Establishment method and application of TRV virus induced canna endogenous gene silencing expression system

Abstract

The invention belongs to the technical field of plant biology, and particularly relates to an establishment method and application of a TRV virus induced canna endogenous gene silencing expression system. The method comprises the following steps: constructing a recombinant pTRV2-PDS vector through a CiPDS specific fragment, preparing virus juice by using an agrobacterium-mediated virus infection system and taking nicotiana benthamiana as a transition host, and realizing effective infection of the TRV virus on canna through friction inoculation. According to the method, a VIGS technical system is established in canna for the first time, the limitation of a traditional heterologous transformation technology is broken through, and the problem that research on canna flower organ development is lagged due to lack of an efficient gene function verification tool is solved. Meanwhile, the silence stability and phenotype observability are remarkably improved by optimizing the temperature and selecting inoculation materials.

Description

Technical Field

[0001] The present invention belongs to the field of plant biotechnology, and particularly relates to a method for establishing a TRV virus-induced endogenous gene silencing expression system in canna and its application. Background Art

[0002] Virus-induced gene silencing (VIGS) is an RNA silencing technology based on the plant antiviral defense mechanism. Its core principle is as follows: Recombinant viruses carrying plant endogenous gene fragments infect the host. During the virus replication process, the double-stranded RNA (dsRNA) formed is cleaved by plant Dicer enzyme into small interfering RNAs (siRNAs) of 21 - 25 bp. Subsequently, under the action of RNA-dependent RNA polymerase (RdRp), secondary siRNAs are amplified. After these siRNAs bind to the RNA-induced silencing complex (RISC), they degrade the target mRNA in a sequence-specific manner, thereby achieving gene silencing. Compared with traditional transgenic technologies, VIGS has significant advantages: It is not necessary to obtain stably inherited transgenic plants, can silence gene family members, requires less information on target sequences, supports synchronous silencing of multiple genes, and is particularly suitable for studying the functions of lethal genes. Currently, VIGS has become an important tool for functional genomics research in non-model plants.

[0003] Tobacco Rattle Virus (TRV) is a vector widely used in the virus-induced gene silencing (VIGS) technology. TRV belongs to the genus Tobravirus, and its genome consists of two single-stranded RNAs (RNA1 and RNA2). Among them, RNA2 can be modified to insert target gene fragments, thereby achieving the silencing of specific genes. The TRV vector can infect a variety of monocotyledonous and dicotyledonous plants and has advantages such as a wide host range, high silencing efficiency, and simple operation. The TRV vector has been successfully applied to the gene function research of various plants. For example, in tomato ( Solanum lycopersicum ), it is used to study the functions of genes related to fruit development and disease resistance; in cotton ( Gossypium hirsutum ), it is used to study the functions of genes related to fiber development and stress resistance; in petunia ( Gossypium hirsutum ), it is used to study the functions of genes related to flower color and flower type. However, although the TRV vector has achieved remarkable results in various plants, its application in canna has not been reported yet.

[0004] Canna ( Canna indica) is a perennial bulbous flower of the Canna family. It is known for its diverse inflorescence morphology and bright colors and is hailed as the "Queen of the Flower Bed". Its unique spathe-like calyx, petalized stamens and asymmetric flower shape show significant developmental differences from the model plant Arabidopsis thaliana. Current research is mostly limited to homologous gene cloning and expression profiling analysis, and functional verification mainly relies on heterologous transformation (such as Arabidopsis or tobacco), but heterologous systems are difficult to truly reflect the unique organ development regulatory network of Canna. Due to the low efficiency (<5%) and long cycle (>12 months) of traditional genetic transformation, there is an urgent need to develop an efficient VIGS technology suitable for Canna itself to reveal the molecular mechanism of its floral organ development. Summary of the invention

[0005] The purpose of the present invention is to provide a method for establishing a TRV virus-induced canna endogenous gene silencing expression system and its application in view of the existing problems.

[0006] The present invention is achieved through the following technical solutions: A method for establishing a TRV virus-induced canna endogenous gene silencing expression system comprises the following steps: (1) Extraction of target genes from canna CiPDS The specific fragment of the gene was identified, and primers were designed to amplify the 400-600 bp CDS segment, and restriction enzyme sites and homologous recombination sequences were introduced at the 5' end of the primers; (2) The gene fragment obtained in step (1) is connected to the linearized pTRV2 Vector, construction of recombinant viral vector pTRV2-CiPDS ; (3) Transform the recombinant viral vector into Agrobacterium GV3101 and TRV1 Agrobacterium and tumefaciens were mixed in equal proportions and injected into Nicotiana benthamiana leaves, and the virus juice was collected after 6 to 12 days of culture; (4) Inoculate the virus juice onto canna leaves by rubbing them and incubate them at 18°C ​​to induce target gene silencing; (5) Verify gene silencing efficiency through phenotypic observation and qRT-PCR.

[0007] Furthermore, the CiPDS The coding region sequence of the gene is 804 bp, encoding a total of 268 amino acids (aa); Said CiPDS The full-length nucleotide sequence of the gene coding region is shown in SEQ ID NO.1.

[0008] SEQ ID NO.1: ATGGATATCATCGGGGCCATTTCCCCTGTGAAGATAAATGGAACCAACCAGAGAAGATACTGGTGGGAAAATCCCGGTCAAAGATGTTCCTTTCCGAAAGATTCTGTTAGCAGCAACCTCCAAACATTCCGGAACAGTGAGTGTATGGGTTGCAAAATGAAGGTTCCAATCACATCGTTCACATACATGAAGCCAAAATATAGAAACAAAACTCTTCAGGTTGTCTGCAAAGATTTTCCAAGGCCGGAACTTGAAAACACTATTAATTTTTTAGAAGCTGCACAGTTGTCTTCATCCTTCCGAAATGGTCCTCATCCAAATATACCACTGAAGGTTGTAATAGCTGGTGCAGGTTTGGCTGGCCTATCTACAGCAAAATATCTAGCAGACGCAGGTCATAAACCTATACTGTTGGAGGCAAGGGATGTTCTGGGTGGAAAGATTGCTGCTTGGAAGGACAATGATGGAGACTGGTATGAGACAGGGCTCCATATATTCTTTGGAGCATATCCCAACATGCAGAACTTGTTTGGGGAACTTGGTATCAATGATCGTTTGCAGTGGAAAGAGCACTCAATGATATTTGCAATGCCAAACAAGCCAGGAGAGTTTAGCAGATTTGACTTTCCAGAGATTCTTCCGGCACCTCTGAATGGAATATTCGCAATTTTGAGAAATAATGAAATGCTGACTTGGCCAGAGAAAGTACGTTTTGCAATTGGACTTCTGCCAGCCATGCTAGGGGGGCAAGCATATGTTGAGGCTCAGGATGGTTTGACTGTTAAAGAGTGGATGAGAAGGCAG Furthermore, 1% (w / v) diatomaceous earth is added as an abrasive before inoculating the virus sap.

[0009] Application of a method for establishing a TRV virus-induced endogenous gene silencing expression system in Canna indica in gene function research or variety improvement of Canna indica.

[0010] Phytoene desaturase ( Phytoene Desaturase , PDS)is a key enzyme in the carotenoid synthesis pathway. Its silencing can lead to leaf photobleaching, with an intuitive phenotype and no lethality, and it is widely used as a reporter gene in the VIGS system. By PDS Quantitative analysis of the silencing efficiency (such as the proportion of albino area and chlorophyll content detection) can systematically optimize the inoculation method, virus vector construction strategy, and environmental condition parameters. In this study, PDS was introduced as an internal reference reporter gene into the Canna indica VIGS system for the first time, providing technical support for the establishment of a standardized silencing evaluation system.

[0011] The present invention has the following advantages compared with the prior art: 1. Aiming at the problems of lack of means for studying gene functions and low genetic transformation efficiency in difficult-to-transform plants such as Canna indica in the prior art, the present invention provides an efficient method for studying gene functions based on virus-induced gene silencing (VIGS). By constructing a recombinant TRV virus vector carrying the target gene fragment and optimizing the virus inoculation system with Nicotiana benthamiana as the transitional host, efficient silencing of endogenous genes in Canna indica is achieved. The present invention further significantly improves the silencing efficiency by screening suitable inoculation materials (rhizome seedlings) and culture temperature (18°C), solving the technical bottlenecks such as unstable silencing effect and unclear phenotype in the traditional method in Canna indica. This method provides reliable technical support for the gene function analysis and molecular breeding of Canna indica, and at the same time provides new ideas for the gene research of other difficult-to-transform plants.

[0012] The present invention constructs a recombinant virus vector carrying CiPDS gene-specific fragments pTRV2-CiPDS , and by optimizing the virus sap rubbing inoculation method with Nicotiana benthamiana as the transitional host, efficient silencing of the CiPDS gene in Canna indica is achieved. The experimental results show that this method can significantly reduce CiPDSThe expression level of the gene (transcription level decreased by 59.58%), and induced obvious albino phenotypes (such as dot-shaped, strip-shaped or block-shaped albino) in the new leaves of Canna, which effectively verified the gene silencing effect. In addition, by optimizing the inoculation conditions (such as using rhizome seedlings as experimental materials and culturing at 18°C), the silencing efficiency can be further increased to 90%, which is significantly better than the traditional seed seedling inoculation method (the efficiency is only 50% at 25°C). The present invention establishes a virus-induced gene silencing (VIGS) technology system in Canna for the first time, breaking through the limitations of traditional heterologous transformation technology and solving the problem of lagging research on Canna flower organ development caused by the lack of efficient gene function verification tools. At the same time, by optimizing the temperature and inoculation material selection, the silencing stability and phenotypic observability are significantly improved, providing an innovative technical platform for gene function analysis and molecular breeding of Canna and other non-model ornamental plants. The present invention is simple to operate and has high stability, providing a reliable technical means for the study of gene function in Canna, and at the same time providing an important reference for the optimization of the virus-induced gene silencing (VIGS) system of other difficult-to-transform plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 Schematic diagram of the TRV vector structure; Figure 2 This is the flowchart of TRV virus gene silencing mediated by Nicotiana benthamiana; Figure 3 To detect the leaf albino phenotype caused by CiPDS gene silencing and the effect of gene silencing; Figure 4 To show the effects of culture temperature and seedling age on canna VIGS experiments. DETAILED DESCRIPTION

[0014] In order to further explain the present invention, it is described below in conjunction with the following specific embodiments.

[0015] Example 1 Construction of pTRV2 vector and CiPDS Gene silencing

[0016] 1. CiPDS Gene-specific fragment cloning Extraction of Total RNA from Canna Leaves Take fresh canna leaves (about 0.1 g) and grind them into powder in liquid nitrogen. For specific extraction steps, refer to the instructions of RNAprep Pure Plant Total RNA Extraction Kit (Tiangen). All pipette tips and centrifuge tubes used in the experiment are RNase-free. Mortars and other related glassware need to be baked at 180℃ for 4 h, plastic utensils need to be sterilized by high pressure for 30 min, and dried for later use.

[0017] Reverse transcription to synthesize first-strand cDNA Using the TransGen All-in-One First-Strand cDNA Synthesis SuperMix TransScript to synthesize the first strand of cDNA.

[0018] 1) Add the following reagents to a RNase-free centrifuge tube: 10 μL of reverse transcription premix (2× TS Reaction Mix), primer; 1 μL of 0.5 μg / μL (Anchored Oligo(dT) 18 Primer), 50 ng–5 μg of total RNA, 1 μL of genomic DNA remover (gDNA Remover), 1 μL of reverse transcriptase ( TransScript RT Enzyme Mix), and add RNase-free water to 20 μL.

[0019] 2) Mix gently, centrifuge briefly, and incubate at 42 °C for 30 min.

[0020] 3) Terminate the reaction by heating at 85 °C for 5 s.

[0021] (3) CiPDS Cloning of the gene Primer design: The target region for the VIGS silencing experiment is generally between 400-600 bp and is located in the CDS region of the gene. At the same time, specific fragments need to be used to avoid having more than 21 consecutive identical bp sequences with other genes. Design forward and reverse primers for the selected specific segment. In addition to meeting the requirements of conventional GC content, length, annealing temperature, etc., the primers need to introduce restriction enzyme sites and homologous recombination sequences (underlined) at the 5' end of the primers.

[0022] TRV-PDS-Xbal-F: AGGTTACCGAATTCT ATGGATATCATCGGGGCCAT TRV-PDS-Xbal-R: CCCCATGGAGGCCTT AAAATCTTTGCAGACAACCT Using the leaf cDNA as a template, amplify the CDS specific sequence of the target gene with Takara PrimeSTAR Max DNA Polymerase (R045A).

[0023] The PCR reaction system is: 2 μL of cDNA, 2 μL of forward primer, 2 μL of reverse primer, 25 μL of premix (2× PrimeSTARMax Premix), 19 μL of ultrapure water, and the total volume is 50 μL.

[0024] The reaction conditions are shown in Table 1 below: Table 1

[0025] (4)Purification of PCR products: Take a small amount of PCR products for agarose gel electrophoresis detection. If the amplified specific band is single, purify it using a common DNA product purification kit (Tiangen); if there are non-specific bands, the PCR products need to be gel-extracted and recovered using an agarose gel purification and recovery kit (Bomed). The specific operation details can be found in the instruction manual.

[0026] The concentration of the purified DNA is detected using a micro-spectrophotometer (Nanodrop) and agarose gel electrophoresis.

[0027] 2. Construction of VIGS gene silencing vector (1) pTRV2 Linearization of the vector: Add the following reagents to a 200 μL centrifuge tube: pTRV2 Less than 1 μg of plasmid, 1 μL of Xbal endonuclease (Takara), 5 μL of 10× buffer, and add ultrapure water to 50 μL.

[0028] Gently mix and centrifuge briefly. Incubate at 37°C for 10 min (no star activity will occur within 16 h). Check whether the digestion is complete by electrophoresis. Purify the digested products using a common DNA product purification kit (Tiangen). The concentration of the purified DNA is detected using Nanodrop and agarose gel electrophoresis.

[0029] (2)Use the Novoprotein One Step Cloning Kit (One Step Cloning Kit; C112) to construct a binary expression vector. The specific steps are as follows: 1) Calculate the amount of linearized vector (X) and insert fragment (Y) required for the recombination reaction according to the kit instruction manual.

[0030] 2) Prepare the following reaction system in an ice-water bath: linearized pTRV2 vector X μL, insert fragment Y μL, buffer (5× CE II Buffer) 4 μL, homologous recombinase (Exnase TM II) 2 μL, and add ultrapure water to 20 μL.

[0031] Use a pipette to blow and suck up and down several times to gently mix each component. Incubate at 37°C for 30 min. Immediately place the reaction tube in an ice-water bath after the reaction is completed and cool for 5 min. The recombinant products can be directly used for transformation experiments or stored at -20°C.

[0032] (3)Transformation of Escherichia coli: 1) Take out the competent Escherichia coli (JM109) from the -80°C refrigerator and place it on ice until it is semi-melted.

[0033] 2) Add 10 μL of the ligation product (2 μL of plasmid) to it, gently rotate the centrifuge tube to mix the contents, and let it stand in an ice bath for 30 min.

[0034] 3) Quickly transfer the centrifuge tube to a 42°C metal bath, heat shock for 60 s, and then quickly transfer the tube to an ice bath to cool the cells for 2 min. Do not shake the centrifuge tube during this process.

[0035] 4) Add 700 μL of sterile LB medium (without antibiotics) to the centrifuge tube, mix well, and place it at 37°C, 180 rpm, and shake culture for 60 min. The purpose is to express the relevant resistance marker genes on the plasmid and resuscitate the bacteria.

[0036] 5) Take out the centrifuge tube, centrifuge at low speed for 2 - 3 min to collect the bacteria. Pour out some of the medium, pipette and mix the remaining approximately 100 μL and add it to an LB solid medium plate containing the corresponding antibiotic. Use a sterile spreader to evenly spread the cells. After the liquid in the plate is completely absorbed, invert the plate and culture it at 37°C for 12 - 16 h.

[0037] (4)Identification of positive clones by colony PCR. The primer sequences are as follows: F206: 5’-GGATGACGCACAATCCCACTA-3’ R206: 5’-TTCACCCTCTCCACTGACAGA-3’ 3. Virus sap rubbing inoculation using Nicotiana benthamiana as a transient host (1)Transformation of Agrobacterium tumefaciens: 1) Take out the competent Agrobacterium tumefaciens (GV3101) stored at -80°C and melt it in ice water.

[0038] 2) Add 4 μL (about 500 ng) of the plasmid to the competent cells, gently mix, and incubate in an ice water bath for 20 min.

[0039] 3) Place the centrifuge tube in liquid nitrogen for 5 min for quick freezing.

[0040] 4) Incubate in a 37°C metal bath for 5 min, do not shake during this period, and quickly transfer to an ice water bath and let it stand for 5 min.

[0041] 5) Add 800 μL of LB liquid medium without antibiotics, and shake culture at 28°C, 180 rpm for 2 h.

[0042] 6) Centrifuge at 5000 rpm for 1 min to collect bacteria, pour off part of the upper culture medium, retain about 100 μL, gently pipette to resuspend, and spread on an LB plate containing the corresponding antibiotic. Incubate inverted at 28 °C for 2 - 3 days.

[0043] (2) Preparation of Agrobacterium: Take out the stored Agrobacterium from the -80 °C refrigerator and streak it on an LB solid plate (containing the corresponding antibiotic) for 2 - 3 days. Pick a single colony and inoculate it into 5 mL of Rif / Kan LB medium, and culture it with shaking at 28 °C for 24 h. Take 0.5 mL of the activated bacterial solution and inoculate it into 50 mL of Rif / Kan-resistant LB medium, and culture it with shaking at 28 °C for 12 - 16 h. Centrifuge at 4000 rpm at 4 °C for 10 min to collect bacteria, discard the supernatant, and resuspend the precipitated Agrobacterium with 10 mL of resuspension solution (10 mM MgCl2, 10 mM MES, 100 μM acetosyringone, pH 5.6) to make the OD600 about 2.0. Let it stand at room temperature for more than 3 h, and then mix the two kinds of Agrobacterium, TRV1 and TRV2-PDS, in equal proportions.

[0044] (3) Virus inoculation: Inject the Agrobacterium mixture containing the target fragment TRV into the leaves of Nicotiana benthamiana at the 8 - 10 leaf stage. Collect the injected leaves and 1 - 2 upper leaves of the injected leaves of the diseased Nicotiana benthamiana 6 - 12 days later, place them in a mortar, add phosphate buffer (20 mM, pH 7.0) according to a ratio of 1:1 (w / v), and then grind. After sufficient grinding, add celite to a final concentration of 1%. Before inoculation, spray carborundum on the leaves of Canna indica, and then inoculate Canna indica by rubbing with the obtained virus juice. After inoculation, spray and wash the leaves with clear water, cover them with plastic wrap, and culture them in the dark for 24 h and then transfer to normal culture.

[0045] 4. Detection of gene silencing efficiency Two weeks after virus inoculation, take the newly grown leaves of Canna indica and extract the total plant RNA using a kit method or Trizol method. Reverse transcribe the first strand of cDNA using random primers. Perform PCR reactions with the following primers. If a band of the corresponding length can be amplified, it indicates that the virus has been transported in the plant body and the inserted fragment has not been lost.

[0046] TRV2 Primers for positive clone detection: pTRV2-Up: 5’-TGGGAGATGATACGCTGTT-3’ pTRV2-Down: 5’-CCTAAAACTTCAGACACG-3’ After the gene silencing phenomenon occurs, plant materials from the experimental group and the control group are taken and the total plant RNA is extracted using the kit method. Oligo dT is used as a primer for reverse transcription to synthesize the first strand of cDNA. Then the same amount of reverse transcription products are taken and the kit is used for fluorescence quantitative qRT-PCR to compare the differences in the transcription levels of endogenous genes. The qRT-PCR primers are as follows: CiPDS-qPCR-F: 5'-ATTGTGAACCATGTCGCCCT-3' CiPDS-qPCR-R: 5'-TTTTCCCGACAAAACCGCAC-3' 5. Phenotypic Observation Using Nicotiana benthamiana as the transitional host and inoculating the virus juice into the leaves of Canna indica can achieve the effect of infection. CiPDS Fragmentary TRV The Agrobacterium mixture was injected into the leaves of Nicotiana benthamiana at the 8-10 leaf stage. After 6-12 days, the injected leaves and 1-2 leaves above the injected leaves of the diseased Nicotiana benthamiana were collected, ground thoroughly, and the obtained juice was rubbed to inoculate canna. Figure 3 As a result, it can be seen that 15 days after inoculation, yellow spots appeared on the new leaves of canna; 42 days later, the leaves showed partial bleaching ( Figure 3 Figure A and Figure 3 Total RNA was extracted from leaves at 12 dpi (inoculation days), 24 dpi, and 35 dpi using the trizol method and expressed as TRV2 Primers were designed based on the sequences at both ends of the vector insertion site and semi-quantitative RT-PCR was performed. The results showed that a band of the expected length was amplified in the sample at 24 dpi, but not at 12 dpi and 35 dpi ( Figure 3 In addition, the present invention also extracted total RNA from leaves at 15 dpi, 24 dpi, 47 dpi and normal leaves, and used OligodT as a primer to synthesize the first strand of cDNA. Design CiPDS Semi-quantitative RT-PCR experiments were performed using gene-specific RT-PCR primers (this amplified fragment avoids overlapping with the target fragment inserted in the vector). The results showed that at 15 dpi, 24 dpi, and 47 dpi PDS The gene expression is lower than that in normal leaves ( Figure 3 The results show that the virus juice friction inoculation method using Nicotiana benthamiana as the transitional host can effectively TRV It infects canna and can cause a decrease in the expression of endogenous PDS gene in canna.

[0047] Figure 3 Middle: Figure A is CiPDSGene silenced plants, L0: inoculated leaves, L1 and L2: upper leaves; Figure B is a close-up of leaf bleaching; Figures C and D are the results of semi-quantitative RT-PCR. Figure C is the amplification of viral gene fragments to show the spread of the virus in the plant; Figure D shows the CiPDS Decreased gene expression.

[0048] Example 2 Optimization of experimental conditions To investigate the effects of temperature and inoculum on the efficiency of virus-induced gene silencing (VIGS), the second to fourth leaves of 20 seed seedlings and 10 rhizome seedlings were tested at 18°C ​​and 25°C, respectively. TRV-PDS (carry CiPDS Gene fragments of the recombinant virus) infection, TRV-Mock (Empty vector control, the number of plants was halved) was used as a control. Observe the phenotypic changes of new leaves (1 to 2 leaves) 20 to 25 days after inoculation.

[0049] Phenotypic analysis results ( Figure 4 ) shows that TRV-Mock In the control group, new leaves of all rhizome seedlings showed typical yellow spot symptoms of TRV infection ( Figure 4 Only 10% of the seedlings showed slight yellow spots, indicating that the rootstock seedlings were more sensitive to TRV infection. TRV-PDS In the treatment group, 90% of the rhizome seedlings showed PDS Gene silencing-induced albinism phenotypes, including punctate albinism ( Figure 4 Figure A), stripe whitening ( Figure 4 B in Figure ), block whitening ( Figure 4 C in the figure) and severe whitening that prevents the leaves from unfolding properly ( Figure 4 Under 25℃, the incidence of albino phenotype dropped to 50%. In contrast, no obvious albino phenotype was observed in seedlings at either temperature. TRV-PDS The treated rhizome seedlings were verified and the results showed CiPDS Gene transcription level decreased by 59.58% ( Figure 4 The comprehensive experimental results showed that rhizome seedlings were more suitable for canna VIGS experiments than seed seedlings, and had higher gene silencing efficiency under 18℃ culture conditions.

[0050] Figure 4 Middle: Figures A to D show inoculation of rhizome seedlings TRV2-PDS Then different degrees of albino phenotypes were produced; Figure E shows the root seedlings TRV2-MockProcessing the virus-infected macula; Figure F shows the probability diagram of corresponding phenotypes under different combinations of culture temperature and seedling age; Figure G shows TRV2-PDS Canna after inoculation CiPDS The decrease in the expression level of the gene, and the error bars represent the standard deviation.

[0051] The above embodiments are only illustrative of the principles and effects of the present invention, and are not intended to limit the present invention. Any person familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. A method for establishing a TRV virus-induced endogenous gene silencing expression system in canna, characterized in that, It includes the following steps: (1)Extract the target gene from Canna indica CiPDS Specific fragments, design primers to amplify the CDS region of 400 - 600 bp, and introduce restriction enzyme cleavage sites and homologous recombination sequences at the 5' end of the primers; (2) Connect the gene fragment obtained in step (1) to the linearized pTRV2 vector through homologous recombination to construct a recombinant viral vector pTRV2-CiPDS ; (3) Transform the recombinant viral vector into Agrobacterium tumefaciens GV3101, mix it with the helper vector TRV1 Agrobacterium tumefaciens in equal proportion and inject it into the leaves of Nicotiana benthamiana, and collect the virus sap after culturing for 6-12 days; (4) Rub the viral sap onto the canna leaves and culture them at 18 °C to induce the silencing of the target gene; (5) Verify the gene silencing efficiency through phenotypic observation and qRT-PCR.

2. The method for establishing a TRV virus-induced endogenous gene silencing expression system in canna according to claim 1, characterized in that, The said CiPDS The coding region sequence of the gene is 804 bp and encodes 268 amino acids in total; The said CiPDS The full-length nucleotide sequence of the gene coding region is shown in SEQ ID NO.

1.

3. The method for establishing a TRV virus-induced canna endogenous gene silencing expression system according to claim 1, wherein 1% diatomaceous earth is added as an abrasive before inoculating the viral sap.

4. Use of the method according to any one of claims 1 to 3 in the study of canna gene functions or variety improvement.

Images