traits.
[0141] In conclusion, the H2 haplotype composed of the S7-S8-S9 linkage loci of the EGF gene is a favorable haplotype, which can improve the reproductive traits of the Duroc pig breed.
[0142] Example 5: Analysis of the S10 site of the EGF gene
[0143] (1) Gene frequency analysis: The method described in Example 3 was used to perform mutation scanning and gene frequency analysis on the S10 site of the EGF gene in pig breeds such as Duroc pig (D), Yorkshire pig (Y), Landrace pig (L), Jiaxing black pig (JXHZ), Bamei pig (BM), and Shengxian spotted pig (SXHZ). The results are shown in Table 18.
[0144] (2) Genetic effect analysis: The method described in Example 3 was used to conduct genetic effect analysis on Duroc pigs with an effective total litter size of not less than 4 pigs. The results are shown in Tables 19 and 20.
[0145] Table 18 Genotype and allele frequencies of EGF gene S10 locus
[0146]
[0147] Table 19 Association analysis between EGF gene S10 locus and primiparous reproductive traits of Duroc pigs
[0148]
[0149] Table 20 Association analysis between EGF gene S10 locus and reproductive traits of Duroc pig breed
[0150]
[0151] Gene frequency analysis results showed that the S10 locus has allele A as the dominant allele in Landrace pigs, while allele G is the dominant allele in other pig breeds. Except for the Duroc pig, the distribution of the S10 locus in other pig breeds conforms to the Hardy-Weinberg equilibrium law.
[0152] The results of genetic effect analysis showed that in primiparous Duroc pigs, the S10 locus achieved significant differences in the AWW trait. The AWW trait of the homozygous AA was 1.15 kg higher than that of the heterozygous AG (P < 0.05), and there were no significant differences in other reproductive traits. In multiparous Duroc pigs, the BLW trait of the homozygous GG was 0.88 kg higher than that of the heterozygous AG (P < 0.05), and there were no significant differences in other reproductive traits.
[0153] In conclusion, the S10 locus of the EGF gene can improve the reproductive traits of the Duroc pig breed.
[0154] Example 6: Analysis of the S11 site of the EGF gene
[0155] Gene frequency analysis: The method described in Example 3 was used to perform mutation scanning and gene frequency analysis on the S11 site of the EGF gene in pig breeds such as Bamei pig (BM), Shengxian Hua pig (SXHZ), and Jiaxing black pig (JXHZ). The results are shown in Table 21.
[0156] Table 21 Genotype and allele frequencies of EGF gene S11 locus
[0157]
[0158] The results showed that the S11 locus has only allele C in Jiaxing Black Pig breed; in Bamei Pig and Shengxian Flower Pig breeds, the distribution of allele A and allele C conforms to the Hardy-Weinberg equilibrium law.
[0159] In conclusion, the S11 locus of the EGF gene has no practical application significance for improving the reproductive traits of Duroc pigs.
[0160] As can be seen from the above examples, the present invention provides the application of SNP sites in the porcine EGF gene for detecting pig fertility. The genotypes corresponding to the S7, S8, S9, and S10 sites of the EGF gene can significantly improve the reproductive traits of the Duroc pig breed and can be used to conduct high-fertility Duroc pig hybrid combination experiments and breed high-quality varieties.
[0161] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the spirit of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. Utilize Pigs EGF The application of the SNP site of a gene in detecting the reproductive capacity of multiparous Duroc pigs for non-disease diagnosis purposes is characterized in that: The SNP site is the S10 site; The S10 site is located in the pig EGF At gene position 2383, the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO. 1; The genotype of the S10 locus is AA, AG or GG, and the reproductive capacity of pigs with genotype GG is higher than that of pigs with genotype AG; The fecundity stated is litter weight at birth.
2. A detection pig EGF The use of a kit for detecting the SNP sites of a gene in detecting the reproductive capacity of multiparous Duroc pigs for non-disease diagnosis purposes is characterized in that: Includes upstream primers and downstream primers; The nucleotide sequence of the upstream primer is shown in SEQ.ID NO.18; The nucleotide sequence of the downstream primer is shown in SEQ ID NO.19; The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.4; The SNP site is the S10 site; The S10 site is located in the pig EGF At gene position 2383, the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO. 1; The nucleotide sequence of the typing primer at the S10 site is shown in SEQ.ID NO.31; The genotype of the S10 locus is AA, AG or GG, and the reproductive capacity of pigs with genotype GG is higher than that of pigs with genotype AG; The fecundity stated is litter weight at birth.
3. A detection pig EGF The use of a kit for detecting SNP sites of a gene in assisted breeding to improve the reproductive capacity of multiparous Duroc pigs is characterized in that: Includes upstream primers and downstream primers; The nucleotide sequence of the upstream primer is shown in SEQ.ID NO.18; The nucleotide sequence of the downstream primer is shown in SEQ ID NO.19; The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.4; The SNP site is the S10 site; The S10 site is located in the pig EGF At gene position 2383, the alleles are A / G; The pig EGF The nucleotide sequence of the gene is shown in SEQ ID NO. 1; The nucleotide sequence of the typing primer at the S10 site is shown in SEQ.ID NO.31; The genotype of the S10 locus is AA, AG or GG, and the reproductive capacity of pigs with genotype GG is higher than that of pigs with genotype AG; The fecundity stated is litter weight at birth.