Preparation method and application of nucleic acid nano bactericide for preventing and treating tobacco target leaf spot

Abstract

The invention relates to a preparation method and application of a nucleic acid nano bactericide for preventing and treating tobacco target leaf spot, and belongs to the technical field of biopesticides. The nucleotide sequence of the dsRNA is as shown in SEQ ID NO. 1. The dsRNA provided by the invention is used for preventing and treating the tobacco target leaf spot by silencing the expression of an RsGH1 gene in rhizoctonia solani AG3-TB, the dsRNA has timeliness, and the inhibition rate on scabs after 72 hours is 51.5%. The invention further provides a nucleic acid nano-bactericide for preventing and treating the tobacco target leaf spot, the nucleic acid nano-bactericide contains dsRNA and epsilon-PL-CMCS nano-particles, and the dsRNA and the epsilon-PL-CMCS nano-particles can be used for preventing and treating the tobacco target leaf spot. The epsilon-PL-coated CMCS nanoparticles can improve the stability, contact angle and adhesion of dsRNA, the silencing efficiency on RsGH1 in 72 hours is 52.1%, and the inhibition rate on the scabs of tobacco target leaf spot reaches 63.4%.

Description

Technical Field

[0001] The present invention relates to the technical field of biological pesticides, and particularly relates to a preparation method and application of a nucleic acid nano-bactericide for controlling tobacco target spot disease. Background Art

[0002] Tobacco target spot disease is a disease that occurs in tobacco and is caused by Rhizoctonia solani AG3-TB. It can occur from the tobacco seedbed to the stage when the tobacco leaves begin to mature in the field. When the disease starts, it is small and round water-soaked lesions, with a diameter of about 2-3 mm. The lesions formed on the young leaves of diseased seedlings show a reticulate pattern when viewed against the light; rotting and ulcers are formed on the young stems. This disease spreads rapidly, has frequent reinfections, and is highly harmful. The lesions often merge into patches, and in severe cases, the economic value is lost. In recent years, it has received extensive attention due to its serious harm to tobacco growth and yield.

[0003] At present, there are relatively few reports on the control technology related to tobacco target spot disease, which are mainly divided into agricultural control and chemical methods. Among them, the efficiency of agricultural control is relatively low, and the efficiency of chemical control is high. However, the long-term use of chemical pesticides will cause a series of negative problems such as environmental pollution and induction of plant drug resistance. Therefore, it is particularly important to explore green and sustainable prevention and control strategies. Summary of the Invention

[0004] The purpose of the present invention is to provide a preparation method and application of a nucleic acid nano-bactericide for controlling tobacco target spot disease, so as to solve the problems that the long-term use of chemical pesticides for controlling tobacco target spot disease in the prior art will cause environmental pollution and induction of plant drug resistance.

[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] The present invention provides a dsRNA for controlling tobacco target spot disease, and the nucleotide sequence of the dsRNA is as shown in SEQ ID NO.1.

[0007] Preferably, the dsRNA controls tobacco target spot disease by silencing the expression of the RsGH1 gene in Rhizoctonia solani AG3-TB.

[0008] The present invention provides a primer pair for synthesizing the dsRNA, and the primer pair includes primer pair 1 and primer pair 2;

[0009] The primer pair 1 includes an upstream primer RsGH1-T7-F and a downstream primer RsGH1-R;

[0010] The nucleotide sequence of the upstream primer RsGH1-T7-F is as shown in SEQ ID NO.2;

[0011] The nucleotide sequence of the downstream primer RsGH1-R is shown in SEQ ID NO.3;

[0012] The primer pair 2 includes an upstream primer RsGH1-F and a downstream primer RsGH1-T7-R;

[0013] The nucleotide sequence of the upstream primer RsGH1-F is shown in SEQ ID NO.4;

[0014] The nucleotide sequence of the downstream primer RsGH1-T7-R is shown in SEQ ID NO.5.

[0015] The present invention provides a method for synthesizing the dsRNA, comprising the following steps:

[0016] (1) Extract the RNA of Rhizoctonia solani AG3-TB and reverse transcribe to obtain cDNA;

[0017] (2) Using the cDNA as a template, perform PCR amplification with primer pair 1 and primer pair 2 respectively to obtain DNA template 1 and DNA template 2;

[0018] (3) Co-perform in vitro transcription on DNA template 1 and DNA template 2, and then perform nuclease treatment to obtain dsRNA;

[0019] The primer pair 1 and primer pair 2 in step (2) are the primer pair 1 and primer pair 2 in the described primer pairs;

[0020] The system for PCR amplification using primer pair 1 is 0.5 - 1.5 μL of cDNA, 11.5 - 13.5 μL of 2×TaqMasterMix, 0.5 - 1.5 μL of RsGH1-T7-F, 0.5 - 1.5 μL of RsGH1-R, and 8.5 - 10.5 μL of ddH2O;

[0021] The system for PCR amplification using primer pair 2 is 0.5 - 1.5 μL of cDNA, 11.5 - 13.5 μL of 2×TaqMasterMix, 0.5 - 1.5 μL of RsGH1-F, 0.5 - 1.5 μL of RsGH1-T7-R, and 8.5 - 10.5 μL of ddH2O;

[0022] The PCR amplification procedures using primer pair 1 and primer pair 2 are independently: pre-denaturation at 95°C for 2.5 - 3.5 min; denaturation at 94°C for 10 - 20 s, annealing at 55°C for 10 - 20 s, extension at 72°C for 35 - 45 s, 35 cycles; extension at 72°C for 4.5 - 5.5 min, cooling at 4°C for 1.5 - 2 min.

[0023] Preferably, the in vitro transcription system in step (3) is 1.5 - 2.5 μL of 10×Transcription Buffer, 1.5 - 2.5 μL of ATP Solution, 1.5 - 2.5 μL of GTP Solution, 1.5 - 2.5 μL of CTP Solution, 1.5 - 2.5 μL of UTP Solution, 0.2 - 0.8 μL of RNase Inhibitor, 1.5 - 2.5 μL of T7 RNA Polymerase, 1.5 - 2.5 μL of DNA template 1, 1.5 - 2.5 μL of DNA template 2, and 3 - 4 μL of RNase free dH2O.

[0024] The present invention provides the application of the dsRNA synthesized by the described synthesis method in the preparation of products for preventing and treating tobacco target spot disease.

[0025] The present invention provides a preparation method of a nucleic acid nano - fungicide for preventing and treating tobacco target spot disease, comprising the following steps:

[0026] (1) Mix the carboxymethyl chitosan solution and the ε - polylysine solution to obtain a mixed solution, and incubate for 25 - 35 min to obtain an aqueous solution of nanoparticles;

[0027] (2) Mix the dsRNA with the aqueous solution of nanoparticles to obtain a nucleic acid nano - fungicide;

[0028] The dsRNA in step (2) is the described dsRNA;

[0029] In the mixed solution in step (1), the mass ratio of carboxymethyl chitosan to ε - polylysine is 1 - 2:1 - 2;

[0030] When the dsRNA is mixed with the aqueous solution of nanoparticles in step (2), the mass ratio of dsRNA to nanoparticles is 1 - 2:1 - 2.

[0031] The present invention provides a nucleic acid nano - fungicide for preventing and treating tobacco target spot disease prepared by the described preparation method.

[0032] The present invention has the following technical effects and advantages:

[0033] The present invention provides a dsRNA for preventing and treating tobacco target spot disease, which targets the gene RsGH1 closely related to degrading plant cell walls in Rhizoctonia solani AG3 - TB. It has an inhibitory effect on the lesions of tobacco target spot disease, but it has timeliness. The inhibition rate of the lesions is 51.5% after 72 h.

[0034] The present invention also provides a nucleic acid nano - bactericide for preventing and controlling tobacco target spot disease, which contains dsRNA targeting the RsGH1 gene closely related to degrading plant cell walls in Rhizoctonia solani AG3 - TB and ε - PL@CMCS nanoparticles. After the dsRNA and the nanoparticles are loaded at a mass ratio of 1:1, it can improve the stability of dsRNA, and can also improve the contact angle and adhesiveness of dsRNA, and has a more significant effect in inhibiting the expression of the target gene and inhibiting the spread of tobacco target spot disease lesions. 72 hours after inoculation with Rhizoctonia solani AG3 - TB, the silencing efficiency of RsGH1 is 52.1%, and the inhibition rate of tobacco target spot disease reaches 63.4%. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a diagram and analysis diagram of the necrotic lesion diameter of Nicotiana benthamiana leaves 48 hours after being infected with Rhizoctonia solani AG3 - TB under different treatment conditions;

[0036] Figure 2 It is the fungal biomass and the expression level of RsGH1 gene in TRV - GFP plants and TRV - RsGH1 plants;

[0037] Figure 3 It is the sub - cellular localization and over - expression result diagram of the RsGH1 gene;

[0038] Figure 4 It is the result diagram of leaf necrotic lesions, fungal biomass and RsGH1 gene expression levels 48 hours and 72 hours after spraying dsGFP and dsRsGH1 on common tobacco K326;

[0039] Figure 5 It is the detection result diagram of Z - average, PDI and potential of ε - PL@CMCS nanoparticles with different mass ratios of ε - PL to CMCS;

[0040] Figure 6 It is the observation result diagram of the ε - PL@CMCS nanoparticle solution with a mass ratio of ε - PL to CMCS of 1:1;

[0041] Figure 7 It is the result diagram of Z - average, zeta potential and PDI of samples of the ε - PL@CMCS nanoparticle solution with a mass ratio of ε - PL to CMCS of 1:1 under different temperature storage conditions;

[0042] Figure 8 It is the gel electrophoresis diagram of dsRsGH1 and ε - PL@CMCS nanoparticles mixed at different mass ratios;

[0043] Figure 9TEM and EDS images of ε-PL@CMCS nanoparticles and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles;

[0044] Figure 10 Results of RNase A treatment of dsRsGH1 and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles for 0.5 h and 1 h;

[0045] Figure 11 Results of contact angle measurements of dsRsGH1 and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles on glass slides and tobacco leaves;

[0046] Figure 12 Results of adhesion measurements of H2O, dsRsGH1 and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles;

[0047] Figure 13 Results of lesion sizes and statistical analysis of tobacco leaves treated differently;

[0048] Figure 14 Results of RsGH1 transcription levels and fungal biomass in tobacco leaves treated differently. Detailed implementation mode

[0049] The present invention provides a dsRNA for controlling tobacco target spot disease, and the nucleotide sequence of the dsRNA is shown in SEQ ID NO.1;

[0050] The nucleotide sequence of SEQ ID NO.1 is: ACTCAACTCGGTCCTTATCCGCCAGGGCGTCGAGGAGTGGTTTTGAGTCTTCGTCCTTGACCGCAAACCCATTCTCCGTGATGTAGATTGGAAGTTTGTACTTCTTCCAAATGTAGTTGAGGAGTGCACGGAAGCCATCTGGGTAAGTCTGAAGCCAGGCACAGTGAGCCTGGCACCCGAGCTCGGTACCGTCGGGGCGCTTGAAGGTGTAATCGACATTTCCTTGGAACTCGTCAGAACCGCCGGCCTTGCAAAGGTTGGTGGTGTAAGTGTTCATGCCGTAGAAGTCACCCGAGCCCTTGACGACCTTGAGCTCCTCTGGGGTGAAGGTGGGCAGCCTGTCACCGAGAACTTCCTTCATGTATGCGGGGTAGTGGCCAAGGTAAACAGGGTCGGCGAACCAACCGATGGCAAAATCGAGTGCATGTTGAGCCGCGGCAATGTTCTCAGGAGTATTGTCGTAAGGCATAGCCCAGTCACCATTCAGGGTGATACCAATCTGCCCCTTTTGGGCAGACTTGAACTGCTCGCGGTACAGCTTGACCGCATACGCATGGGCAAGGATTACACT。

[0051] In the present invention, the dsRNA controls tobacco target spot disease by silencing the expression of the RsGH1 gene in Rhizoctonia solani AG3-TB.

[0052] The present invention provides primer pairs for synthesizing the dsRNA described above. The primer pairs include primer pair 1 and primer pair 2;

[0053] The primer pair 1 includes the upstream primer RsGH1-T7-F and the downstream primer RsGH1-R;

[0054] The nucleotide sequence of the upstream primer RsGH1-T7-F is as shown in SEQ ID NO.2;

[0055] The nucleotide sequence of SEQ ID NO.2 is: TAATACGACTCACTATAGGGACTCAACTCGGTCCTTATC;

[0056] The nucleotide sequence of the downstream primer RsGH1-R is shown in SEQ ID NO.3;

[0057] The nucleotide sequence of SEQ ID NO.3 is: AGTGTAATCCTTGCCCATGC;

[0058] The primer pair 2 includes the upstream primer RsGH1-F and the downstream primer RsGH1-T7-R;

[0059] The nucleotide sequence of the upstream primer RsGH1-F is shown in SEQ ID NO.4;

[0060] The nucleotide sequence of SEQ ID NO.4 is: ACTCAACTCGGTCCTTAT;

[0061] The nucleotide sequence of the downstream primer RsGH1-T7-R is shown in SEQ ID NO.5;

[0062] The nucleotide sequence of SEQ ID NO.5 is: TAATACGACTCACTATAGGGAGTGTAATCCTTGCCCATGC.

[0063] The present invention provides a method for synthesizing the dsRNA, comprising the following steps:

[0064] (1) Extract the RNA of Rhizoctonia solani AG3-TB and reverse transcribe to obtain cDNA;

[0065] (2) Using the cDNA as a template, perform PCR amplification with primer pair 1 and primer pair 2 respectively to obtain DNA template 1 and DNA template 2;

[0066] (3) Co-perform in vitro transcription on DNA template 1 and DNA template 2, and then perform nuclease treatment to obtain dsRNA;

[0067] The primer pair 1 and primer pair 2 in step (2) are the primer pair 1 and primer pair 2 in the primer pairs described above;

[0068] The system for PCR amplification using primer pair 1 is 0.5 - 1.5 μL of cDNA, 11.5 - 13.5 μL of 2×TaqMasterMix, 0.5 - 1.5 μL of RsGH1-T7-F, 0.5 - 1.5 μL of RsGH1-R and 8.5 - 10.5 μL of ddH2O;

[0069] The volume of the cDNA is preferably 1 μL; the volume of the 2× Taq Master Mix is preferably 12.5 μL; the volume of the RsGH1-T7-F is preferably 1 μL; the volume of the RsGH1-R is preferably 1 μL; the volume of the ddH2O is preferably 9 μL;

[0070] The system for PCR amplification using primer pair 2 is 0.5 - 1.5 μL of cDNA, 11.5 - 13.5 μL of 2× Taq Master Mix, 0.5 - 1.5 μL of RsGH1-F, 0.5 - 1.5 μL of RsGH1-T7-R, and 8.5 - 10.5 μL of ddH2O;

[0071] The volume of the cDNA is preferably 1 μL; the volume of the 2× Taq Master Mix is preferably 12.5 μL; the volume of the RsGH1-F is preferably 1 μL; the volume of the RsGH1-T7-R is preferably 1 μL; the volume of the ddH2O is preferably 9 μL;

[0072] The procedures for PCR amplification using primer pair 1 and primer pair 2 are independently pre-denaturation at 95 °C for 2.5 - 3.5 min, preferably 3 min; denaturation at 94 °C for 10 - 20 s, preferably 15 s, annealing at 55 °C for 10 - 20 s, preferably 15 s, extension at 72 °C for 35 - 45 s, preferably 40 s, for 35 cycles; extension at 72 °C for 4.5 - 5.5 min, preferably 5 min, and cooling at 4 °C for 1.5 - 2 min, preferably 1.5 min.

[0073] In the present invention, the system for in vitro transcription in step (3) is 1.5 - 2.5 μL of 10× Transcription Buffer, 1.5 - 2.5 μL of ATP Solution, 1.5 - 2.5 μL of GTP Solution, 1.5 - 2.5 μL of CTP Solution, 1.5 - 2.5 μL of UTP Solution, 0.2 - 0.8 μL of RNase Inhibitor, 1.5 - 2.5 μL of T7 RNA Polymerase, 1.5 - 2.5 μL of DNA template 1, 1.5 - 2.5 μL of DNA template 2, and 3 - 4 μL of RNase free ddH2O;

[0074] The volume of the 10×Transcription Buffer is preferably 2 μL; the volume of the ATP Solution is preferably 2 μL; the volume of the GTP Solution is preferably 2 μL; the volume of the CTP Solution is preferably 2 μL; the volume of the UTP Solution is preferably 2 μL; the volume of the RNase Inhibitor is preferably 0.5 μL; the volume of the T7 RNA Polymerase is preferably 2 μL; the volume of the DNA template 1 is preferably 2 μL; the volume of the DNA template 2 is preferably 2 μL; the volume of the RNase free ddH2O is preferably 3.5 μL.

[0075] The present invention provides the application of the dsRNA synthesized by the described synthesis method in the preparation of a product for preventing and treating tobacco target spot disease.

[0076] The present invention provides a preparation method of a nucleic acid nano-fungicide for preventing and treating tobacco target spot disease, comprising the following steps:

[0077] (1) Mix the carboxymethyl chitosan solution and the ε-polylysine solution to obtain a mixed solution, and incubate for 25 - 35 min to obtain an aqueous solution of nanoparticles;

[0078] The incubation time is preferably 30 min;

[0079] (2) Mix the dsRNA with the aqueous solution of nanoparticles to obtain a nucleic acid nano-fungicide;

[0080] In step (2), the dsRNA is the described dsRNA;

[0081] In the mixed solution in step (1), the mass ratio of carboxymethyl chitosan to ε-polylysine is 1 - 2:1 - 2, preferably 1:1;

[0082] In step (2), when the dsRNA is mixed with the aqueous solution of nanoparticles, the mass ratio of dsRNA to nanoparticles is 1 - 2:1 - 2, preferably 1:1.

[0083] The present invention provides a nucleic acid nano-fungicide for preventing and treating tobacco target spot disease prepared by the described preparation method.

[0084] The technical solutions provided by the present invention are described in detail below with reference to the examples, but they should not be construed as limiting the protection scope of the present invention.

[0085] Example 1: Screening genes

[0086] Plant culture conditions and reagents: Nicotiana benthamiana and Nicotiana tabacum K326 were cultured in an artificial constant temperature culture room at 25 °C in Shenyang Agricultural University, with 16 h of light and 8 h of darkness per day, and a relative humidity of 60%. Tobacco at the 4-6 leaf stage was used for subsequent experiments. Rhizoctonia solani AG3-TB was preserved by the Virus Laboratory of Shenyang Agricultural University. Vectors pTRV1 and pTRV2e were preserved by our laboratory; Escherichia coli competent DH5α and Agrobacterium tumefaciens competent GV3101 were purchased from Sangon Biotech (Shanghai) Co., Ltd. Restriction endonucleases BamHΙ and XhoΙ were purchased from Thermo Fisher Scientific (China) Co., Ltd.; DL2000, DL15000 Maker, homologous recombinase, PCR product gel recovery kit, plasmid miniprep kit, etc. were all purchased from Nanjing Novoprotein Scientific Co., Ltd.

[0087] Screening method:

[0088] (1) Total RNA extraction

[0089] Scrape the mycelium of Rhizoctonia solani AG3-TB on a PDA medium covered with cellophane, weigh 0.1 g of mycelium and put it into a sterilized mortar. During this process, continuously add liquid nitrogen until it is ground into a powder. Transfer the ground sample to a 1.5 mL centrifuge tube, add 1 mL of TRIzol reagent to the centrifuge tube, mix well with a pipette and let it stand on ice for 5 min; add 200 μL of chloroform to the solution, shake vigorously for 15 s to form an emulsion, then let it stand at 4 °C for 5 min; then centrifuge at 12000 rpm for 15 min at 4 °C, transfer the supernatant to a new centrifuge tube, add an equal volume of isopropanol, mix well by inverting up and down and let it stand at 4 °C for 10 min. After centrifuging at 12000 rpm for 10 min at 4 °C, take it out, discard the supernatant and keep the precipitate. Add 1 mL of 75% ethanol to the precipitate to suspend the precipitate, invert it up and down several times and let it stand at room temperature for 3 min, then centrifuge at 12000 rpm for 5 min at 4 °C, discard the supernatant and keep the precipitate. Finally, blow it in the ultra-clean workbench for 3 min, and add 20 μL of RNase-free ddH2O to dissolve the precipitate to obtain the RNA extraction solution.

[0090] (2) Reverse transcription

[0091] Use the III 1st Strand cDNA SynthesisKit(+gDNAwiper) kit from Novoprotein Scientific Co., Ltd. to synthesize the first-strand cDNA to obtain the cDNA of Rhizoctonia solani AG3-TB bacteria.

[0092] (3) PCR amplification of the target fragment

[0093] Using the cDNA of Rhizoctonia solani AG3-TB as a template, eight genes including DUF3129 family protein (RsDUF3129), glycosyl hydrolase family 1 (RsGH1), chorismate synthase (RsCS), polysaccharide lyase (RsPLs), polysaccharide deacetylase (RsPDA), pectin-degrading (RsPD), Glutathione S-transferase (RsGST) and 60s acidic ribosomal protein (RsRPL), as well as the fragment of the control group green fluorescent protein (GFP) gene were amplified, and the primers were designed by primer premier 5.0.

[0094] The nucleotide sequence of the DUF3129 family protein (RsDUF3129) gene is shown in SEQ ID NO.6, and the nucleotide sequence of SEQ ID NO.6 is: ATTATTGGCGTTCGTCTGGTCGCCACCCAGAGGCAGAGGCAATGTGCTCTTGCGAGCTGCTTCGCGGTCCGCATTAACTTCCTTGCCGCCGATAACCCATGTACGCTTGTCGCCCGTATCTCCATGCTTCTGGTTGAGTCTGCTAAGAAGTGCAGACTGCCGGGCAGGGAAGGGTGGCATCTCCTCACAAACGTTTTGAAGCAGTATATCATCGTCAGGTCGGGATGCAATGGCATAGTACTCGCATGCCCGTTGCTGGAGTTCAGAGTCGAGAACATGTCGGTAACGGTCGAATATGCTCAAAAGCTCTTGTTTAATTTCAGGAAAGACGTTGGCCCATTTGATGTAGGTCGATAATAGTAGTGCACGAGTAGCGGGCGATGTAAAATGCGATTTCGATTGCAGTGCTTGCAGTTGTTCAATGGGACTGCAGCCAGGTTCGTTTGCAATAAGATGACCATATTCTCCAAGAATATAACCGCCGA;

[0095] The nucleotide sequence of the glycosyl hydrolase family 1 (RsGH1) gene is shown in SEQ ID NO.7, and the nucleotide sequence of SEQ ID NO.7 is: ACTCAACTCGGTCCTTATCCGCCAGGGCGTCGAGGAGTGGTTTTGAGTCTTCGTCCTTGACCGCAAACCCATTCTCCGTGATGTAGATTGGAAGTTTGTACTTCTTCCAAATGTAGTTGAGGAGTGCACGGAAGCCATCTGGGTAAGTCTGAAGCCAGGCACAGTGAGCCTGGCACCCGAGCTCGGTACCGTCGGGGCGCTTGAAGGTGTAATCGACATTTCCTTGGAACTCGTCAGAACCGCCGGCCTTGCAAAGGTTGGTGGTGTAAGTGTTCATGCCGTAGAAGTCACCCGAGCCCTTGACGACCTTGAGCTCCTCTGGGGTGAAGGTGGGCAGCCTGTCACCGAGAACTTCCTTCATGTATGCGGGGTAGTGGCCAAGGTAAACAGGGTCGGCGAACCAACCGATGGCAAAATCGAGTGCATGTTGAGCCGCGGCAATGTTCTCAGGAGTATTGTCGTAAGGCATAGCCCAGTCACCATTCAGGGTGATACCAATCTGCCCCTTTTGGGCAGACTTGAACTGCTCGCGGTACAGCTTGACCGCATACGCATGGGCAAGGATTACACT;

[0096] The nucleotide sequence of the chorismate synthase (RsCS) gene is shown in SEQ ID NO.8, and the nucleotide sequence of SEQ ID NO.8 is: CCAGTTGGAAGTCGTGCGGAGGCGCCCATCCTCGCCGGCAACGAAGGGGTCGTTGTGGCGCGATCCTGGAACCTCGCAGCCCTTGAAGCCGGAGCCAATTTCGAAGCCCTTGGTGGCAGGGATGGAGAGCATGGCATGCGCAAGCTCAGCCTCGAACTTGTCAAAGACGGGCTCTCCGAGGCCTGCAGGGACGTTGCGGATGACGCAAACAACGGTACCACCGATGGAGTCCTGAGCTTCCTTGGCACGGATGATACGCGCAGTCATCTTCTCTGAAGTCTCAGCGTGAGGGCAACGAGTCGTGAATTTGTCAACCTCCTCGCGAGTGATGGTCTTCAGGAGCTTGACGTACTCGGGGGAGAGAGCATCCTCAGCATAGTCAGGGTCCTCGCTCTCGCCAGTGGCAGCAGCACCGGAGCTGCTGGGGATGTGAATATTGCCCACGGAGGCGACAAAGGCGACGATCTCGACGCCGAAAGCGATCTTCAAGTACTTCTCGGCAATGGCACCAGCAGCGACACGGCCAATGGTCTCGCGGGCCGAAGAGCGACCTCCACCAGACGAAG;

[0097] The nucleotide sequence of the said polysaccharide lyase (RsPLs) gene is as shown in SEQ ID NO.9, and the nucleotide sequence of SEQ ID NO.9 is: TGGTTGTTGATGTCTCGGAAGAAGGGTCCTCCACCCGAGGTCTCATAAGCATTACCCGGCATGACCATATAGACACCCACCCCACTTCCAGTCACTCCGTGAACCTGATCTTTGATGAACTGGACCGAAGAGTAGAATTTAGAGCGCGTTTGTCCGTTGAGCAAGTACACATCGCTTCCTTCGATGGCTGTACCACCATTAATTTCAGATTGGGTATAGCCCTTGGAAACTGCCGACTTGGAAAGGCGGGCAATGAAGCGTAGCTCTCCCACATCCGGCTCAGCCGTGGTGTAGGTACCAATATAAATCGCACTTTGCCCGCTCACGGCAACGTAGTATTGAGTGAGCGTCGATGTTGCAATCGTTATAGTGGCATAGTTCCCGGAGACCTTGGAAGAAACCGTAGCGGATCCCAGCCCGGAAGCAATGTGAGTGTATTTCGAAGAGTCTTGGCACTCGATATTATTATATTTCAGTGACGTAATGTCTCCGTTTGTTGTCGATACTCGAAAAACGAGGCCTCCTCCCGTGTCAACGCTGAGATACCCAGATCCAGTGGTTACACCGAACGCGGCCAAAGCACCAGGGGCAAAAGTCGAGAAAGCGAGCACAATAGCCGTTTTCC;

[0098] The nucleotide sequence of the said polysaccharide deacetylase (RsPDA) gene is as shown in SEQ ID NO.10, and the nucleotide sequence of SEQ ID NO.10 is: GAGTTGGTTGACTTGTTGGATAACTATGGTGCAAAAGGCACTTTCTTCGTCAACGGTAACAACTACGGCTGCATTTACACCGAGGAGAACGCCGAGCGTCTCAAGGACCTGGTTAAGCGAGGTCACCAGCTCGCGTCGCATACTTGGGCCCACGCGCATCTGCCTCAGCTGACCGGCGACGCGCTAAAGGCTGAGTTTACCAGGACAAACGAGGCCATTACCAAGATCACAGGGCGTACCCCTGCATTCATGCGCCCGCCGTATGGAGAGTACAATGATGAAGTGGTCGAGACGGCGGCCAATAATGGTCAAACTGTCGTCATTTGGGACTTTGATTCCCAGGATTCGATTGGCGCCACAGCGGCTCAGTCAAAGAGCTATTACGACAACATTCTTGACAACAACTCGGGCCACATTCTCACTCTGAACCATGAGACTATTGAAACTACTGTCCATGACGTTATTCCGTATGCACTCAAGCTAATCA;

[0099] The nucleotide sequence of the pectin-degrading (RsPD) gene is shown in SEQ ID NO.11, and the nucleotide sequence of SEQ ID NO.11 is: AATTGCGTTGAACGTATGCATGGAAATTTGTGTTCCCCCGAGTAAATGGCGCAATAGTAGTCGAGGGTCCGCTGATGAACACATTATTCATGATATTTACGTACGACTGGCCTGCAGAGTCTCCGCCAGCGATATAACCGCCGCCACTACCCCAATTGTAGACAATGTTGTTGACAAACTCATTAACACCCTTGACTTTAGGATTACGAGTTTTGTGGTCGATGTAAAGGGACCTGATGATACTAACGCCCCCACTCGTCTGCATAAGCCCGCCGCATGAGTGTGTCTCTAGACCTTGTGCAATAAGAGCGTCGGATATTGTCACGTTCGAGACGTCGCCATTGATGGAGAATGTCTCATCTCGTCCCCAAGAAACACTAACA;

[0100] The nucleotide sequence of the Glutathione S-transferase (RsGST) gene is shown in SEQ ID NO.12, and the nucleotide sequence of SEQ ID NO.12 is: TATCAGCCCACCACGCCTTGACATGGGGCTTGGAAGAAAGGATGGTAGGTTCGAGGTCGTTAACCATCTTGCCGTAGGGAAGATGGAACAAGTCGGCGAGAGTGAAAGTGTCGCCAGCCAGATACTTTTGCTTGGACAAAATCCGCTCGTAGCCATCCATCTTGGCGTTGAGTGTGTCGACATACTTCTTCACCAACTCTTCGTTGGTTTTCAGTTGCCTCATTGGAGCGAAAACCCTTTCGTAAGCGAGCGAGGAAGCCGAAGGATCGAAACTCGAATACTCGACGCTAGCGGCTTGTTCAAACAGTCCATAGGCCTTTACATCGCTGGGATTGGGTAGCAAAGGAGAACCTTTTCCATATTTGGCAACCAAGTAGCGAGAGATAGCACGAGACTCATAAATCTTCGTTCCATCCTCGTCCTCAAGGACGGGGATAATACCGAACGGG;

[0101] The nucleotide sequence of the 60s acidic ribosomal protein (RsRPL) gene is shown in SEQ ID NO.13, and the nucleotide sequence of SEQ ID NO.13 is: GAAAAGACCAAAGCCCATATCGTCGTCTGACTCTTCCTTTTCTTCTTCCTTCTTCTCTTCCTTCTTTTCCTCGGCAGCAGCTGCTCCACCCGCAGCAGCAGCAGGGGCAGCTCCACCAGACGCCGCTCCCCCACCCGACGGGACGGATGCGAGCTTGGAGGAGCCCTCGGCGATCAAAGCGTTGACGTCCTTGCCCTCGAGCTCGCTCAAAAGCTTGTCAAGGCGCTCCTCGTCAACATCAACACCGCCGGCAGAAATAACCTTCTTGATATCATCCTTTGTAGGAGAGGTATTTCC。

[0102] Prepare the following reaction system in a PCR tube: 1 μL of template cDNA; 1 μL each of 10 μM forward and reverse primers; 12.5 μL of 2× Taq Master Mix; 9.5 μL of ddH2O. The reaction conditions are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 45 s, for 32 cycles; extension at 72°C for 10 min. After the reaction, preliminarily detect whether the fragment size is correct by agarose gel electrophoresis. Cut and recover the PCR products with correct fragment sizes according to the FastPure Gel DNA Extraction Mini Kit instruction manual (Nanjing Novoprotein Biological Technology Co., Ltd.) to obtain PCR amplification fragments of different genes.

[0103] (4) Preparation of linearized pTRV2e vector

[0104] According to the selected restriction enzyme sites (BamHΙ and XhoΙ), double-digest the pTRV2 plasmid with restriction enzymes BamHΙ and XhoΙ. The reaction system is as follows: 10 μL of pTRV2e plasmid (500 ng - 2 μg); 2 μL each of restriction endonucleases; 4 μL of 10× CutSmart Buffer; 32 μL of ddH2O, react at 37°C in a PCR instrument for 3 h. After detecting the success of digestion by running the product on a gel, purify the product according to the product purification kit instruction manual. Store the purified double-digested linearized pTRV2e vector in a -20°C refrigerator for later use.

[0105] (5) Ligation and transformation

[0106] Prepare the purified double-digested linearized pTRV2e vector and PCR amplification fragments of different genes according to the following reaction system:

[0107] 2 μL of linearized pTRV2e vector; 2 μL of PCR amplification fragment; 4 μL of 5× CEⅡ buffer; 2 μL of ExnaseⅡ; 10 μL of ddH2O.

[0108] Use a pipette to mix the reaction system, and obtain the ligation product after reacting at 37°C for 30 min. Then transfer the ligation product into Escherichia coli competent DH5α. The specific method is as follows:

[0109] After taking out the Escherichia coli competent DH5α from the -80 °C refrigerator, place it on ice and let it thaw slowly; sequentially add 50 μL of competent cells and 10 μL of ligation product into a centrifuge tube, gently mix and then let it stand on ice for 25 min; heat shock in a 42 °C water bath for 45 s, quickly put it back on ice and let it stand for 2 min; add 900 μL of liquid LB medium without antibiotics into the centrifuge tube, place it at 37 °C, and resuscitate in a shaker at 200 rpm for 1 h; centrifuge at 5000 rpm for 1 min to collect the bacterial cells, leave about 100 μL of supernatant, pipette to resuspend the bacterial pellet and spread it on a solid LB medium containing kana antibiotic; invert the plate and place it in a 37 °C incubator for overnight culture. Pick single colonies and culture them by shaking in a liquid LB (kana) medium, and perform preliminary identification of the bacterial liquid by colony PCR using the pTRV2e sequencing primer. The recombinant expression vectors with correct identification bands are sent for sequencing to obtain recombinant Escherichia coli expressing different genes.

[0110] (6) Transformation of the recombinant expression vector into Agrobacterium tumefaciens GV3101

[0111] After expanding the culture of the recombinant Escherichia coli expressing different genes and extracting the plasmids, recombinant plasmids expressing different genes are obtained respectively. Take out the Agrobacterium tumefaciens competent GV3101 from the -80 °C refrigerator and place it on ice. Add 8 μL of plasmid (not exceeding 1 / 10 of the volume of the competent cells) into 100 μL of just thawed competent cells; mix with a pipette and let it stand on ice for 5 min, in liquid nitrogen for 5 min, in a 37 °C water bath for 5 min, and then let it stand on ice for 5 min; add 900 μL of liquid LB medium without antibiotics in a laminar flow hood, mix well and culture in a shaker at 28 °C for 3 h; centrifuge at 6000 rpm for 1 min to collect the bacterial cells, leave about 100 μL of supernatant, pipette to resuspend the bacterial pellet and spread it on an LB solid medium containing kana and Rif antibiotics. Wait until all the liquid in the medium is absorbed, seal it with parafilm and invert it and place it in a 28 °C incubator for 3 days. Pick single colonies and culture them by shaking in a liquid LB medium containing kana and Rif for 5 h, and perform identification of the bacterial liquid by colony PCR using the pTRV2e sequencing primer to obtain the recombinant Agrobacterium tumefaciens bacterial liquid expressing different genes, and store the bacterial liquid in the -80 °C refrigerator for later use.

[0112] (7) Agrobacterium-mediated infiltration of Nicotiana benthamiana with the recombinant expression vector

[0113] Take out the stored recombinant Agrobacterium liquid expressing different genes from the -80°C refrigerator. For each treatment, draw 100 μL of the bacterial liquid and add it to 10 mL of liquid LB medium (containing kana and Rif). After mixing evenly, culture it on a shaker at 28°C for 36 h. Centrifuge at 12,000 rpm for 20 min to remove the liquid LB and collect the bacterial cells. Dilute the cultured Agrobacterium carrying pTRV1 and recombinant pTRV2 with infiltration buffer (10 mM MES, 10 mM MgCl2, and 200 μM acetosyringone) to a suspension buffer with an OD 600 = 0.5. Mix equal volumes of pTRV1 and recombinant pTRV2 and incubate at room temperature for 2 h. Aspirate the suspension buffer with a 1 mL needleless syringe and select the 3rd and 4th leaves of Nicotiana benthamiana with similar growth vigor for infiltration treatment. After the treatment, first culture in the dark for 16 h, and then resume culturing with 16 h of light and 8 h of darkness every day. At 14 days after the infiltration treatment, inoculate with a Rhizoctonia solani AG3-TB fungal cake by acupuncture. Take pictures and samples of the test plants on the 2nd day after inoculation, and record the diameter of the necrotic lesions. The results are as Figure 1 shown in Figure 1 a. Use SPSS software to perform statistical analysis on each treatment and the control group. The results are as

[0114] shown in Figure 1 a and Figure 1 b. It can be seen from

[0115] a and Figure 2 b that compared with the control, plants of TRV-RsDUF3129, TRV-RsGH1, TRV-RsCS, TRV-RsPLs, TRV-RsPDA, TRV-RsPD, TRV-RsGST, and TRV-RsRPL all showed different degrees of inhibition against the infection of Rhizoctonia solani AG3-TB. Among them, the plant of TRV-RsGH1 had the highest inhibition rate of necrotic lesions of tobacco target spot disease, which was 63.57%.

[0115] Further detection was carried out on the TRV-RsGH1 plants to detect the fungal biomass and the expression level of the RsGH1 gene in the TRV-GFP plants and the TRV-RsGH1 plants. The results are as Figure 2 shown, among which Figure 2 a represents the fungal biomass of the TRV-GFP plants and the TRV-RsGH1 plants, Figure 2 b represents the expression level of the RsGH1 gene in the TRV-GFP plants and the TRV-RsGH1 plants.

[0116] It can be seen from Figure 2 a and Figure 2As can be seen from b, compared with the control plants, the biomass accumulation of Rhizoctonia solani AG3-TB in the leaves of TRV-RsGH1 plants decreased by 76.83%; compared with the control plants, the expression level of the RsGH1 gene in TRV-RsGH1 plants decreased significantly by 64.3%.

[0117] The above results indicate that the silencing of the RsGH1 gene can reduce the diameter of necrotic lesions and enhance the resistance of tobacco to Rhizoctonia solani AG3-TB.

[0118] Example 2: Subcellular localization and overexpression of RsGH1

[0119] Using the pGD-GFP plasmid stored in the laboratory as the backbone, the full-length RsGH1 was ligated into pGD-GFP by homologous recombination to construct a vector of pGD-RsGH1-GFP (expressing the fusion protein of RsGH1 and GFP). The correctly sequenced recombinant plasmid was transferred into competent cells of Agrobacterium tumefaciens GV3101. After streaking and culturing in a shaker at 28 °C for 36 h, the liquid was removed by centrifugation at 12,000 rpm for 20 min, and the cells were collected. The OD of the freshly cultured bacterial liquid was adjusted to 1.0 with infiltration buffer (10 mM MES, 10 mM MgCl2 and 200 μM acetosyringone), and it was mixed with competent cells of Agrobacterium tumefaciens GV3101 (pSoup-p19) at a ratio of 1:1 (v:v) and incubated at room temperature for 2 h. The above-mentioned well-mixed Agrobacterium was injected into the 3rd and 4th true leaves of Nicotiana benthamiana with similar growth. Laser confocal observation was carried out 48 - 72 h after injection, and the results are shown in 600 As shown in a. Figure 3 a.

[0120] According to Figure 3 a, there was obvious fluorescence on the plasma membrane of the leaves of Nicotiana benthamiana, proving that the RsGH1 protein was localized on the plasma membrane of the host plant.

[0121] The full-length sequence of the RsGH1 gene was ligated into the pSuper1300-GFP transient overexpression vector. The construction of the recombinant plasmid and Agrobacterium transformation were the same as above, with the pSuper1300-GFP empty vector as the control. After 36 h of Agrobacterium infiltration, the pathogen Rhizoctonia solani AG3-TB was inoculated on the infiltrated leaves. After 2 d, the situation of necrotic lesions on the leaves was observed. The results are shown in Figure 3 b. The diameter of the necrotic lesions was recorded and statistically analyzed. Then, the cellulose content of the leaves overexpressing the RsGH1 protein was further detected. The results are shown in Figure 3 c.

[0122] According to Figure 3 b and Figure 3As can be seen from [c], the transient overexpression of the RsGH1 protein significantly promoted the spread of lesions. Compared with the control, the cellulose content in the leaves treated with transient overexpression of the RsGH1 protein was significantly reduced, indicating that the RsGH1 protein has the function of destroying the host cell wall and degrading cellulose into monosaccharides. This result further confirmed the localization pattern of the RsGH1 protein on the host cell plasma membrane.

[0123] The above results indicate that the RsGH1 protein positively regulates the pathogenic process of Rhizoctonia solani AG3-TB and is a key virulence factor of the pathogen.

[0124] Example 3: Synthesis of dsRNA

[0125] As can be seen from Example 1 and Example 2, the RsGH1 protein can positively regulate the pathogenic process of Rhizoctonia solani AG3-TB and is a key virulence factor of the pathogen. Based on the RsGH1 gene, a dsRNA (i.e., dsRsGH1) was designed to silence the RsGH1 gene in Rhizoctonia solani AG3-TB and inhibit the expression of the RsGH1 protein to control tobacco target spot disease.

[0126] The nucleotide sequence of the dsRNA is as shown in SEQ ID NO.1, specifically: ACTCAACTCGGTCCTTATCCGCCAGGGCGTCGAGGAGTGGTTTTGAGTCTTCGTCCTTGACCGCAAACCCATTCTCCGTGATGTAGATTGGAAGTTTGTACTTCTTCCAAATGTAGTTGAGGAGTGCACGGAAGCCATCTGGGTAAGTCTGAAGCCAGGCACAGTGAGCCTGGCACCCGAGCTCGGTACCGTCGGGGCGCTTGAAGGTGTAATCGACATTTCCTTGGAACTCGTCAGAACCGCCGGCCTTGCAAAGGTTGGTGGTGTAAGTGTTCATGCCGTAGAAGTCACCCGAGCCCTTGACGACCTTGAGCTCCTCTGGGGTGAAGGTGGGCAGCCTGTCACCGAGAACTTCCTTCATGTATGCGGGGTAGTGGCCAAGGTAAACAGGGTCGGCGAACCAACCGATGGCAAAATCGAGTGCATGTTGAGCCGCGGCAATGTTCTCAGGAGTATTGTCGTAAGGCATAGCCCAGTCACCATTCAGGGTGATACCAATCTGCCCCTTTTGGGCAGACTTGAACTGCTCGCGGTACAGCTTGACCGCATACGCATGGGCAAGGATTACACT。

[0127] Primer pairs for synthesizing dsRNA were also designed, including primer pair 1 and primer pair 2. Primer pair 1 includes the upstream primer RsGH1-T7-F and the downstream primer RsGH1-R;

[0128] The nucleotide sequence of the upstream primer RsGH1-T7-F is as shown in SEQ ID NO.2, specifically: TAATACGACTCACTATAGGGACTCAACTCGGTCCTTATC;

[0129] The nucleotide sequence of the downstream primer RsGH1-R is as shown in SEQ ID NO.3, specifically: AGTGTAATCCTTGCCCATGC;

[0130] Primer pair 2 includes the upstream primer RsGH1-F and the downstream primer RsGH1-T7-R;

[0131] The nucleotide sequence of the upstream primer RsGH1-F is shown in SEQ ID NO.4, specifically: ACTCAACTCGGTCCTTAT;

[0132] The nucleotide sequence of the downstream primer RsGH1-T7-R is shown in SEQ ID NO.5, specifically: TAATACGACTCACTATAGGGAGTGTAATCCTTGCCCATGC.

[0133] The method for synthesizing dsRNA is as follows:

[0134] (1) Extract the RNA of Rhizoctonia solani AG3-TB, and reverse transcribe it to obtain cDNA;

[0135] (2) Using the cDNA of Rhizoctonia solani AG3-TB as a template, perform PCR amplification with the upstream primer and downstream primer of primer pair 1 to obtain DNA template 1 with the T7 promoter inserted at the N-terminus of the RsGH1 gene;

[0136] The PCR amplification system is: 1 μL of cDNA, 12.5 μL of 2× Taq Master Mix, 1 μL of RsGH1-T7-F, 1 μL of RsGH1-R, and 9 μL of ddH2O;

[0137] The PCR amplification program is: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 40 s, 35 cycles; extension at 72°C for 5 min, cooling at 4°C for 2 min;

[0138] Using the cDNA of Rhizoctonia solani AG3-TB as a template, perform PCR amplification with the upstream primer and downstream primer of primer pair 2 to obtain DNA template 2 with the T7 promoter inserted at the C-terminus of the RsGH1 gene;

[0139] The PCR amplification system is: 1 μL of cDNA, 12.5 μL of 2× Taq Master Mix, 1 μL of RsGH1-F, 1 μL of RsGH1-T7-R, and 9 μL of ddH2O;

[0140] The PCR amplification program is: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 40 s, 35 cycles; extension at 72°C for 5 min, cooling at 4°C for 2 min;

[0141] (3) Co-transcribe DNA template 1 and DNA template 2 in vitro, react at 42 °C for 2 h. After the reaction is completed, add 2 μL of RNase free DNase I (5 U / μL) and 1 μL of RNase T1 (4 U / μL) for nuclease treatment, and obtain dsRNA, namely dsRsGH1 after reacting at 37 °C for 2 h.

[0142] The in vitro transcription system is: 2 μL of 10× Transcription Buffer, 2 μL of ATP Solution, 2 μL of GTP Solution, 2 μL of CTP Solution, 2 μL of UTP Solution, 0.5 μL of RNase Inhibitor, 2 μL of T7 RNA Polymerase, 2 μL of DNA template 1, 2 μL of DNA template 2 and 3.5 μL of RNase free ddH2O.

[0143] Example 4: Detection of the inhibitory effect of dsRsGH1 on the incidence of tobacco target spot disease

[0144] Dilute the dsRsGH1 obtained in Example 3 with pure water to a final concentration of 200 ng / μL, and evenly spray it on the leaves of common tobacco K326 at the 5-7 leaf stage with similar growth, using dsGFP as a control; after the sprayed dsRsGH1 is completely absorbed by the tobacco leaves, use a sterilized toothpick to puncture the leaves, then invert a Rhizoctonia solani AG3-TB bacterial cake with a diameter of 0.7 cm on the wound to inoculate the pathogen, and cover the bacterial cake with moist cotton for moisturizing; respectively, at 48 h and 72 h after inoculation, count the lesion size, detect the RsGH1 gene expression level and fungal biomass, and use the β-tublin gene of Rhizoctonia solani AG3-TB (GenBank: FJ392714.1) as an internal reference gene to detect the expression level of the RsGH1 gene by qRT-PCR. Use the common tobacco Actin (GenBank: LOC107795948) and the 5.8S rDNA gene of Rhizoctonia solani AG3-TB (GenBank: LC273000.1) as internal reference genes to detect the fungal biomass by qPCR. The detection results are as Figure 4 shown, where Figure 4 a represents the lesion size at 48 h after inoculation, Figure 4 b represents the lesion size at 72 h after inoculation, Figure 4 c represents the statistical results of the lesion sizes of different treatments at 48 h and 72 h after inoculation, Figure 4 d represents the statistical results of the biomass of Rhizoctonia solani AG3-TB of different treatments at 48 h and 72 h after inoculation.Figure 4 f represents the expression levels of the RsGH1 gene under different treatments at 48 h and 72 h after inoculation.

[0145] According to Figure 4 it can be seen that the spraying of exogenous dsRsGH1 can effectively inhibit the spread of tobacco target spot lesions. Compared with the control, the control effect of dsRsGH1 on tobacco target spot was 54.2% at 48 h; while at 72 h, the control effect of dsRsGH1 on tobacco target spot was 43.9%. The qRT-PCR results showed that the RsGH1 gene silencing efficiency was 54.3% at 48 h and 41.7% at 72 h. The qPCR results showed that the fungal biomass decreased significantly after spraying dsRsGH1.

[0146] The above results indicate that the interference of the RsGH1 gene can play an effect in preventing and controlling tobacco target spot, but the prevention and control of dsRsGH1 on the disease has a certain timeliness.

[0147] Example 5: Preparation and characterization of nucleic acid nano-fungicides

[0148] 1. Preparation of nano-carriers

[0149] Carboxymethyl chitosan (degree of deacetylation ≥ 90.0%) (CMCS) was purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. ε-Polylysine (ε-PL) was purchased from Zhengzhou Bionovo Biotechnology Co., Ltd.

[0150] Weigh 0.2 g of ε-PL and 0.2 g of CMCS and add them to 99.8 mL of deionized water respectively. Stir with a magnetic stirrer for 30 min and ultrasonically treat for 30 min until completely dissolved to obtain an ε-PL solution with a concentration of 2 mg / mL and a CMCS solution with a concentration of 2 mg / mL.

[0151] CMCS particles can spontaneously combine with ε-PL particles in an aqueous solution to form ε-PL@CMCS nanoparticles. Mix the solutions according to different mass ratios of ε-PL to CMCS, and incubate at room temperature for 30 min to obtain ε-PL@CMCS nanoparticle solutions with different mass ratios of ε-PL to CMCS. The preparation of solutions with different mass ratios of ε-PL to CMCS is shown in Table 1.

[0152] Table 1 Preparation of solutions with different mass ratios of ε-PL to CMCS

[0153] Mass ratio of ε-PL to CMCS ε-PL (2 mg / mL) CMCS (2 mg / mL) 4：1 8 mL 2 mL 3：2 6 mL 4 mL 1：1 5 mL 5 mL 2：3 4 mL 6 mL 1：4 2 mL 8 mL

[0154] 2. Determination of Z-average, zeta potential and PDI of nanoparticles

[0155] The ε-PL@CMCS nanoparticle solutions with different mass ratios of ε-PL to CMCS were detected for Z-average, PDI and potential using a Malvern particle size analyzer. The results are as Figure 5 shown.

[0156] According to Figure 5 it can be seen that when the mass ratio of ε-PL to CMCS is 1:1, although its particle size slightly increases compared to ε-PL, its PDI is the smallest, proving that its particles are more uniform and the solution is evenly distributed. Therefore, the optimal mass ratio of ε-PL to CMCS is determined to be 1:1.

[0157] The ε-PL@CMCS nanoparticle solution with a mass ratio of ε-PL to CMCS of 1:1 was observed and then irradiated with a laser pointer. The results are as Figure 6 shown.

[0158] According to Figure 6 it can be seen that the ε-PL@CMCS nanoparticle solution with a mass ratio of ε-PL to CMCS of 1:1 is milky white with uniform dispersion. An obvious "Tyndall effect" can be observed when irradiated with a laser pointer, proving that the particles in this solution are in the nanoscale range.

[0159] 3. Stability test of nanoparticles at different temperatures

[0160] The ε-PL@CMCS nanoparticle solution with a mass ratio of ε-PL to CMCS of 1:1 was stored at different temperatures (4 °C, 28 °C and 37 °C) for 1 d, 5 d, 7 d, 9 d, 11 d, 13 d and 15 d respectively. The Z-average, zeta potential and PDI of the samples under different temperature storage conditions were tested using a Malvern particle size analyzer. The results are as Figure 7 shown.

[0161] According to Figure 7 it can be seen that when the ε-PL@CMCS nanoparticles with a mass ratio of ε-PL to CMCS of 1:1 are stored at three different temperatures until the 15th day, the particle size increases significantly. It is proved that the ε-PL@CMCS nanoparticles with a mass ratio of ε-PL to CMCS of 1:1 can be stably stored for at least 13 d under different temperature conditions, which can meet the needs of production applications.

[0162] Example 6: Optimal loading ratio of nanoparticles loaded with dsRsGH1

[0163] dsRsGH1, as a nucleic acid substance, carries a negative charge, and the prepared ε-PL@CMCS nanoparticles carry a positive charge. According to the principle of electrostatic adsorption, dsRsGH1 is loaded onto the nanoparticles. The optimal loading ratio of dsRsGH1 and the nanoparticles was determined by gel retardation assay. After mixing dsRsGH1 and ε-PL@CMCS nanoparticles at different mass ratios, electrophoresis was performed on 1% agarose gel. The results are as Figure 8 shown. Lanes 3-7 correspond to the mass ratios of dsRsGH1 to ε-PL@CMCS of 5:1, 2:1, 1.5:1, 1:1, and 1:2, respectively; dsRsGH1 and ε-PL@CMCS correspond to lanes 1 and 2.

[0164] According to Figure 8 it can be seen that ε-PL@CMCS nanoparticles have a strong ability to load dsRsGH1. When the mass ratio of dsRsGH1 to ε-PL@CMCS nanoparticles is 1:1, dsRsGH1 loses its electronegativity and is completely loaded onto the ε-PL@CMCS nanoparticles, resulting in dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles, which remain in the sample well.

[0165] Example 7: Morphological characteristics of nucleic acid nanoparticles

[0166] The morphology of the samples was observed using a transmission electron microscope (TEM) equipped with an energy dispersive spectrometer (EDS).

[0167] Drop the ε-PL@CMCS nanoparticles and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticle solutions onto the copper grid. After natural air drying, observe under the condition of 120 kV. The results are as Figure 9 shown.

[0168] According to Figure 9 it can be seen that the ε-PL@CMCS nanoparticles present regular near-spherical nanoparticles. The EDS energy spectrum scanning results show that the C, N, O, and P elements are evenly distributed in the dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles, further indicating that dsRsGH1 is successfully loaded onto the ε-PL@CMCS nanoparticles.

[0169] Example 8: Performance determination of nucleic acid nanoparticles

[0170] 1. Determination of protection performance

[0171] After treating dsRsGH1 and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles with RNase A for 0.5 h and 1 h respectively, dsRsGH1 was released from the nanocarrier with 0.4% SDS for agarose gel electrophoresis. The results are as Figure 10 shown, where Figure 10a shows the gel electrophoresis patterns of dsRsGH1 and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles after being treated with RNase A for 0.5 h and 1 h. Figure 10 b shows the concentration of dsRsGH1 after being treated with RNase A for 0.5 h and 1 h. Figure 10 c shows the concentration of dsRsGH1 in dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles after being treated with RNase A for 0.5 h and 1 h.

[0172] According to Figure 10 it can be seen that dsRsGH1 was severely degraded after being treated with RNase A for 0.5 h and 1 h. However, after being treated with RNase A for 0.5 h and 1 h, the bands of dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles were still single and clear. After quantitative analysis, the concentration of dsRsGH1 was 56.2% of the control group when treated with RNase A for 0.5 h, and only 28% of the control group after being treated with RNase A for 1 h, which proved that ε-PL@CMCS had the effect of protecting dsRsGH1 from being degraded by RNase A. Under natural conditions, the concentration of nuclease is far lower than the laboratory standard. Therefore, we believe that the prepared ε-PL@CMCS nanoparticles' protective performance on dsRsGH1 can fully meet the requirements of production applications.

[0173] 2. Contact angle measurement with leaves

[0174] Using a contact angle measuring instrument, 5 μL of dsRsGH1@ε-PL@CMCS nucleic acid nanoparticle solution (dsRsGH1 concentration was 200 ng / μL) and dsRsGH1 solution (concentration was 200 ng / μL) were vertically dropped onto the surface of a glass slide and a tobacco leaf respectively. After the liquid droplets were stable for 5 s, contact angle images were collected. The ellipse fitting algorithm was used to analyze the contact angle, and 10 independent replicate experiments were carried out for each treatment. The results are as Figure 11 shown, where Figure 11 a shows the contact angle images and data of different treatments on the glass slide. Figure 11 b shows the contact angle images and data of different treatments on the surface of tobacco leaves.

[0175] According to Figure 11 it can be seen that the contact angles of dsRsGH1 after being loaded with ε-PL@CMCS decreased on both the glass slide and the surface of tobacco leaves. The contact angle on the glass slide decreased by 14.93%, and the contact angle on the tobacco leaf decreased by 19.23%.

[0176] 3. Adhesion measurement

[0177] The area of 8 cm 2The tobacco leaves were first weighed to obtain the mass (M1), and then soaked in the dsRsGH1 solution (200 ng / μL) and the dsRsGH1@ε-PL@CMCS nucleic acid nanoparticle solution for 30 s until no liquid dripped, and then weighed to obtain M2. Using ddH2O as a control, the retention amount was calculated.

[0178] The formula for calculating the retention amount is: retention amount (mg / cm 2 ) = (M2 - M1) / leaf area;

[0179] Each treatment was performed with 10 independent replicate experiments, and the images and data were recorded. The results are as Figure 12 shown.

[0180] According to Figure 12 it can be seen that the retention amount of dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles on tobacco leaves is higher. The retention amount of dsRsGH1 on tobacco leaves is 6.51 mg / cm 2 , and the retention amount of dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles on tobacco leaves is 8.95 mg / cm 2 .

[0181] 4. Evaluation of the effect of controlling tobacco target spot disease

[0182] The same volume of H2O, ε-PL@CMCS nanoparticle solution, dsGFP solution (concentration of 200 ng / μL), dsGFP@ε-PL@CMCS solution (dsGFP concentration of 200 ng / μL), dsRsGH1 solution (concentration of 200 ng / μL), and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticle solution (dsRsGH1 concentration of 200 ng / μL) were sprayed onto the surface of tobacco leaves. After complete absorption, Rhizoctonia solani AG3-TB was inoculated. The lesion sizes of tobacco leaves under different treatments were recorded at 48 h and 72 h, and statistical analysis was carried out. Furthermore, the transcriptional level of the RsGH1 gene and the fungal biomass in tobacco leaves under different treatments were statistically analyzed. The lesion sizes of tobacco leaves under different treatments and the statistical analysis results are as Figure 13 shown, where Figure 13 a represents the lesion sizes of tobacco leaves under different treatments, Figure 13 b represents the statistical analysis of the lesion sizes of tobacco leaves under different treatments; the results of the transcriptional level of the RsGH1 gene and the fungal biomass in tobacco leaves under different treatments are as Figure 14 shown, where Figure 14 a represents the fungal biomass in tobacco leaves under different treatments, Figure 14 b represents the transcriptional level of the RsGH1 gene in tobacco leaves under different treatments.

[0183] According toFigure 13 and Figure 14 It can be seen that at 48 h after inoculation, dsRsGH1 and dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles significantly inhibited the spread of necrotic lesions, while the group containing only dsGFP and ε-PL@CMCS showed a sensitive reaction, and the lesion diameter was greater than 0.5 cm. At 72 h after inoculation, compared with the H2O group, the inhibition rate of spraying dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles on the lesions was 63.4%, while the inhibition efficiency of dsRsGH1 on the lesions decreased, only 51.5%. This indicates that ε-PL@CMCS nanoparticles extended the protection time of dsRsGH1 against tobacco. Compared with the H2O group, after spraying dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles at 48 h and 72 h, the fungal biomass decreased, and the expression level of the RsGH1 gene decreased significantly, indicating that dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles could silence the expression of the RsGH1 gene for a long time, thereby controlling tobacco target spot disease.

[0184] The above results confirmed that dsRsGH1@ε-PL@CMCS nucleic acid nanoparticles can be used as a green and highly effective fungicide for controlling tobacco target spot disease.

[0185] Example 9: Preparation of a nucleic acid nano-fungicide for controlling tobacco target spot disease

[0186] (1) Weigh 0.2 g of ε-PL and 0.2 g of CMCS and add them to 99.8 mL of deionized water respectively. Stir with a magnetic stirrer for 30 min and sonicate for 30 min until completely dissolved to obtain an ε-PL solution with a concentration of 2 mg / mL and a CMCS solution with a concentration of 2 mg / mL. Mix 5 mL of the ε-PL solution with 5 mL of the CMCS solution and incubate at room temperature for 30 min to obtain an ε-PL@CMCS nanoparticle solution;

[0187] (2) Dilute the dsRsGH1 obtained in Example 3 with pure water to a dsRsGH1 dilution with a final concentration of 2 mg / mL. Mix 10 mL of the dsRsGH1 dilution with 10 mL of the ε-PL@CMCS nanoparticle solution to obtain a nucleic acid nano-fungicide.

[0188] As can be seen from the above examples, the present invention provides a dsRNA for controlling tobacco target spot disease, which targets the RsGH1 gene closely related to the degradation of plant cell walls in Rhizoctonia solani AG3-TB bacteria, and it has an inhibitory effect on the lesions of tobacco target spot disease, but it has a time limit, and the inhibition rate on the lesions is 51.5% after 72 h.

[0189] The present invention also provides a nucleic acid nano-bactericide for preventing and controlling tobacco target spot disease, which contains dsRNA targeting the RsGH1 gene closely related to Rhizoctonia solani AG3-TB and degrading plant cell walls and ε-PL@CMCS nanoparticles. After the dsRNA and the nanoparticles are loaded at a mass ratio of 1:1, the stability of the dsRNA can be improved, and the contact angle and adhesiveness of the dsRNA can be increased, and it has a more significant effect on inhibiting the expression of the target gene and inhibiting the spread of tobacco target spot disease lesions. 72 hours after inoculation with Rhizoctonia solani AG3-TB, the silencing efficiency of the RsGH1 gene is 52.1%, and the inhibition rate of tobacco target spot disease reaches 63.4%.

[0190] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A dsRNA for controlling tobacco target spot disease, characterized in that, The nucleotide sequence of the dsRNA is shown in SEQ ID NO.

1.

2. Use of the dsRNA according to claim 1 in controlling tobacco target spot disease, characterized in that, The dsRNA controls tobacco target spot disease by silencing the expression of the RsGH1 gene in Rhizoctonia solani AG3-TB.

3. A primer pair for synthesizing the dsRNA described in claim 1, characterized in that, The primer pair includes primer pair 1 and primer pair 2; The primer pair 1 includes the upstream primer RsGH1-T7-F and the downstream primer RsGH1-R; The nucleotide sequence of the upstream primer RsGH1-T7-F is shown in SEQ ID NO.2; The nucleotide sequence of the downstream primer RsGH1-R is shown in SEQ ID NO.3; The primer pair 2 includes the upstream primer RsGH1-F and the downstream primer RsGH1-T7-R; The nucleotide sequence of the upstream primer RsGH1-F is shown in SEQ ID NO.4; The nucleotide sequence of the downstream primer RsGH1-T7-R is shown in SEQ ID NO.

5.

4. The method for synthesizing the dsRNA according to claim 1, characterized in that, It includes the following steps: (1) Extract the RNA of Rhizoctonia solani AG3-TB and reverse transcribe to obtain cDNA; (2) Using the cDNA as a template, perform PCR amplification with primer pair 1 and primer pair 2 respectively to obtain DNA template 1 and DNA template 2; (3) Co-perform in vitro transcription on DNA template 1 and DNA template 2, and then perform nuclease treatment to obtain dsRNA; The primer pair 1 and primer pair 2 in step (2) are primer pair 1 and primer pair 2 in the primer pair described in claim 3; The system for PCR amplification using primer pair 1 is 0.5 - 1.5 μL of cDNA, 11.5 - 13.5 μL of 2×TaqMasterMix, 0.5 - 1.5 μL of RsGH1-T7-F, 0.5 - 1.5 μL of RsGH1-R, and 8.5 - 10.5 μL of ddH2O; The system for PCR amplification using primer pair 2 is 0.5 - 1.5 μL of cDNA, 11.5 - 13.5 μL of 2×TaqMasterMix, 0.5 - 1.5 μL of RsGH1-F, 0.5 - 1.5 μL of RsGH1-T7-R, and 8.5 - 10.5 μL of ddH2O; The procedures for PCR amplification using primer pair 1 and primer pair 2 are independently: pre-denaturation at 95°C for 2.5 - 3.5 min; denaturation at 94°C for 10 - 20 s, annealing at 55°C for 10 - 20 s, extension at 72°C for 35 - 45 s, 35 cycles; extension at 72°C for 4.5 - 5.5 min, cooling at 4°C for 1.5 - 2 min.

5. The synthesis method according to claim 4, characterized in that, The in vitro transcription system described in step (3) is 1.5 - 2.5 μL of 10× Transcription Buffer, 1.5 - 2.5 μL of ATP Solution, 1.5 - 2.5 μL of GTP Solution, 1.5 - 2.5 μL of CTP Solution, 1.5 - 2.5 μL of UTP Solution, 0.2 - 0.8 μL of RNase Inhibitor, 1.5 - 2.5 μL of T7 RNA Polymerase, 1.5 - 2.5 μL of DNA template 1, 1.5 - 2.5 μL of DNA template 2, and 3 - 4 μL of RNase free ddH2O.

6. Use of the dsRNA synthesized by the synthesis method according to claim 4 or claim 5 in the preparation of a product for preventing and treating tobacco target spot disease.

7. A preparation method of a nucleic acid nano bactericide for preventing and controlling tobacco target spot disease, characterized in that, Comprising the following steps: (1) Mix the carboxymethyl chitosan solution and the ε-polylysine solution to obtain a mixed solution, and incubate for 25 - 35 min to obtain an aqueous solution of nanoparticles; (2) Mix the dsRNA with the aqueous solution of nanoparticles to obtain a nucleic acid nano-fungicide; The dsRNA described in step (2) is the dsRNA described in claim 1; In the mixed solution described in step (1), the mass ratio of carboxymethyl chitosan to ε-polylysine is 1 - 2:1 - 2; When the dsRNA is mixed with the aqueous solution of nanoparticles in step (2), the mass ratio of dsRNA to nanoparticles is 1 - 2:1 - 2.

8. A nucleic acid nano-fungicide for preventing and treating tobacco target spot disease prepared by the preparation method according to claim 7.

Images