Application of recombinant saccharomyces cerevisiae to production of homoeriodictyol 7-O-glucoside by using glucose

Abstract

The invention relates to the field of bioengineering, in particular to application of recombinant saccharomyces cerevisiae to production of homoeriodictyol 7-O-glucoside by using glucose. The invention provides an application of an integration site as a target spot in preparation of homoeriodictyol 7-O-glucoside. And the integration sites comprise one or more of PDC5, TKL2-TEF2, YHRCdelta14, YORWdelta17, ARO10, YNRCdelta9, YERCdelta8, HO, YMRWdelta15, YARCdelta8 and YCRWdelta12, and the integration sites comprise one or more of the following components: the PDC5, the TKL2-TEF2, the YHRCdelta14, the YORWdelta17, the ARO10, the YNRCdelta9, the YERCdelta8, the HO, the YMRWdelta15, the YARCdelta8 and the YCRWdelta12. According to the invention, the de novo synthesis of homoeriodictyol 7-O-glucoside is realized by constructing a heterologous synthesis pathway in saccharomyces cerevisiae, screening key glycosyl transferase, knocking out endogenous glycoside hydrolase, regulating NADPH (nicotinamide adenine dinucleotide phosphate) and a UDP-glucose regeneration pathway, and optimizing cell growth and fermentation strategies.

Description

[0001] This application claims priority to a Chinese patent application filed with the Patent Office of China on September 10, 2024, with application number 2024112670421 and invention name “Application of recombinant brewer's yeast in producing homoeriocarbamate 7-O-glucoside using glucose”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] The present invention relates to the field of bioengineering, and in particular to the application of recombinant saccharomyces cerevisiae in producing homoeriodictyol 7-O-glucoside by utilizing glucose. Background Art

[0003] Flavonoids are aromatic natural compounds with important biological activities, including anticancer, anti-inflammatory, and antiviral properties. Flavonoid glycosides exhibit enhanced biological activities, such as anti-HIV activity and tyrosinase inhibition. Flavonoid glycosides also possess enhanced solubility, bioavailability, and reduced cytotoxicity. Homoeriodictyol 7-O-glucoside, a product of flavonoid glycoside glucoside at the 7-hydroxyl group of homoeriodictyol, not only possesses the inherent value of flavonoid glycosides but also has bitterness-masking properties and is widely used in the food and pharmaceutical industries. Therefore, developing sustainable access to homoeriodictyol 7-O-glucoside is crucial. Traditional methods primarily include chemical synthesis and plant extraction. However, the seasonality and limited availability of plants hinder the commercialization of plant extraction methods, while the use of toxic reagents and extreme reaction conditions make chemical synthesis methods unsafe and unsustainable. Therefore, biosynthesis of homoeriodictyol 7-O-glucoside offers the advantages of a short process cycle, high efficiency, and environmental friendliness, making it a promising production method.

[0004] The biosynthetic pathway for homoeriodictyol 7-O-glucoside remains largely unexplored, but the biosynthetic pathway for its key precursor, homoeriodictyol, has been extensively studied. Based on existing research, the Saccharomyces cerevisiae cell factory is capable of synthesizing homoeriodictyol from p-coumaric acid. This pathway primarily involves the 4-p-coumaryl-CoA ligase 4CL from parsley, the chalcone synthase CHS from petunia, the chalcone isomerase CHI from alfalfa, the flavonoid 3'-monooxygenase F3'H and cytochrome P450 reductase ATR1 from Arabidopsis thaliana, and the 3'-O-methyltransferase ROMT-9 from rice. Using metabolic engineering strategies and the rational design and modification of enzymes, homoeriodictyol has been produced at titers of 1.0 mmol / l in shake flask fermentation. For the de novo synthesis of homoeriodictyol, existing technology has constructed a de novo synthesis route using ferulic acid as an intermediate in an Escherichia coli cell factory. The pathway contains 4CL from grapes, CHS from Arabidopsis thaliana, and CHI from Arabidopsis thaliana. This technology did not optimize the cell factory and used glycerol as the carbon source to obtain a homoeriodictyol titer of 17 mg / L. Summary of the Invention

[0005] In light of this, the present invention provides the use of recombinant Saccharomyces cerevisiae to produce homoeriodictyol 7-O-glucoside from glucose. This invention achieves de novo synthesis of homoeriodictyol 7-O-glucoside by constructing a heterologous synthesis pathway in Saccharomyces cerevisiae, screening for key glycosyltransferases, deleting endogenous glycoside hydrolases, regulating NADPH and UDP-glucose regeneration pathways, and optimizing cell growth and fermentation strategies.

[0006] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0007] The present invention provides the use of an integration site as a target in the preparation of homoeriodictyol 7-O-glucoside;

[0008] The integration sites include: one or more of: PDC5 site, TKL2-TEF2 site, YHRCdelta14 site, YORWdelta17 site, ARO10 site, YNRCdelta9 site, YERCdelta8 site, HO site, YMRWdelta15 site, YARCdelta8 site and YCRWdelta12 site.

[0009] In some embodiments of the present invention, in the above application, the sequence of the PDC5 site is shown in SEQ ID NO: 24:

[0010] In some embodiments of the present invention, in the above application, the sequence of the TKL2-TEF2 site is as shown in SEQ ID NO: 25: aacatcaatcatgcggttgc.

[0011] In some embodiments of the present invention, in the above application, the sequence of the YHRCdelta14 site is shown in SEQ ID NO: 26:

[0012] In some embodiments of the present invention, in the above application, the sequence of the YORWdelta17 site is shown in SEQ ID NO: 27:

[0013]

[0014] In some embodiments of the present invention, in the above application, the sequence of the ARO10 site is shown in SEQ ID NO: 28:

[0015] In some embodiments of the present invention, in the above application, the sequence of the YNRCdelta9 site is as shown in SEQ ID NO: 29: ggaatctacgaaaggggcccgatacttctatataatatatttttatttctccttcaattttatacgttgtcattccttatcctattacttcatcaattctt gcaattcaacatccaataactttgataactgtttcccatcaattatgtcgtcattttacactgtatatgatacaagtagtatgagtacacaccaatag atgattaattttttc.

[0016] In some embodiments of the present invention, in the above application, the sequence of the YERCdelta8 site is shown in SEQ ID NO: 30:

[0017] In some embodiments of the present invention, in the above application, the sequence of the HO site is shown in SEQ ID NO: 31:

[0018] In some embodiments of the present invention, in the above application, the sequence of the YMRWdelta15 site is shown in SEQ ID NO: 32:

[0019] In some embodiments of the present invention, in the above application, the sequence of the YARCdelta8 site is shown in SEQ ID NO: 33:

[0020] In some embodiments of the present invention, in the above application, the sequence of the YCRWdelta12 site is shown in SEQ ID NO: 34:

[0021] The present invention also provides the use of expressed genes and / or knocked-out genes in the preparation of homoeriodictyol 7-O-glucoside;

[0022] The expressed genes include: exogenous expressed genes and / or endogenous expressed genes;

[0023] The exogenous expression genes include: TAL gene, PAL gene, C4H gene, ATR2 gene, aroL gene, PDH1 gene, ROMT-9 N135T / I324M one or more of gene, MTHFR gene, UGT73C6 gene, 4CL gene and VHb gene;

[0024] The endogenous expression genes include: CYB5 gene, ARO4 K229L Gene, ARO7 G141S one or more of gene, MET6 gene, SAH1 gene, ADO1 gene, MET13 gene, GND1 gene, Pos5Δ17 gene, PGM1 gene and UGP1 gene;

[0025] The knockout genes include: EXG1 gene and / or HUT1 gene.

[0026] In some embodiments of the present invention, in the above applications, the TAL gene has:

[0027] (1), the nucleotide sequence shown in SEQ ID NO: 1; or

[0028] (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or

[0029] (3) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (1) or (2); or

[0030] The PAL gene has:

[0031] (4) the nucleotide sequence shown in SEQ ID NO: 2; or

[0032] (5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases of the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or

[0033] (6) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (4) or (5); or

[0034] The C4H gene has:

[0035] (7) the nucleotide sequence shown in SEQ ID NO: 3; or

[0036] (8) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or

[0037] (9) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (7) or (8); or

[0038] The ATR2 gene has:

[0039] (10), the nucleotide sequence shown in SEQ ID NO: 4; or

[0040] (11) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (10), and having the same or similar function as the nucleotide sequence shown in (10); or

[0041] (12) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (10) or (11); or

[0042] The CYB5 gene has:

[0043] (13), the nucleotide sequence shown in SEQ ID NO: 5; or

[0044] (14) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (13), and having the same or similar function as the nucleotide sequence shown in (13); or

[0045] (15) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (13) or (14); or

[0046] The ARO4 K229L Genes have:

[0047] (16), the nucleotide sequence shown in SEQ ID NO: 6; or

[0048] (17) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (16), and having the same or similar function as the nucleotide sequence shown in (16); or

[0049] (18), a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (16) or (17); or

[0050] The ARO7 G141S Genes have:

[0051] (19), the nucleotide sequence shown in SEQ ID NO: 7; or

[0052] (20) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (19), and having the same or similar function as the nucleotide sequence shown in (19); or

[0053] (21), a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (19) or (20); or

[0054] The aroL gene has:

[0055] (22), the nucleotide sequence shown in SEQ ID NO: 8; or

[0056] (23) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (22), and having the same or similar function as the nucleotide sequence shown in (22); or

[0057] (24), a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (22) or (23); or

[0058] The PDH1 gene has:

[0059] (25), the nucleotide sequence shown in SEQ ID NO: 9; or

[0060] (26) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (25), and having the same or similar function as the nucleotide sequence shown in (25); or

[0061] (27) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (25) or (26);

[0062] The UGT73C6 gene has:

[0063] (28), the nucleotide sequence shown in SEQ ID NO: 10; or

[0064] (29) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (28), and having the same or similar function as the nucleotide sequence shown in (28); or

[0065] (30) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (28) or (29);

[0066] The GND1 gene has:

[0067] (31), the nucleotide sequence shown in SEQ ID NO: 11; or

[0068] (32) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (31), and having the same or similar function as the nucleotide sequence shown in (31); or

[0069] (33) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (31) or (32);

[0070] The Pos5Δ17 gene has:

[0071] (34), the nucleotide sequence shown in SEQ ID NO: 12; or

[0072] (35) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (34), and having the same or similar function as the nucleotide sequence shown in (34); or

[0073] (36) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (34) or (35);

[0074] The PGM1 gene has:

[0075] (37), the nucleotide sequence shown in SEQ ID NO: 13; or

[0076] (38) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (37), and having the same or similar function as the nucleotide sequence shown in (37); or

[0077] (39) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (37) or (38);

[0078] The UGP1 gene has:

[0079] (40), the nucleotide sequence shown in SEQ ID NO: 14; or

[0080] (41) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (40), and having the same or similar function as the nucleotide sequence shown in (40); or

[0081] (42) a nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (40) or (41);

[0082] The VHb gene has:

[0083] (43), the nucleotide sequence shown in SEQ ID NO: 15; or

[0084] (44) A nucleotide sequence obtained by replacing, deleting or adding one or more bases of the nucleotide sequence shown in (43), and having the same or similar function as the nucleotide sequence shown in (43); or

[0085] (45) A nucleotide sequence that is at least 80% identical to the nucleotide sequence shown in (43) or (44).

[0086] In some embodiments of the present invention, in the above application, the sequence of the TAL gene is as shown in SEQ ID NO: 1:

[0087] In some embodiments of the present invention, in the above application, the sequence of the PAL gene is shown in SEQ ID NO: 2:

[0088]

[0089] In some embodiments of the present invention, in the above application, the sequence of the C4H gene is shown in SEQ ID NO: 3:

[0090]

[0091] In some embodiments of the present invention, in the above application, the sequence of the ATR2 gene is shown in SEQ ID NO: 4:

[0092]

[0093] In some embodiments of the present invention, in the above application, the sequence of the CYB5 gene is shown in SEQ ID NO: 5:

[0094] In some embodiments of the present invention, the ARO4 K229L The sequence of the gene is shown in SEQ ID NO:6:

[0095]

[0096] In some embodiments of the present invention, the above application, the ARO7 G141S The sequence of the gene is shown in SEQ ID NO:7:

[0097] In some embodiments of the present invention, in the above application, the sequence of the aroL gene is shown in SEQ ID NO: 8:

[0098] In some embodiments of the present invention, in the above application, the sequence of the PDH1 gene is shown in SEQ ID NO: 9:

[0099]

[0100] In some embodiments of the present invention, in the above applications, the sequence of the UGT73C6 gene is shown in SEQ ID NO: 10:

[0101] In some embodiments of the present invention, in the above application, the sequence of the GND1 gene is shown in SEQ ID NO: 11:

[0102] In some embodiments of the present invention, in the above application, the sequence of the Pos5Δ17 gene is shown in SEQ ID NO: 12:

[0103]

[0104] In some embodiments of the present invention, in the above application, the sequence of the PGM1 gene is shown in SEQ ID NO: 13:

[0105] In some embodiments of the present invention, in the above application, the sequence of the UGP1 gene is shown in SEQ ID NO: 14:

[0106] In some embodiments of the present invention, in the above application, the sequence of the VHb gene is shown in SEQ ID NO: 15:

[0107] In some embodiments of the present invention, in the above application, the sequence of the EXG1 gene is shown in SEQ ID NO: 35:

[0108]

[0109] In some embodiments of the present invention, in the above application, the sequence of the HUT1 gene is shown in SEQ ID NO: 36:

[0110] The present invention also provides an expression module, comprising: one or more of the first expression module to the fourteenth expression module, and the fifteenth expression module to the twenty-third expression module;

[0111] The first expression module includes: the TAL gene used above;

[0112] The second expression module includes: the PAL gene used above;

[0113] The third expression module includes: the C4H gene used above;

[0114] The fourth expression module includes: the ATR2 gene used above;

[0115] The fifth expression module includes: the CYB5 gene used above;

[0116] The sixth expression module includes: the ARO4 K229L Gene;

[0117] The seventh expression module includes: the ARO7 of the above application G141S Gene;

[0118] The eighth expression module includes: the aroL gene used above;

[0119] The ninth expression module includes: the PDH1 gene used above;

[0120] The tenth expression module includes: the ROMT-9 of the above application N135T / I324M Gene;

[0121] The eleventh expression module includes: the MET6 gene used above;

[0122] The twelfth expression module includes: the SAH1 gene used above;

[0123] The thirteenth expression module includes: the ADO1 gene used above;

[0124] The fourteenth expression module includes: the MET13 gene and the MTHFR gene used above;

[0125] The fifteenth expression module includes: the UGT73C6 gene used above;

[0126] The sixteenth expression module includes: the EXG1 gene used above;

[0127] The seventeenth expression module includes: the 4CL gene used above;

[0128] The eighteenth expression module includes: the GND1 gene used above;

[0129] The nineteenth expression module includes: the Pos5Δ17 gene used above;

[0130] The twentieth expression module includes: the HUT1 gene of the above application;

[0131] The twenty-first expression module includes: the PGM1 gene used above;

[0132] The twenty-second expression module includes: the UGP1 gene used above;

[0133] The twenty-third expression module includes: the VHb gene used above.

[0134] In some embodiments of the present invention, the above-mentioned expression module further comprises: a promoter and a terminator;

[0135] The promoter includes: TEF1 、P GPM1 、P TPI1 and P TDH3 One or more of;

[0136] The terminator includes: ADH1 、T TEF2 、T CPS1 and T PGK1 One or more of .

[0137] In some embodiments of the present invention, in the above expression module, the P TEF1 The sequence is shown in SEQ ID NO: 16:

[0138] In some embodiments of the present invention, in the above expression module, the P GPM1 The sequence is shown in SEQ ID NO: 17:

[0139] In some embodiments of the present invention, in the above expression module, the P TPI1 The sequence is shown in SEQ ID NO: 18:

[0140]

[0141] In some embodiments of the present invention, in the above expression module, the P TDH3 The sequence is shown in SEQ ID NO: 19:

[0142] In some embodiments of the present invention, in the above expression module, the T ADH1 The sequence is shown in SEQ ID NO: 20:

[0143] In some embodiments of the present invention, in the above expression module, the T TEF2 The sequence is shown in SEQ ID NO: 21:

[0144] In some embodiments of the present invention, in the above expression module, the T CPS1 The sequence is shown in SEQ ID NO: 22:

[0145] In some embodiments of the present invention, in the above expression module, the T PGK1 The sequence is shown in SEQ ID NO: 23:

[0146] In some embodiments of the present invention, in the above expression modules, the first expression module is expressed at the above PDC5 site;

[0147] The second expression module, the third expression module, the fourth expression module and the fifth expression module are expressed at the TKL2-TEF2 site;

[0148] The sixth expression module and the seventh expression module are expressed at the YHRCdelta14 site;

[0149] The eighth expression module and the ninth expression module are expressed at the YORWdelta17 site;

[0150] The tenth expression module is expressed at the ARO10 site and the HO site;

[0151] The eleventh expression module, the twelfth expression module, the thirteenth expression module and the fourteenth expression module are expressed at the YNRCdelta9 site;

[0152] The fifteenth expression module is expressed at the YERCdelta8 site;

[0153] The seventeenth expression module is expressed at the HO site;

[0154] The eighteenth expression module and the nineteenth expression module are expressed at the YMRWdelta15 site;

[0155] The twenty-first expression module and the twenty-second expression module are expressed at the YARCdelta8 site;

[0156] The twenty-third expression module is expressed at the YCRWdelta12 site.

[0157] The present invention also provides a strain, into which the above-mentioned expression module is introduced.

[0158] The present invention also provides the use of the above expression module and / or the above strain in the preparation of homoeriodictyol 7-O-glucoside.

[0159] The present invention also provides a method for preparing homoeriodictyol 7-O-glucoside, which comprises inoculating and culturing the above-mentioned strain to obtain the homoeriodictyol 7-O-glucoside.

[0160] The beneficial effects of the present invention include:

[0161] (1) The present invention realizes the biosynthesis of homoeriodictyol 7-O-glucoside for the first time.

[0162] (2) The present invention screened out a glycosyltransferase that can act on the 7-hydroxyl group glycosidation of homoeriodictyol.

[0163] (3) The present invention achieves the highest titer of de novo synthesis of homoeriocarbamate 7-O-glucoside. BRIEF DESCRIPTION OF THE DRAWINGS

[0164] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for describing the embodiments or the prior art.

[0165] Figure 1 The pathway for the de novo synthesis of homoeriodictyol 7-O-glucoside was shown;

[0166] Figure 2 The results showed that the yield of eriodictyol was improved;

[0167] Figure 3 The results showed that the yield of eriodictyol was improved;

[0168] Figure 4 Effects of different glycosyltransferases on the yield of homoeriodictyol 7-O-glucoside

[0169] Figure 5 The results showed that glycosyltransferases were introduced, glycoside hydrolysis genes were knocked out, and rate-limiting enzymes were overexpressed;

[0170] Figure 6It is shown that NADPH regeneration is regulated to eliminate the accumulation of intermediates;

[0171] Figure 7 The results showed that the production of homoeriodictyol 7-O-glucoside could be increased by regulating UDP-glucose regeneration and cell growth.

[0172] Figure 8 The fermentation results of strain YHG026 are shown. DETAILED DESCRIPTION

[0173] The invention discloses the application of recombinant saccharomyces cerevisiae in producing homoeriodictyol 7-O-glucoside by utilizing glucose.

[0174] It should be understood that the expression "one or more of" includes individually each of the items recited after the expression and various combinations of two or more of the recited items, unless otherwise apparent from the context and usage. The expression "and / or" in conjunction with three or more recited items should be understood to have the same meaning, unless otherwise apparent from the context.

[0175] The terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, e.g., not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0176] It should be understood that the order of steps or the order in which certain actions are performed are not important as long as the present invention remains operable. Additionally, two or more steps or actions may be performed simultaneously.

[0177] The use of any and all examples or exemplary language, such as "such as" or "including," herein is intended merely to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating any non-claimed element as essential to the practice of the invention.

[0178] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant numerical values ​​in the specific examples have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual testing methods. Therefore, unless otherwise expressly stated, all ranges, amounts, values, and percentages used in this disclosure should be understood to be modified by the word "about." As used herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specified value or range.

[0179] Example of ROMT-9 N135T / I324M Methods for integrating genes into the ARO10 site of the yeast genome: mainly using CRISPR and homologous recombination technology.

[0180] First build ROMT-9 N135T / I324M Gene expression cassette: P TPI1 -ROMT-9 N135T / I324M -T CPS1 .

[0181] Promoter P TPI1 Using the yeast genome as a template, amplification was performed using the following primers: tatatctaggaacccatcaggt (shown in SEQ ID NO: 37) and ttttagtttatgtatgtgttttttgtagt (shown in SEQ ID NO: 38). For the top primer, a 17-30 bp primer was selected 5' to the promoter sequence, with an annealing temperature (Tm) between 52-55°C. For the bottom primer, a primer was selected 3' to the promoter sequence, with the same length and Tm as for the top primer, but the Tm difference between the top and bottom primers should not exceed 5°C.

[0182] ROMT-9 N135T / I324M The gene (synthesized by Qingke Biotechnology Co., Ltd.) was amplified using primers aaacacatacataaactaaaaGCATGG GTTCTACAGCAGCA (shown in SEQ ID NO: 39) and CTTGGGCTATTGAATTCACTAAGT AAGCgcgcaatgattgaatagtc (shown in SEQ ID NO: 40). N135T / I324M The 5' ends of the upper and lower primers contain 20bp regions homologous to the promoter and terminator, respectively. Gene amplification primers are composed of two parts: one homologous to the gene, and the other homologous to the promoter or terminator element. The principles for selecting the homologous portion of the gene are the same as those for promoter amplification primers. After selection, add 20-30bp of homology to the downstream end of the promoter (the Tm value of this portion is above 50°C) to the 5' end of the gene upper primer, and add 20-30bp of homology to the upstream end of the terminator (the Tm value of this portion is above 50°C) to the 5' end of the gene lower primer.

[0183] Terminator T CPS1 Using the yeast genome as a template, amplification was performed using the primers gcgcaatgattgaatagtcaaa (shown in SEQ ID NO: 41) and agaataggtttcgttttctggaa (shown in SEQ ID NO: 42). The selection of primers for terminator amplification was the same as that for promoter amplification.

[0184] The three amplified fragments were subjected to overlap PCR to obtain ROMT-9 N135T / I324M expression cassette.

[0185] Next, the yeast genome was used as a template to amplify the linker fragment used for homologous recombination.

[0186] Linker1-1 was selected 400 bp upstream of the genomic insertion site. Amplification primer selection principles are consistent with the promoter selection principles described above. Note that the 5' end of the down primer of Linker1-1 requires 20-30 bp of homology to the upstream end of the promoter (this portion has a Tm value above 50°C). Linker1-1 was amplified using primers CATTGGTAGTAGGCT TAGGC (as shown in SEQ ID NO:43) and AGATAACAAAGAAACTCCCTTAAGCtcttgcccatcag attgatg (as shown in SEQ ID NO:44). The down primer contains 20 bp of homology to the promoter.

[0187] Linker2-1 was selected 400 bp downstream of the genomic insertion site. Amplification primer selection principles are consistent with those for promoter selection described above. Note that the 5' end of the upper primer of Linker2-1 should contain 20-30 bp of homology to the downstream end of the terminator (this portion has a Tm value above 50°C). Linker2-1 was amplified using primers aagaataggtttcgttttctggaaCT TGTGGGCGCAATTATAAAAC (as shown in SEQ ID NO:45) and GCAGACATTTAGCAGATG TAGG (as shown in SEQ ID NO:46). The upper primer contains 20 bp of homology to the terminator.

[0188] Linker1-1 was overlapped with the promoter fragment, and linker2-1 was overlapped with the terminator fragment to obtain linker1 and linker2, respectively.

[0189] Next, search for the first 20 bp of the PAM sequence (NGG) at the ARO10 locus as a guide RNA. Search the target insertion site on https: / / yeastgenome.org / to obtain the insertion site sequence. To select the insertion site, enter the insertion site sequence into the "Target asequence" field at https: / / www.atum.bio / eCommerce / cas9 / input, select "Saccharomyces cerevisiae" for species, "NGG" for PAM, and "Wild-type Cas9" for Iwant. Once all settings are complete, select search and select the highest-scoring guide RNA sequence from the results.

[0190] In this case, the gRNA is: CGCTTGCTCGTAGCCTACT (as shown in SEQ ID NO: 47). Next, the CRISPR-gRNA-Cas9-his plasmid was combined with ROMT-9 N135T / I324M The expression cassette, linker1, and linker2 were transformed into yeast, spread on yeast basal medium (SC-his), and cultured for 3-4 days to obtain a recombinant yeast strain. The first pair of verification primers were found upstream of the insertion site and gene, and the length of verification interface 1 was about 1000bp. The second pair of verification primers were found downstream of the insertion site and gene, and the length of verification interface 2 was about 1000bp. The verification primers were selected by selecting a 20-30bp verification primer (Tm value at 52-55°C) about 100bp upstream of linker1-1 as the upper primer of the first pair of verification primers. The lower primer of the first pair of verification primers was selected in the upstream part of the inserted gene fragment, and the length and Tm value were consistent with the above. Note that the sequence length between this pair of primers is about 1000-2000bp. A 20-30bp verification primer (Tm value at 52-55°C) was selected about 100bp downstream of linker2-1 as the lower primer of the second pair of verification primers. The upper primers of the second pair of verification primers are selected in the downstream part of the inserted gene fragment, and the length and Tm value are consistent with the above. Note that the sequence length between this pair of primers is about 1000-2000bp.

[0191] The first pair of verification primers in this example are: ACACCTCATGTAGCTTCCTTATTAA (as shown in SEQ ID NO: 48), TGCTGCTGTAGAACCCAT (as shown in SEQ ID NO: 49). The second pair of verification primers are: GAGA GAATTCAGAGAATTGGCT (as shown in SEQ ID NO: 50), CTTTGTTAGAGCCAATGATT TCG (as shown in SEQ ID NO: 51).

[0192] The linker sequence selection criteria in the present invention are: for genome-integrated genes, the linker selects fragments 400 bp upstream and downstream of the site; for knocked-out genes, the linker selects fragments 400 bp upstream and downstream of the knocked-out gene.

[0193] According to the above method, ROMT-9 N135T / I324M The gene was integrated into the ARO10 locus of the yeast genome.

[0194] The integration of the expression cassette into the gene locus in Examples 1 to 7 of the present invention is the same as the above method, except that the elements in the expression cassette are replaced.

[0195] The selection method for linker1 and linker2 for gene knockout is to use the upstream and downstream 400bp of the gene as linker1 and linker2 respectively. The design principle of the amplification primers is that the selection method for the upper primer of linker1 and the upper and lower primers of linker2 are consistent with the primer selection method of the promoter above. It should be noted that the lower primer of linker1 is divided into two parts, one part is homologous to linker1, and the other part is homologous to linker2. Specifically, the part homologous to linker1 is selected according to the selection method of the promoter amplification primer, and a 20-30bp sequence (the Tm value of this part is above 50°C) with homology to the upstream front end of linker2 is added to the 5' end of the part. After PCR amplification of the two linkers, linker1 and linker2 are overlap PCR. Used as a fragment for gene knockout.

[0196] The primers for gene knockout verification are selected as follows: a 20-30bp primer approximately 100bp upstream of linker 1 (Tm value 52-55°C); and a 20-30bp primer approximately 100bp downstream of linker 2 (Tm value 52-55°C). Therefore, if the gene is not knocked out, the fragment amplified by these two primers will be 1000bp + the gene length; if it is knocked out, the amplified length will be approximately 1000bp.

[0197] The gene knockout in Examples 1 to 7 of the present invention is the same as the above-mentioned method.

[0198] In Examples 1 to 7 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0199] The present invention will be further described below in conjunction with the embodiments:

[0200] Example 1

[0201] The present invention first achieves the de novo synthesis of homoeriodictyol. First, a pathway for synthesizing p-coumaric acid from tyrosine and phenylalanine is constructed in the Yeri001 strain (derived from patent application number: 202310747742.X), which can produce homoeriodictyol in previous research. The specific method is as follows:

[0202] The expression cassette of tyrosine ammonia lyase TAL from Flavobacterium johnsonii (including promoter P TEF1 -TAL gene-terminator T ADH1 ) was integrated into the genomic locus PDC5 of Yeri001 (i.e., the entire PDC5 gene was deleted) to obtain the YTAL001 strain, and then the phenylalanine ammonia lyase PAL (including: PAL) from Arabidopsis thaliana was TEF1 -PAL gene-terminator T ADH1 ), trans-cinnamate 4-monooxygenase C4H (including: promoter P GPM1 -C4H gene-terminator T TEF2 ), cytochrome P450 reductase 2ATR2 (including: promoter P TPI1 -ATR2 gene-terminator T CPS1 ), an expression cassette of cytochrome b5 from Saccharomyces cerevisiae (including promoter P TDH3 -CYB5 gene-terminator T PGK1 ) was integrated between the genomic loci TKL2 and TEF2 to obtain the YTP001 strain.

[0203] Example 2

[0204] This example strengthens the de novo synthesis of eriodictyol and optimizes the shikimate pathway of the above recombinant strain. K229L Expression cassette (including promoter P GPM1 -ARO4 K229L Gene-Terminator T TEF2 ) and the feedback-insensitive mutant ARO7 of chorismate mutase G141S Expression cassette (including promoter P TPI1 -ARO7 G141S Gene-Terminator T CPS1 ) was integrated into the genomic site YHRCdelta14 (i.e., the entire sequence of this site was deleted) to release the feedback inhibition and obtain the YTP002 strain. Then, the expression cassette of the shikimate kinase aroL from Escherichia coli (including: promoter P TDH3 -aroL gene-terminator T PGK1 ) and an expression cassette of prephenate dehydrogenase PDH1 from Medicago truncatula (including: promoter P GPM1 -PDH1 gene-terminator TTEF2 ) was integrated into the genomic site YORWdelta17 (i.e., the entire sequence of this site was deleted) to strengthen the rate-limiting step in the shikimate pathway to obtain the YTP004 strain.

[0205] Table 1

[0206] strain Eriodictyol production YTAL001 15.2mg / L YTP001 110.0mg / L YTP002 130.8mg / L YTP004 209.2mg / L

[0207] The data in Table 1 correspond to Figure 2 .

[0208] Example 3

[0209] After strengthening the synthesis pathway of eriodictyol, ROMT-9 was integrated into the genomic site ARO10 of the above strain (i.e., the entire sequence of the site was deleted). N135T / I324M Expression cassette (including promoter P TPI1 -ROMT-9 N135T / I324M Gene-Terminator T CPS1 ), the YTP007 strain was obtained, and the yeast endogenous gene homocysteine ​​S-methyltransferase MET6 (including promoter P) was integrated into the YNRCdelta9 site (i.e., the entire sequence of the site was deleted). TPI1 -MET6 gene-terminator T CPS1 ), S-adenosyl-l-cysteine ​​hydrolase SAH1 (including: promoter P GPM1 -SAH1 gene-terminator T TEF2 ), adenosine kinase ADO1 (including: promoter P TEF1 -ADO1 gene-terminator T ADH1 ), methylenetetrahydrofolate reductase MET13 and a chimeric expression cassette of methylenetetrahydrofolate reductase MTHFR from Arabidopsis thaliana (including: promoter P TDH3 -MET13 gene-MTHFR gene-terminator T PGK1 ) to obtain strain YTP008. The above steps achieved the construction of a de novo synthesis pathway for homoeriodictyol.

[0210] Table 2

[0211] strain p-Coumaric acid production Eriodictyol production High eriodictyol production YTP007 10.6mg / L 35.9mg / L 137.6mg / L YTP008 35.5mg / L 6.6mg / L 174.0mg / L

[0212] The data in Table 2 correspond to Figure 3 .

[0213] Example 4

[0214] First, we screened for glycosyltransferases. The glycosyltransferases screened included DicGT4 from Carnation, AtGT2, UGT73C6, and UGT73B2 from Arabidopsis thaliana, and NtGT2 from Nicotiana tabacum. Expression cassettes for these genes (promoter PTEF1, terminator TADH1) were transformed into strain YTP008. The cells were fermented in YPD medium for 48 hours, and the yields of homoeriodictyol 7-O-glucoside were compared. The results are as follows:

[0215] Table 3

[0216] Glycosyltransferase Yield of homoeriodictyol 7-O-glucoside (mg / L) DicGT4 19.7 AtGT2 68.4 NtGT2 80.7 UGT73C6 82.4 UGT73B2 98.2

[0217] The data in Table 3 correspond to Figure 4 .

[0218] Next, in order to utilize an effective glycosyltransferase to realize the synthesis of homoeriodictyol 7-O-glucoside, the expression cassette of the glycosyltransferase UGT73C6 from Arabidopsis thaliana (including: promoter P TEF1 -UGT73C6 gene-terminator T ADH1 ) was integrated into the genomic site YERCdelta8 of the above-mentioned recombinant strain (i.e., the entire sequence of the site was deleted) to obtain the YHG001 strain. In order to achieve efficient accumulation of homoeriocarbamate 7-O-glucoside, the endogenous yeast glucosidase EXG1 (accession number: SGD: S000004291) was knocked out to obtain the YHG005 strain. And overexpressed the key rate-limiting enzyme 4CL in the entire pathway (derived from patent application number: 202310747742.X, including: promoter P TPI1 -4CL gene-terminator T CPS1 ), ROMT-9 N135T / I324M (derived from patent application number: 202310747742.X, including: promoter P TPI1 -ROMT-9 N135T / I324M Gene-Terminator T CPS1 ), the expression cassettes of the two enzymes were integrated into the genomic site HO (i.e., the entire sequence of the site was deleted) to eliminate the accumulation of the intermediates p-coumaric acid and eriodictyol, and the YHG006 strain was obtained.

[0219] Table 4

[0220]

[0221] The data in Table 4 correspond to Figure 5 .

[0222] Example 5

[0223] Since multiple reactions in the de novo synthesis pathway involve the participation of the reduced coenzyme NADPH, the regeneration of NADPH in yeast was strengthened. The expression cassette of the endogenous yeast 6-phosphate glucose dehydrogenase GND1 (including promoter P TEF1 -GND1 gene-terminator T ADH1 ) and the expression cassette of the NADH kinase mutant (Pos5Δ17) that does locate the peptide (including: promoter P GPM1 -Pos5Δ17 gene-terminator T TEF2 ) was integrated into the genomic site YMRWdelta15 (i.e., the entire sequence of this site was deleted) to obtain the YHG013 strain.

[0224] Table 5

[0225]

[0226] The data in Table 5 correspond to Figure 6 .

[0227] Example 6

[0228] Uridine diphosphate glucose (UDP-glucose) is the glycosyl donor for homoeriodictyol glycosylation, so this embodiment strengthens the biosynthesis of UDP-glucose and weakens the intracellular secretion of UDP-glucose.

[0229] The specific method is to knock out the endogenous UDP-galactose transporter HUT1 (accession number: SGD: S000006165) in yeast and replace the expression cassette of the endogenous phosphoglucomutase (PGM1) in yeast (including promoter P TEF1 -PGM1 gene-terminator T ADH1 ) and UDP-glucose pyrophosphorylase (UGP1) expression cassette (including promoter P TPI1 -UGP1 gene-terminator T CPS1 ) was integrated into the genomic site YARCdelta8 (i.e., the entire sequence of this site was deleted) to obtain the YHG021 strain.

[0230] Example 7

[0231] Finally, in order to optimize the growth of the strain, the expression cassette of bacterial hemoglobin (VHb) from Vitreous Oscillatoria was inserted into the TEF1 -VHb gene-terminator T ADH1) was integrated into the genomic locus YCRWdelta12 (i.e., the entire sequence at this locus was deleted), resulting in strain YHG026. Finally, the strain was optimized for fermentation: 100 μL of the culture medium stored at -80°C was inoculated into 5 mL of synthetic medium SC-URA. The culture was incubated overnight at 30°C and 220 rpm. The next morning, the OD value of the seeds was measured. 600 Value, based on initial OD 600 The seed culture medium was inoculated into the fermentation medium (30 mL of YPD medium) with an inoculum size of 0.1, and 512 μL of 500 g / L glucose solution was added to the culture medium at 24 h and 48 h, respectively, to ensure a final glucose concentration of 40 g / L. The culture was fermented at 30°C and 220 rpm for 72 h.

[0232] Fed-batch fermentation in yeast extract peptone glucose medium yielded 461.7 mg / L homoeriodictyol 7-O-glucoside from 40 g / L glucose.

[0233] Table 6

[0234] strain High eriodictyol 7-O-glucoside yield YHG021 360.3mg / L YHG026 394.0mg / L

[0235] The data in Table 6 correspond to Figure 7 .

[0236] Table 7

[0237]

[0238]

[0239] The data in Table 7 correspond to Figure 8 .

[0240] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.

Claims

1. Use of integration sites as targets in the preparation of homopterocarpin 7-O-glucoside; The integration sites include: One or more of the PDC5 site, TKL2-TEF2 site, YHRCdelta14 site, YORWdelta17 site, ARO10 site, YNRCdelta9 site, YERCdelta8 site, HO site, YMRWdelta15 site, YARCdelta8 site, and YCRWdelta12 site.

2. Use of expressing genes and / or knocking out genes in the preparation of homopterocarpin 7-O-glucoside; The expressing genes include: exogenous expressing genes and / or endogenous expressing genes; The exogenous expression genes include: one or more of the TAL gene, PAL gene, C4H gene, ATR2 gene, aroL gene, PDH1 gene, ROMT-9 N135T / I324M gene, MTHFR gene, UGT73C6 gene, 4CL gene and VHb gene; The endogenous expression genes include: CYB5 gene, ARO4 K229L gene, ARO7 G141S gene, MET6 gene, SAH1 gene, ADO1 gene, MET13 gene, GND1 gene, Pos5Δ17 gene, PGM1 gene, and UGP1 gene, one or more of them; The knocking out genes include: EXG1 gene and / or HUT1 gene.

3. The application according to claim 2, characterized in that The TAL gene has: (1) The nucleotide sequence shown in SEQ ID NO:1; or (2) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (1), and having the same or similar function as the nucleotide sequence shown in (1); or (3) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (1) or (2); or The PAL gene has: (4) The nucleotide sequence shown in SEQ ID NO:2; or (5) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (4), and having the same or similar function as the nucleotide sequence shown in (4); or (6) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (4) or (5); or The C4H gene has: (7) The nucleotide sequence shown in SEQ ID NO:3; or (8) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (7), and having the same or similar function as the nucleotide sequence shown in (7); or (9) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (7) or (8); or The ATR2 gene has: (10) The nucleotide sequence shown in SEQ ID NO:4; or (11) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (10), and having the same or similar function as the nucleotide sequence shown in (10); or (12) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (10) or (11); or The CYB5 gene has: (13) The nucleotide sequence shown in SEQ ID NO:5; or (14) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (13), and having the same or similar function as the nucleotide sequence shown in (13); or (15) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (13) or (14); or The ARO4 K229L gene has: (16) The nucleotide sequence shown in SEQ ID NO:6; or (17) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (16), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (16); or (18) A nucleotide sequence having at least 80% identity to the nucleotide sequence shown in (16) or (17); or The ARO7 G141S gene has: (19) The nucleotide sequence as shown in SEQ ID NO:7; or (20) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (19), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (19); or (21) A nucleotide sequence having at least 80% identity to the nucleotide sequence shown in (19) or (20); or The aroL gene has: (22) The nucleotide sequence as shown in SEQ ID NO:8; or (23) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (22), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (22); or (24) A nucleotide sequence having at least 80% identity to the nucleotide sequence shown in (22) or (23); or The PDH1 gene has: (25) The nucleotide sequence as shown in SEQ ID NO:9; or (26) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (25), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (25); or (27) A nucleotide sequence having at least 80% identity to the nucleotide sequence shown in (25) or (26); The UGT73C6 gene has: (28) The nucleotide sequence as shown in SEQ ID NO:10; or (29) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (28), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (28); or (30) A nucleotide sequence having at least 80% identity to the nucleotide sequence shown in (28) or (29); The GND1 gene has: (31) The nucleotide sequence as shown in SEQ ID NO:11; or (32) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (31), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (31); or (33) A nucleotide sequence having at least 80% identity to the nucleotide sequence shown in (31) or (32); The Pos5Δ17 gene has: (34) The nucleotide sequence as shown in SEQ ID NO:12; or (35) A nucleotide sequence obtained by substituting, deleting, or adding one or more bases to the nucleotide sequence as shown in (34), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (34); or (36) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (34) or (35); The PGM1 gene has: (37) A nucleotide sequence as shown in SEQ ID NO:13; or (38) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (37), and having the same or similar function as the nucleotide sequence shown in (37); or (39) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (37) or (38); The UGP1 gene has: (40) A nucleotide sequence as shown in SEQ ID NO:14; or (41) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (40), and having the same or similar function as the nucleotide sequence shown in (40); or (42) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (40) or (41); The VHb gene has: (43) A nucleotide sequence as shown in SEQ ID NO:15; or (44) A nucleotide sequence obtained by substituting, deleting or adding one or more bases to the nucleotide sequence shown in (43), and having the same or similar function as the nucleotide sequence shown in (43); or (45) A nucleotide sequence having at least 80% identity with the nucleotide sequence shown in (43) or (44).

4. Expression module, characterized in that, Comprising: One or more of the first expression module to the fourteenth expression module, and the fifteenth expression module to the twenty-third expression module; The first expression module comprises: the TAL gene as described in the application of claim 2 or 3; The second expression module comprises: the PAL gene as described in the application of claim 2 or 3; The third expression module comprises: the C4H gene as described in the application of claim 2 or 3; The fourth expression module comprises: the ATR2 gene as described in the application of claim 2 or 3; The fifth expression module comprises: the CYB5 gene as described in the application of claim 2 or 3; The sixth expression module includes: the ARO4 as described in the application of claim 2 or 3 K229L gene; The seventh expression module includes: the ARO7 of the application according to claim 2 or 3 G141S gene; The eighth expression module comprises: the aroL gene as described in the application of claim 2 or 3; The ninth expression module comprises: the PDH1 gene as described in the application of claim 2 or 3; The tenth expression module includes: the ROMT-9 of the application as described in claim 2 or 3 N135T / I324M gene; The eleventh expression module comprises: the MET6 gene as described in the application of claim 2 or 3; The twelfth expression module comprises: the SAH1 gene as described in the application of claim 2 or 3; The thirteenth expression module comprises: the ADO1 gene as described in the application of claim 2 or 3; The fourteenth expression module comprises: the MET13 gene and the MTHFR gene as described in the application of claim 2 or 3; The fifteenth expression module comprises: the UGT73C6 gene as described in the application of claim 2 or 3; The sixteenth expression module comprises: the EXG1 gene as described in the application of claim 2 or 3; The seventeenth expression module includes: the 4CL gene of the application as described in claim 2 or 3; The eighteenth expression module includes: the GND1 gene of the application as described in claim 2 or 3; The nineteenth expression module includes: the Pos5Δ17 gene of the application as described in claim 2 or 3; The twentieth expression module includes: the HUT1 gene of the application as described in claim 2 or 3; The twenty-first expression module includes: the PGM1 gene of the application as described in claim 2 or 3; The twenty-second expression module includes: the UGP1 gene of the application as described in claim 2 or 3; The twenty-third expression module includes: the VHb gene of the application as described in claim 2 or 3.

5. The expression module according to claim 4, wherein It further includes: A promoter and a terminator; The promoter includes: P TEF1 , P GPM1 , P TPI1 and P TDH3 one or more of; The terminator includes: T ADH1 , T TEF2 , T CPS1 and T PGK1 or one or more of them.

6. The expression module according to claim 4 or 5, characterized in that The first expression module is expressed at the PDC5 locus as described in claim 1; The second expression module, the third expression module, the fourth expression module and the fifth expression module are expressed at the TKL2-TEF2 locus as described in claim 1; The sixth expression module and the seventh expression module are expressed at the YHRCdelta14 locus as described in claim 1; The eighth expression module and the ninth expression module are expressed at the YORWdelta17 locus as described in claim 1; The tenth expression module is expressed at the ARO10 locus and the HO locus as described in claim 1; The eleventh expression module, the twelfth expression module, the thirteenth expression module and the fourteenth expression module are expressed at the YNRCdelta9 locus as described in claim 1; The fifteenth expression module is expressed at the YERCdelta8 locus as described in claim 1; The seventeenth expression module is expressed at the HO locus as described in claim 1; The eighteenth expression module and the nineteenth expression module are expressed at the YMRWdelta15 locus as described in claim 1; The twenty-first expression module and the twenty-second expression module are expressed at the YARCdelta8 locus as described in claim 1; The twenty-third expression module is expressed at the YCRWdelta12 locus as described in claim 1.

7. A strain, characterized in that, Introduce the expression module as described in any one of claims 4 to 6 into the chassis strain.

8. Use of the expression module as described in any one of claims 4 to 6 and / or the strain as described in claim 7 in the preparation of homoeriodictyol 7-O-glucoside.

9. Preparation method of homopterocarpin 7-O-glucoside, characterized in that, Inoculate and culture the strain as described in claim 7 to obtain the homoeriodictyol 7-O-glucoside.

Images