Application of agomelatine in preparation of medicine for treating systemic lupus erythematosus

Abstract

The invention provides an application of agomelatine in preparation of a medicine for treating systemic lupus erythematosus, relates to the technical field of biomedicine, and has the technical key points that the application shows the application of agomelatine in treatment of systemic lupus erythematosus for the first time, specifically, agomelatine is used for intragastric administration of two systemic lupus erythematosus model mice, and the application of agomelatine in treatment of systemic lupus erythematosus in treatment of systemic lupus erythematosus in treatment of systemic lupus erythematosus in treatment of systemic lupus erythematosus is realized. Agomelatine can relieve spleen swelling and reduce spleen indexes, and urine protein is quantified in 24 hours; the degree of kidney damage is reduced, and serum autoantibodies and kidney function indexes are reduced; the symptoms of facial skin injury or abdominal granuloma nodules are improved; the proportion of M1 macrophages, Tfh cells, Th17 cells and plasma cells of the spleen is reduced. Mechanism research shows that the agomelatine reduces release of macrophage inflammatory factors, interferon and interferon stimulating genes, which indicates that the agomelatine improves the condition of systemic lupus erythematosus by reversing the functional disorder of macrophages of systemic lupus erythematosus mice, and provides a new way for treating systemic lupus erythematosus.

Description

Technical Field

[0001] The present invention relates to the technical field of pharmaceutical medicine, and particularly to the application of agomelatine in the preparation of drugs for treating systemic lupus erythematosus. Background Art

[0002] Systemic lupus erythematosus (SLE) is an autoimmune disease that seriously endangers the physical health and quality of life of patients. It mainly affects multiple organs and systems, leading to various clinical manifestations, including kidney damage, skin diseases, and nervous system complications. Data shows that the incidence of nephritis in SLE patients is about 29 - 82%, and the 24-hour urinary protein quantification is one of the important indicators reflecting kidney involvement and disease activity. As an immune organ, splenomegaly is one of the important indicators for evaluating the pathological damage of SLE. Depression and anxiety are common complications in SLE patients. Research reports that the prevalence of depression and anxiety in SLE patients is about 30% and 37% respectively, which further increases the incidence of cardiovascular diseases, reduces the quality of life, and increases the risk of premature death in SLE patients. Therefore, it is crucial to develop a reasonable and targeted treatment plan for lupus patients.

[0003] In recent years, studies have shown that the innate immune response plays an increasingly important role in the pathogenesis of SLE: during the occurrence and development of SLE, there are functional defects in the innate immunity, and it plays a key role in the regulatory stage of the adaptive immune response. Activation of the innate immune system can lead to an increase in the release of type I interferon (IFN-I). Studies have shown that the serum IFN-I level in SLE patients is elevated, which is positively correlated with the SLE disease activity index (SLEDAI) score and the level of anti-double-stranded DNA antibodies. In addition, increased expression of IFN-stimulating genes (ISGs) is observed in various different immune cells in SLE patients. Macrophages are important immune effector cells of the innate immune system, located in multiple organs or tissues, and can respond to different stimuli and polarize into different subtypes. Studies have shown that the M1 type dominates in the macrophages of SLE patients, triggering a series of signal cascades to activate interferon regulatory factor 3 (IRF3) and nuclear factor κB (NF-κB) to produce IFN-I and pro-inflammatory cytokines. IFN-I activates the signal pathway mediated by the type I interferon receptor (IFNAR), leading to the transcription of a large number of ISGs, including various chemokines, and further recruiting various immune cells to amplify the SLE response. Summary of the Invention

[0004] The purpose of the present invention is to solve the problem of the lack of corresponding drugs for SLE in the prior art.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] Use of agomelatine in the preparation of a medicament for treating systemic lupus erythematosus.

[0007] Preferably, the systemic lupus erythematosus is one of MRL / lpr spontaneous lupus and pristane-induced lupus.

[0008] Preferably, the agomelatine is used to reduce splenomegaly, reduce spleen index and 24-hour urinary protein quantification.

[0009] Preferably, the agomelatine is used to reduce the degree of kidney damage, reduce serum autoantibodies and renal function indexes.

[0010] Preferably, the autoantibodies include at least one of anti-double-stranded DNA and anti-nuclear antibody.

[0011] Preferably, the renal function indexes include at least one of creatinine and urea.

[0012] The present application also provides a medicament for treating systemic lupus erythematosus, which contains agomelatine.

[0013] Preferably, the medicament is an oral preparation.

[0014] Preferably, the dosage of the medicament is at least one of 10 mg / kg / d, 25 mg / kg / d, and 50 mg / kg / d.

[0015] Compared with the prior art, the present application has the following beneficial effects:

[0016] In the first aspect of the present invention, it is shown for the first time that agomelatine exhibits certain potential in the treatment of systemic lupus erythematosus. Specifically, agomelatine can reduce splenomegaly in lupus model mice, reduce spleen index and 24-hour urinary protein quantification; reduce the degree of kidney damage, reduce serum autoantibodies and renal function indexes; improve facial skin damage or abdominal granuloma nodule symptoms; reduce the proportions of spleen M1 macrophages, Tfh cells, Th17 cells, and plasma cells, which may play an important role in protecting tissues and organs in systemic lupus erythematosus.

[0017] In the second aspect of the present invention, the role of agomelatine in regulating macrophage function is provided. Agomelatine reduces the release of macrophage inflammatory factors, interferons, and ISGs.

[0018] This shows that agomelatine provides a new option for the treatment of SLE, with the advantages of significant curative effect and small side effects; the safety data of the marketed drug can be utilized to accelerate the clinical transformation process; it provides a new way (or new method) for the treatment of SLE diseases. Description of the Drawings

[0019] Figure 1 It is a result diagram of the effects of agomelatine (AGO) on the measurement and weighing of organs, 24-hour urinary protein quantification, facial skin, mouse serum indexes and kidney pathology in MRL / lpr spontaneous lupus mice. A: Measurement of the size of the spleen of the mouse, B: Spleen index of the mouse, C: Detection of 24-hour urinary protein quantification in the mouse, D: Changes in the facial skin of the mouse, E: Detection of the levels of anti-dsDNA, ANA antibodies, Cr, and BUN in the mouse serum, F: H&E, PAS, and MASSON staining of the mouse kidney.

[0020] Figure 2 It is a result diagram of the effects of AGO on the measurement and weighing of organs, 24-hour urinary protein quantification, peritoneal granuloma nodules, mouse serum indexes and kidney pathology in pristane-induced lupus mice. A: Measurement of the size of the spleen of the mouse, B: Spleen index of the mouse, C: Detection of 24-hour urinary protein quantification in the mouse, D: Peritoneal granuloma nodules of the mouse, E: Detection of the levels of anti-double-stranded DNA antibody (anti-dsDNA), antinuclear antibody (ANA), Creatinine (Cr), and blood urea nitrogen (BUN) in the mouse serum, F: H&E, PAS, and MASSON staining of the mouse kidney.

[0021] Figure 3 It is a result diagram of detecting the effects of AGO on splenic immune cells in lupus model mice by flow cytometry. A: Flow cytometry diagram for detecting the proportion of M1 macrophages (F4 / 80 + CD86 + ) in the spleen of MRL / lpr mice, B: Flow cytometry diagram for detecting the proportion of Th17 cells (CD4 + IL-17 + ) in the spleen of MRL / lpr mice, C: Flow cytometry diagram for detecting the proportion of Tfh cells (PD-1 + CXCR5 + ) in the spleen of MRL / lpr mice, D: Flow cytometry diagram for detecting the proportion of plasma cells (B220 - CD138 + ) in the spleen of MRL / lpr mice, E-H: Column statistical chart for detecting the proportions of M1 macrophages, Th17 cells, Tfh cells, and plasma cells in the spleen of MRL / lpr mice.

[0022] Figure 4AGO significantly reduces the release of macrophage inflammatory factors, IFN genes, and ISGs induced by LPS and VSV. A-B AGO was pre-treated with immortalized bone marrow-derived macrophages (iBMDM) cells for 2 h, and the expression levels of IFNβ and IL-6 mRNA were detected after 3 h of LPS infection; C-D AGO was pre-treated with iBMDM cells for 2 h, and the expression levels of IFNβ and IL-6 mRNA were detected after 6 h of VSV infection; E-J AGO was pre-treated with peritoneal exudate macrophage (PEM) cells for 2 h, and the expression levels of IFNβ, Ccl5, Cxcl10, IL-6, TNF-α, and IL-1β mRNA were detected after 3 h of LPS infection; K-P AGO was pre-treated with PEM cells for 2 h, and the expression levels of IFNβ, Ccl5, Cxcl10, IL-6, TNF-α, and IL-1β mRNA were detected after 6 h of VSV infection.

[0023] Figure 5 AGO significantly reduces the release of macrophage inflammatory factors, IFN, and ISGs induced by ISD and QVD-OPh + ABT-737. A-G AGO was pre-treated with PEM cells for 2 h, and the expression levels of IFNβ, Cxcl10, Mx1, Mx2, IRF7, IFNA4, and IL-6 mRNA were detected after 6 h of ISD infection; H AGO was pre-treated with PEM cells for 2 h, and the representative flow cytometry plot of F4 / 80+CD86+ macrophages was detected by flow cytometry after 6 h of ISD infection; I-M PEM cells treated with DMSO or AGO were induced with QVD-OPh (50 μm) and ABT-737 (5 μm) for 24 h to detect the expression levels of IFN-β, CXCL10, Mx1, IRF7, and Mx2 mRNA; N-O iBMDM cells treated with DMSO or AGO were induced with QVD-OPh and ABT-737 for 24 h to detect the expression levels of IFN-β and CXCL10 mRNA. Specific embodiments

[0024] The present invention will be further described in detail below in conjunction with specific embodiments.

[0025] Use of agomelatine in the preparation of a medicament for treating systemic lupus erythematosus, wherein the systemic lupus erythematosus is one of MRL / lpr spontaneous lupus and pristane-induced lupus.

[0026] In one embodiment, the agomelatine is used to reduce splenomegaly, spleen index, and 24-hour urinary protein quantification.

[0027] In one embodiment, the agomelatine is used to reduce the degree of kidney damage, lower serum autoantibodies and renal function indexes; and improve facial skin damage or abdominal cavity granuloma nodule symptoms.

[0028] In one embodiment, the autoantibodies include at least one of anti-dsDNA and ANA antibodies.

[0029] The renal function indexes include at least one of Cr and BUN.

[0030] The agomelatine is also used to reduce the proportions of splenic M1 macrophages (F4 / 80 + CD86 + )、Tfh cells (PD-1 + CXCR5 + ), Th17 cells (CD4 + IL-17 + ), and plasma cells (B220 - CD138 + ).

[0031] The present application also provides a drug for treating systemic lupus erythematosus, which contains agomelatine. In one embodiment, the drug is an oral preparation, and the administration dose of the drug is at least one of 10 mg / kg / d, 25 mg / kg / d, and 50 mg / kg / d.

[0032] The above content will be elaborated below in conjunction with specific examples:

[0033] I. Materials and Reagents

[0034] A864665 ABT-737, ≥97% (Macklin),

[0035] QVD-OPh (Selleck chem),

[0036] AGO (Aladdin),

[0037] ISD (Forward: tacagatctactagtgatctatgactgatctgtacatgatctaca,

[0038] Reverse: tgtagatcatgtacagatcagtcatagatcactagtagatctgta)

[0039] II. Experimental Methods

[0040] 2.1 Mouse Model Construction

[0041] Purchase 8-week-old female MRL / lpr spontaneous lupus model mice and 8-week-old female MRL / MPJ healthy control mice; purchase 6-week-old female BALB / c mice, randomly divide them into two groups. At 8 weeks, the model group was intraperitoneally injected with 0.5 mL of pristane once, and the control group was intraperitoneally injected with 0.5 mL of NaCl once. After 6 months, the pristane successfully induced an SLE animal model.

[0042] Randomly divide the animals into a healthy control group, an AGO administration group of 10 mg / kg, an AGO administration group of 25 mg / kg, an AGO administration group of 50 mg / kg, and a model mouse + NaCl negative control group. AGO was administered by gavage every day for 6 weeks.

[0043] 2.2 Urinary protein determination

[0044] Collect 24-hour urine from mice using a metabolic cage, and collect the urine of mice again after 6 weeks of AGO gavage. Take the BSA standard provided by the kit and dilute it stepwise with PBS buffer. Take 20 μL of urine sample, mix it with 1×G250 staining solution, and incubate it in the dark at room temperature for 3 - 5 min; measure the absorbance at 595 nm using an enzyme-linked immunosorbent assay (ELISA) reader.

[0045] 2.3 Enzyme-linked immunosorbent assay

[0046] In this application, mouse anti-dsDNA ELISA kit, mouse ANA enzyme-linked immunosorbent assay kit, mouse BUN enzyme-linked immunosorbent assay kit, and mouse Cr ELISA research kit (purchased from Jiangsu Jingmei) were used to analyze the levels of anti-dsDNA, ANA, BUN, and Cr in the sera of MRL / lpr mice and pristane-induced lupus mice according to the standard procedure, and the absorbance at 450 nm was measured using an ELISA reader.

[0047] 2.4 H&E, MASSON, and PAS staining

[0048] Place the kidneys in 4% paraformaldehyde, then embed and section them, and evaluate the histological morphological characteristics of kidney tissues by staining with hematoxylin and eosin staining solution; evaluate the amount of collagen fiber deposition by staining with iron hematoxylin nuclear stain, ponceau-acid fuchsin mixed solution, phosphomolybdic acid differentiation, and aniline blue counterstain, making the collagen fibers blue and the muscle fibers red; show the glycogen distribution by periodic acid-Schiff reaction.

[0049] 2.5 Flow cytometry

[0050] Prepare the cells into a single-cell suspension. After lysing and washing the red blood cells, treat them with an FcR blocker at room temperature for 15 min.

[0051] In one embodiment, in order to detect macrophages, the cells were incubated with Fixable Viability Dyee FluorTM Incubate with 455UV, F4 / 80 - PERCP, and CD86 - FITC antibodies in the dark for 30 min.

[0052] In one embodiment, to detect Tfh and Th17 cells, the cells were incubated with Fixable Viability Dyee Fluor TM 455UV, CD3 - APC - CY7, CD4 - FITC, CXCR5 - PE - cy7, and PD - 1 - APC antibodies in the dark for 30 min. After fixation and permeabilization, the cells were incubated with IL - 17A - BV421 antibody in the dark.

[0053] In one embodiment, to detect plasma cells, the cells were incubated with Fixable Viability Dyee Fluor TM 455UV, TCRβ - Percp - cy5.5, B220 - APC, and CD138 - BV605 antibodies in the dark for 30 min.

[0054] After washing, the cell suspension was resuspended in 200 μL of buffer for subsequent detection by flow cytometry (BD Biosciences, USA).

[0055] 2.6 Cell culture

[0056] The cells used in this application were iBMDM and PEM. BALB / c mice were intraperitoneally injected with 3% thioglycolate aqueous solution (3 mL) for 4 days. The mice were sacrificed by cervical dislocation and then immersed in 75% ethanol for 2 min to extract PEM. Both iBMDM and PEM were cultured in DMEM complete medium (10% FBS, 2 mM L - Glutamine, 100 U / ml penicillin - streptomycin) at 37°C and 5% CO2. Macrophages were seeded at a density of 1×10^5 cells / mL in 24 - well plates.

[0057] 2.7 RNA extraction, reverse transcription, and real - time quantitative PCR

[0058] Collect the cells, wash them once with PBS, add 500 μL of Lysis Buffer to lyse the cells thoroughly, add an equal volume of absolute ethanol to the lysed cells, mix well, transfer to a centrifugal column, and centrifuge at 4000 g for 1 minute at 4 °C. Add 500 μL of Wash Buffer to the RNA column, centrifuge at 12000 g for 1 minute, place the column on a clean RNase-free 1.5 mL centrifuge tube, open the lid and air-dry for 2 minutes. Add 20 - 50 μL of Elution Buffer to the center of the membrane of the RNA column, let it stand at room temperature for 2 minutes, and then centrifuge at 12000 g for 1 minute to obtain RNA. Measure the RNA concentration with Nanodrop. Store the RNA at -80 °C.

[0059] Reverse transcription: First, mix 1 μg of RNA and 4 μL of 4×gDNA wiper Mix, and adjust to 16 μL with DEPC water. Incubate at 42 °C for 2 min, then add 4 μL of 5×HiScript III qRT SuperMix, incubate at 37 °C for 15 min, and at 85 °C for 5 sec to obtain the cDNA template for the qPCR reaction.

[0060] The qPCR reaction system is 10 μL: 3.2 μL of deionized water, 5 μL of SYBR-Green MasterMix, 1 μL of diluted cDNA template, and 0.8 μL of forward and reverse primers. The reaction program is: 95 °C for 30 sec; 95 °C for 10 sec, 60 °C for 30 sec, read the fluorescence value, for a total of 40 cycles; 95 °C for 15 sec; 60 °C for 60 sec; 95 °C for 15 sec for melting, read the fluorescence value.

[0061] The RT-qPCR primer sequences are as follows:

[0062]

[0063] 2.8 Statistical methods

[0064] Use Graphpad Prism software to perform statistical analysis on the data. The data are expressed as mean ± standard deviation. One-way ANOVA is used for comparison among multiple groups, and P < 0.05 indicates statistically significant differences.

[0065] II. Experimental results

[0066] 1. AGO treatment alleviates MRL / lpr spontaneous lupus model mice

[0067] To evaluate the therapeutic effect of AGO on MRL / lpr spontaneous lupus model mice, AGO was administered to mice by gavage at a fixed time every day at doses of 10 mg / kg, 25 mg / kg, and 50 mg / kg for 6 consecutive weeks. The control group was given an equal volume of normal saline. Before and after administration, 24-hour urine of mice was collected using a metabolic cage. Whole blood was collected from the orbital vein into an EDTA anticoagulation tube, and the upper-layer serum was separated. An ELISA kit was used to detect autoantibodies and biochemical indicators. At the end of the experiment, the mice were sacrificed, and the spleen and kidneys were isolated. The spleen index was calculated, and lesions such as glomerular inflammation and mesangial hyperplasia were evaluated.

[0068] Please refer to Figure 1 , the experimental results showed that: compared with the model mice + Nacl negative control group, the AGO 10 mg / kg administration group, the AGO 25 mg / kg administration group, and the AGO 50 mg / kg administration group all significantly alleviated splenomegaly ( Figure 1 A), reduced the spleen index ( Figure 1 B), significantly decreased the 24-hour urinary protein quantification ( Figure 1 C), improved facial skin lesions ( Figure 1 D).

[0069] ELISA results indicated that the levels of anti-dsDNA, ANA, BUN, and Cr in the serum of the AGO treatment group were significantly decreased ( Figure 1 E). The results of kidney H&E, PAS, and MASSON staining showed that the AGO treatment group had reduced glomerular swelling and renal interstitial immune cell infiltration ( Figure 1 F).

[0070] 2. AGO treatment alleviates pristane-induced lupus model mice

[0071] To explore the regulatory effect of AGO on lupus pathogenesis, the present invention also studied the effect of AGO on the condition of another lupus model mouse - pristane-induced lupus mice.

[0072] Please refer to Figure 2 , the experimental results showed that: compared with the mice treated with the control agent, the pristane-induced lupus mice treated with AGO had significantly reduced splenomegaly ( Figure 2 A), significantly decreased spleen weight ( Figure 2 B), decreased 24-hour urinary protein quantification ( Figure 2 C), reduced peritoneal granulomatous nodules ( Figure 2 D), and the contents of anti-dsDNA, ANA, BUN, and Cr in the serum were also significantly decreased ( Figure 2 E). Kidney H&E, PAS, and MASSON staining showed that AGO treatment could significantly alleviate renal injury in pristane-induced lupus mice ( Figure 2 F).

[0073] 3. AGO reduces the accumulation of M1 inflammatory macrophages in MRL / Ipr lupus model mice and balances the dysfunction of T and B cells in lupus mice

[0074] In order to explore the regulatory effect of AGO on the activation and differentiation of immune cells in lupus mice, the proportions of immune cells in the spleens of lupus mice were detected by flow cytometry.

[0075] Please refer to Figure 3 , the experimental results showed that: compared with the MRL / lpr model mouse group treated with Nacl negative control agent, the proportions of F4 / 80 + CD86 + macrophages in the spleens of the three AGO administration groups of mice were significantly reduced ( Figure 3 A and 3E); the proportions of CD4 + IL-17 + Th17 cells ( Figure 3 B and 3F), PD1 + CXCR5 + Tfh cells in the spleens of the three AGO administration groups of mice were significantly reduced ( Figure 3 C and 3G); the proportions of B220 - CD138 + plasma cells in the spleens of the AGO 10mg / kg and AGO 25mg / kg administration groups of mice were significantly reduced ( Figure 3 D and 3H). This indicates that after treatment with AGO, the accumulation of M1 inflammatory macrophages in lupus model mice is reduced, and the disorders of T and B immune cells tend to be balanced.

[0076] 4. AGO effectively inhibits macrophage inflammation and interferon response induced by LPS and VSV

[0077] To detect the effects of AGO on the expression of inflammatory factors, IFN and ISGs, iBMDM and PEM cells were used, and macrophages were treated with different concentrations of 0.1um, 1um, 10um AGO for 2 hours. After infecting the cells with LPS and VSV for 3h and 6 hours, the cells were collected for RT-qPCR to detect the expression of inflammatory factors, IFN genes and ISGs.

[0078] Please refer to Figure 4 , the experimental results showed that: in iBMDM stimulated by LPS and VSV, AGO significantly reduced the expression levels of the inflammatory cytokine IL-6 and the interferon gene IFNβ, and showed a dose-dependent manner. The greater the dose, the more obvious the inhibitory effect ( Figure 4(A-D) to determine that the optimal stimulation time for LPS is 3 h, the optimal stimulation time for VSV is 6 h, and the optimal stimulation concentration for AGO is 10 μM. In PEM, it was found that at the optimal stimulation time of LPS and VSV and the optimal stimulation concentration of AGO, the interferon gene (IFNβ) could be significantly reduced ( Figure 4 E and 4K), inflammatory cytokines (IL-1β, IL-6, TNF-α) ( Figure 4 H, 4I, 4J, 4N, 4O and 4P), and ISGs (Cxcl10, Ccl5) ( Figure 4 F, 4G, 4L and 4M) expression levels.

[0079] 5. AGO effectively inhibits macrophage inflammation and interferon response induced by ISD, QVD-OPh + ABT737

[0080] ISD is a synthetic mimic of dsDNA. Macrophages were treated with different concentrations of 0.1 μM, 1 μM, and 10 μM AGO for 2 hours, infected with ISD for 3 h and 6 h, and then the cells were collected for RT-qPCR to detect the expression of inflammatory factors, IFN genes, and ISGs. The proportion of M1 inflammatory macrophages was detected by flow cytometry. It has been reported that mitochondrial DNA (mtDNA) in the cytoplasmic matrix or extracellular environment can drive the production of IFN-I to promote the development of lupus. Therefore, in this invention, macrophages were treated with the BCL-Xl and BCL-2 inhibitor ABT-737 and the pan-caspase inhibitor QVD-OPh to release mtDNA into the cytoplasm, and then the cells were treated with DMSO or AGO for 24 h. The cells were collected and the expression levels of macrophage inflammatory factors, IFN genes, and ISGs were detected by RT-qPCR.

[0081] Please refer to Figure 5 , the experimental results showed that: in PEM stimulated with ISD, AGO significantly reduced the transcription level of IFNβ and showed a dose-dependent manner. The greater the dose, the more obvious the inhibitory effect ( Figure 5 A). To determine that the optimal stimulation time for ISD is 6 h and the optimal stimulation concentration for AGO is 10 μM. In PEM, it was found that at the optimal stimulation time of ISD and the optimal stimulation concentration of AGO, the mRNA levels of IL-6, IFNA4, Cxcl10, Mx1, Mx2, and IRF7 could be significantly reduced ( Figure 5 B-G). Flow cytometry results indicated that AGO could significantly reduce the proportion of M1 macrophages (F4 / 80 + CD86 + ) induced by ISD ( Figure 5H). Similar results were observed in QVD-OPh. AGO was able to significantly reduce the transcriptional levels of IFNβ, Cxcl10, Mx1, Mx2, and IRF7 induced by QVD-OPh in PEM cells ( Figure 5 I-M), and significantly reduce the transcriptional levels of IFNβ and Cxcl10 induced by QVD-OPh in iBMDM cells ( Figure 5 N-O).

[0082] In summary, the present invention discovers that on the one hand, AGO shows certain therapeutic potential for MRL / lpr spontaneous lupus model mice and pristane-induced lupus model mice, reduces the accumulation of M1 inflammatory macrophages, balances the dysfunction of T and B cells in lupus mice, and thus alleviates the occurrence of lupus; on the other hand, AGO inhibits the release of macrophage inflammatory factors, IFN, and ISGs.

Claims

1. Use of agomelatine in the preparation of a drug for treating systemic lupus erythematosus.

2. Use of agomelatine according to claim 1 in the preparation of a medicament for treating systemic lupus erythematosus, characterized in that: The systemic lupus erythematosus is one of MRL / lpr spontaneous lupus and pristane-induced lupus.

3. Use of agomelatine according to claim 2 in the preparation of a medicament for treating systemic lupus erythematosus, characterized in that: The agomelatine is used to reduce splenomegaly, and decrease the spleen index and 24-hour urinary protein quantification.

4. Use of agomelatine according to claim 3 in the preparation of a medicament for treating systemic lupus erythematosus, characterized in that: The agomelatine is used to reduce the degree of renal damage, and lower serum autoantibodies and renal function indexes.

5. Use of agomelatine according to claim 4 in the preparation of a medicament for treating systemic lupus erythematosus, characterized in that: The autoantibodies include at least one of anti-double-stranded DNA and antinuclear antibody.

6. Use of agomelatine according to claim 5 in the preparation of a medicament for treating systemic lupus erythematosus, characterized in that: The renal function indexes include at least one of creatinine and urea.

7. A drug for treating systemic lupus erythematosus, characterized in that: The drug contains agomelatine.

8. A drug for treating systemic lupus erythematosus according to claim 7, characterized in that: The drug is an oral preparation.

9. A drug for treating systemic lupus erythematosus according to claim 8, characterized in that: The administration dose of the drug is at least one of 10 mg / kg / d, 25 mg / kg / d, and 50 mg / kg / d.

Images