Multi-component nuclease biosensor for detecting olfactory marker protein and method of making

Abstract

This invention discloses a biosensor for detecting olfactory marker proteins using a multi-component nuclease and its preparation method. The biosensor comprises: two target sequences, OMP1 and / or OMP2, at different sites of the OMP gene; a hairpin molecule, D-MH, for isothermal amplification; ssDNA, the substrate nucleic acid of the multi-component nuclease complex; Klenow DNA polymerase; Nb.BbvCI nuclease; dNTPs; 10×NEB buffer; and MgCl2 solution. This invention combines SPEXPAR isothermal amplification technology with the multi-component nuclease MNAzyme system. The conformationally variable hairpin D-MH molecule recognizes the target sequence OMP and amplifies a large number of new nucleic acid molecules, OMP1+2. This nucleic acid molecule folds and combines with the substrate ssDNA to form an enzymatically active multi-component nucleic acid complex, which then cleaves the ssDNA, thereby generating a detectable fluorescent signal.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a fluorescent biosensor for detecting olfactory marker proteins and its preparation method. Background Technology

[0002] Olfactory function is a vital human sense, and olfactory dysfunction is a condition characterized by a partial or complete loss, abnormality, or reduction of the sense of smell. Olfactory dysfunction not only impacts a patient's quality of life, social activities, daily work, and mental health, but it also serves as a relevant or early indicator for a range of diseases. Studies have shown that olfactory dysfunction may be more strongly correlated with the detection of COVID-19 infection before symptoms appear compared to typical symptoms such as cough, fever, and chest tightness, making it crucial for the early detection of the virus. For neurodegenerative diseases that cannot be diagnosed early, olfactory function can reflect episodic memory and medial temporal lobe atrophy in at-risk individuals. Olfactory dysfunction appears earlier than motor symptoms and is associated with disease progression. Furthermore, olfactory dysfunction can also result from genetic disorders, sinusitis, nasal polyps, allergies, head trauma, and viral infections of the upper respiratory tract. Currently, methods for examining olfactory dysfunction, besides relying on the patient's subjective complaint, include stimulation with different types or concentrations of olfactory substances, MRI and PET scans, respiratory resistance measurement, and olfactory evoked potential detection. Some of these methods depend on patient cooperation and are susceptible to human interference, while others, although more objective, are cumbersome to perform and require specialized equipment, making them difficult to implement in ordinary hospitals. Selecting a specific olfactory marker gene for molecular detection may be a valuable supplement to the above methods.

[0003] Olfactory marker protein (OMP) is a soluble acidic protein expressed in mature olfactory nerves. By directly capturing cyclic adenosine monophosphate (cAMP), OMP enhances olfactory responses and modulates olfactory sensitivity and olfactory nerve axon targeting. In the absence of OMP, basal cAMP concentration increases, eliminating the difference in basal cAMP levels between ORNs expressing different odor receptors, thus making it impossible to distinguish different odors. When OMP expression levels are restored, the ability to perceive odors is significantly restored. Currently, OMP levels are mainly detected using immunohistochemistry and quantitative real-time PCR. These methods are accurate and reliable, but newer detection methods with higher sensitivity, faster and simpler operation, and lower cost are crucial for specimens like olfactory nerves with limited sample sizes.

[0004] Multicomponent nucleic acid enzymes (MNAzymes) are polymers of multiple nucleic acid molecules that spontaneously fold together. Although these polymers do not contain proteases, they possess the ability to cleave substrate nucleic acid molecules. When fluorescent groups or electroactive molecules bind to the ends of the substrate nucleic acids, changes in fluorescence or electrical signals can be detected to assess biological reactions. Biosensors built upon this foundation have been widely used in nucleic acid detection. Traditional MNAzyme reactions require the assembly and folding of multiple nucleic acid sequences, resulting in complex systems, high costs, and limited signal amplification efficiency.

[0005] SPEXPAR (Spice-Extended Self-Primer Amplification) is a newly invented isothermal amplification technique that does not require additional primers. The target sequence specifically recognizes and binds to a hairpin molecule, causing a conformational change in the hairpin and a zipper-like refolding. Using the hairpin molecule itself as a template, a new nucleic acid fragment extends from the 5' end of the hairpin molecule under the action of DNA polymerase and endonuclease and is cleaved. During this process, the target sequence is also released from the hairpin. These released target sequences and newly synthesized nucleic acid fragments can recombine with the hairpin molecule, continuously promoting this reaction cycle and ultimately producing a large number of new nucleic acid fragments. The method is ingeniously designed, the system is simple, the cost is low, and the operation is rapid and convenient.

[0006] Therefore, the MNAzyme fluorescent biosensor based on the SPEXPAR reaction is beneficial for the efficient, sensitive, accurate and rapid detection of the OMP gene. Summary of the Invention

[0007] The purpose of this invention is to provide a biosensor for detecting olfactory marker proteins based on a multi-component nuclease with high sensitivity and specificity, simple and rapid operation, and low cost, as well as its preparation method.

[0008] The technical solution of this invention is:

[0009] A biosensor for detecting olfactory marker proteins using a multi-component nuclease, characterized in that the biosensor comprises: two target sequences OMP1 and / or OMP2 at different sites of the OMP gene, a hairpin molecule D-MH for isothermal amplification, substrate nucleic acid ssDNA of the multi-component nuclease complex, DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP, 10×NEB buffer, and MgCl2 solution.

[0010] A method for preparing a biosensor for detecting olfactory marker proteins using a multi-component nuclease is characterized by the following: the SPEXPAR isothermal amplification reaction can specifically recognize the OMP genes OMP1 and OMP2 through its hairpin molecule D-MH, and initiate the isothermal amplification reaction without the need for primers, generating a new nucleotide molecule OMP. 1+2; In addition to the target sequence and D-MH molecules, the SPEXPAR reaction also requires DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTPs, and 10×NEB buffer; D-MH molecules bind to avidinized magnetic beads via a biotin-avidin reaction and are removed from the SPEXPAR reaction product by magnetic adsorption. These D-MH-biotin-avidin magnetic beads can be reused after washing; The newly generated nucleic acid molecules undergo an MNAzyme reaction with ssDNA molecules and MgCl2 solution. After complementarity and folding, a multi-component nuclease complex with cleavage activity is formed, which specifically cleaves the rGrU site on ssDNA, causing the separation of the fluorescent reporter group and quencher group modified at both ends of the ssDNA, thereby generating a detectable fluorescent signal.

[0011] The 3' end of the D-MH molecule is modified with biotin, and then linked to avidinized magnetic beads via a biotin-avidin reaction. After the SPEXPAR reaction is completed, the D-MH molecule is removed from the reaction product using a magnetic frame. The D-MH molecule coated with the magnetic beads can be recycled after cleaning.

[0012] In the SPEXPAR reaction, the final concentrations of D-MH, Klenow, Nb.BbvCI, and dNTP were 100 nM, 0.1 U / μl, 0.1 U / μl, and 0.25 mM, respectively.

[0013] The SPEXPAR reaction temperature is 37℃ and the SPEXPAR reaction time is 1h.

[0014] The optimal final concentration of ssDNA is 100 nM, Mg 2+ The final concentration was 30 mM; the reaction temperature of MNAzyme depends on the Tm value of the nucleic acid molecule, the reaction temperature is 70℃, and the reaction time of MNAzyme is 0.5 h.

[0015] The nucleic acid sequence is as follows:

[0016] OMP 1: 5'TGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAG 3'

[0017] OMP 2: 5'AGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTC 3'

[0018] D-MH:

[0019] 5'AGCAGCGGCTTAGCAGTCTACTGTTACTAAAAGCCGCTGCTCCTCAGCTGCGGATC TTGGCCAGGTCCGACAGTAGACTGCTTCTCCCCGCGCTGCTTCAGGCT-Biotin 3'

[0020] ssDNA:

[0021] 5'FAM-GCTGCGGATCTTGGCCAGGTCCGACrGrUTCTCCCCCGCGCTGCTTCAG GCT-BHQ 3';

[0022] OMP 1+2:

[0023] 5'AGCCTGAAGCAGCGCGGGGAGAAGCAGTCTACTGTCGGACCTGGCCA AGATCCGCAGC 3'.

[0024] SPEXPAR reaction result interpretation: Non-denaturing polyacrylamide gel electrophoresis was performed at 200V for 60 minutes. After staining with GelRed nucleic acid dye, the electrophoretic products were detected by a gel imaging system.

[0025] SPEXPAR reaction condition optimization:

[0026] The product bands in reaction systems containing different concentrations of D-MH magnetic beads, Klenow DNA polymerase, Nb.BbvCI nuclease, and dNTP solutions were detected to determine the optimal reaction concentrations for each component. The results showed that the optimal final concentrations for D-MH magnetic beads, Klenow, Nb.BbvCI, and dNTP solutions were 100 nM, 0.1 U / μL, 0.1 U / μL, and 0.25 mM, respectively.

[0027] Based on the temperature requirements of the endonuclease Nb.BbvCI, 37℃ was selected as the reaction temperature for SPEXPAR.

[0028] The SPEXPAR reaction product bands were detected from 0.5h to 4h, and 1h was selected as the SPEXPAR reaction time.

[0029] MNAzyme reaction results reading: On a fluorescence spectrophotometer, the excitation source wavelength was 490 nm, and the emission spectrum from 500 to 700 nm was recorded.

[0030] MNAzyme reaction condition optimization:

[0031] The fluorescence intensity of the products in the reaction system of ssDNA and MgCl2 solution at different concentrations was measured to find the optimal concentrations of ssDNA and MgCl2 solution. The results showed that the optimal final concentration of ssDNA was 100 nM and the optimal final concentration of MgCl2 solution was 30 mM.

[0032] The fluorescence intensity of the MNAzyme reaction products was measured at 50-80℃ to determine the optimal reaction temperature. The reaction temperature depends on the Tm value of the nucleic acid molecules in the reaction; the optimal reaction temperature for this system is 70℃.

[0033] The fluorescence intensity of the MNAzyme reaction product was detected from 0.5 h to 4 h, and 0.5 h was selected as the optimal reaction time for MNAzyme.

[0034] Combining SPEXPAR with the MNAzyme reaction:

[0035] The supernatant of the SPEXPAR reaction product was mixed with FAM-ss-DNA-BHQ and MgCl2 solution in a certain proportion for reaction. After the reaction was completed, the emission spectrum of 500-700 nm was recorded by a fluorescence spectrophotometer at an excitation wavelength of 490 nm.

[0036] Methodological evaluation: The established method is evaluated for specificity, linear range, limit of detection, intra- and inter-batch repeatability, etc.

[0037] Compared with existing technologies, the beneficial effects of this invention are as follows: This invention combines SPEXPAR isothermal amplification technology with a multi-component nuclease MNAzyme system, utilizing the conformationally variable hairpin D-MH molecule to recognize the target sequence OMP and amplify a large number of new nucleic acid molecules, OMP1+2. This nucleic acid molecule can fold and combine with the substrate ssDNA to form a multi-component nucleic acid complex with enzymatic activity, and then cleave the ssDNA to generate a detectable fluorescent signal. This constructs a simple, efficient, and sensitive olfactory marker protein detection biosensor, providing a new method for the detection of the OMP gene.

[0038] The present invention will be further described below with reference to the accompanying drawings and embodiments. Attached Figure Description

[0039] Figure 1 This is a schematic diagram of multicomponent nuclease detection based on isothermal self-primer noncomponent amplification reaction.

[0040] Figure 2 These are non-denaturing polypropylene gel electrophoresis images of the SPEXPAR reaction under different conditions.

[0041] Figure 3 These are SPEXPAR reaction non-denaturing polypropylene gel electrophoresis images of different groups.

[0042] Figure 4 These are fluorescence intensity diagrams of the MNAzyme reaction under different conditions.

[0043] Figure 5 These are fluorescence intensity graphs of different groups of MNAzyme reactions.

[0044] Figure 6 This is a fluorescence intensity diagram of the SPEXPAR-MNAzyme reaction.

[0045] Figure 7 This is a schematic diagram of the SPEXPAR-MNAzyme reaction specificity detection.

[0046] Figure 8 This is a schematic diagram of the SPEXPAR-MNAzyme reaction sensitivity detection. Detailed Implementation

[0047] 1. Sequence design and synthesis

[0048] A schematic diagram of the principle of this invention is shown below. Figure 1 OMP sequences were searched on PubMed, and two sites were selected as target sequences for detection. Based on the experimental principle and these two sequences, corresponding D-MH hairpin molecules were designed. Complementary substrate nucleic acid sequences were designed based on the SPEXPAR product sequences, and fluorescent reporter groups FAM and quencher groups BHQ were added to both ends of these sequences. The sequences used in this invention are as follows:

[0049] OMP 1 5'TGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAG 3'

[0050] OMP 2 5'AGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTC 3'

[0051] D-MH

[0052] 5'AGCAGCGGCTTAGCAGTCTACTGTTACTAAAAGCCGCTGCTCCTCAGCTGCGGATCTTGGCCAGGTCCGACAGTAGACTGCTTCTCCCCGCGCTGCTTCAGGCT-Biotin 3'

[0053] ssDNA:

[0054] 5'FAM-GCTGCGGATCTTGGCCAGGTCCGACrGrUTCTCCCCGCGCTGCTTCAGGCT-BHQ 3'

[0055] 2. Preparation of D-MH magnetic beads

[0056] The D-MH-magnetic bead ligation reaction was performed by vortexing the magnetic bead bottle for 20 seconds, resuspending the beads, and transferring 20 μL of beads to a new centrifuge tube. The centrifuge tube was placed on a magnetic separator and allowed to stand for 1 minute (this operation will be referred to as magnetic separation below). The supernatant was removed, and the centrifuge tube was removed from the magnetic separator. 1 mL of Buffer I (10 mM Tris-HCl (pH 7.5), 1 mM EDTA, 1 M NaCl, 0.01%–0.1% Tween-20) was added, and the mixture was vortexed and resuspended before magnetic separation. The supernatant was removed, and this operation was repeated once. 100 μL of biotinylated nucleic acid diluted with Buffer I was added (to make the magnetic bead concentration 2 mg / mL), and the mixture was vortexed and mixed at room temperature for 30 minutes. After 30 minutes, magnetic separation was performed. The magnetic beads were washed three times with Buffer I solution, and 100 μL of DEPC water was added to resuspend the beads, completing the D-MH-biotin and avidinized magnetic bead ligation reaction.

[0057] 3. Optimization of SPEXPAR reaction conditions

[0058] The SPEXPAR reaction system consists of D-MH magnetic beads, DNA polymerase Klenow, endonuclease Nb.BbvCI, dNTP solution, 10×NEB buffer, and target sequences OMP1 and / or OMP2.

[0059] The SPEXPAR product bands were analyzed when the concentrations of target sequences OMP1 and / or OMP2, DNA polymerase Klenow, endonuclease Nb.BbvCI, and dNTP solutions were fixed, and the concentrations of D-MH-magnetic beads were 1 μM, 100 nM, and 10 nM, respectively. It was found that the target product band was brightest and had the fewest impurities when the final concentration of D-MH-magnetic beads was 100 nM. Therefore, 100 nM was selected as the final concentration of D-MH-magnetic beads. Figure 2 A).

[0060] The SPEXPAR product banding was analyzed when the concentrations of target sequences OMP1 and / or OMP2, D-MH-magnetic beads, endonuclease Nb.BbvCI, and dNTP solutions were fixed, and the concentrations of Klenow DNA polymerase were 0.2 U / μL, 0.1 U / μL, and 0.05 U / μL, respectively. Considering both economic efficiency and product banding performance, 0.1 U / μL was selected as the optimal final concentration of Klenow DNA polymerase. Figure 2 B).

[0061] The SPEXPAR product bands were examined when the concentrations of the target sequences OMP1 and / or OMP2, D-MH-magnetic beads, DNA polymerase Klenow, and dNTP solutions were fixed, and the Nb.BbvCI concentrations were 0.2 U / μL, 0.1 U / μL, and 0.05 U / μL, respectively. Considering both economic efficiency and product band performance, 0.1 U / μL was selected as the optimized final concentration of the Nb.BbvCI.

[0062] The SPEXPAR product bands were examined when the concentrations of target sequences OMP1 and / or OMP2, D-MH-magnetic beads, DNA polymerase Klenow, and endonuclease Nb.BbvCI were fixed, and the dNTP solutions were 2.5 mM, 1.25 mM, 0.625 mM, and 0.25 mM, respectively. Considering both economic efficiency and product band performance, 0.25 mM was selected as the optimal final concentration of the dNTP solution. Figure 2 B).

[0063] Take 1 μL of 10 μM OMP 1 and / or OMP 2, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL Nb.BbvCI endonuclease, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10×NEB buffer. Add 3 μL H2O to make up the total volume of 10 μL. Mix well and react at 37℃ for 0.5 h to 4 h. Observe the product bands and select 1 h as the shortest reaction time for SPEXPAR.

[0064] 4. Interpretation of SPEXPAR reaction results

[0065] Take 1 μL of 10 μM OMP 1 and / or OMP 2, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL Nb.BbvCl nuclease, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10× NEB buffer. Make up the total volume to 10 μL with 3 μL H2O, mix well, and incubate at 37℃ for 1 h. Perform non-denaturing polyacrylamide gel electrophoresis at 200V for 60 min. Add 15 μL of GelRed nucleic acid dye 10000× stock solution and 5 mL of 1M NaCl to 45 mL of H2O to obtain the non-denaturing polyacrylamide gel staining solution. Stain the non-denaturing polyacrylamide gel using the immersion staining method for 30 min. Observe the banding using a gel imaging system. The results show that, compared with other groups, the desired size band was only produced when all components in the system were present. Figure 3 A), and whether OMP 1 and OMP 2 are present alone or simultaneously, they can both lead to the generation of the target size band ( Figure 3 B).

[0066] 5. Optimization of MNAzyme reaction conditions

[0067] The MNAzyme reaction system consists of OMP 1+2 sequence, ssDNA, and MgCl2 solution.

[0068] The fluorescence intensity (FL) of the reaction product was measured when the concentrations of OMP 1+2 and MgCl2 solutions were fixed, and the ssDNA concentrations were 100 nM, 10 nM, and 1 nM, respectively. It was found that a relatively obvious FL peak was produced when the final ssDNA concentration was 100 nM. Therefore, 100 nM was chosen as the optimal final concentration for ssDNA. Figure 4 A).

[0069] The FL (fluctuations in MgCl2) of the reaction products were measured when the concentrations of OMP 1+2 and ssDNA were fixed, and the final concentrations of MgCl2 solution were 40 mM, 30 mM, 20 mM, 10 mM, 5 mM, and 2.5 mM. It was found that the FL value was highest when the final concentration of MgCl2 solution was 30 mM. Therefore, 30 mM was selected as the optimal final concentration of MgCl2 solution. Figure 4 B).

[0070] Take 1 μL of 10 μM OMP 1+2, 1 μL of 1 μM ssDNA, and 3 μL of 100 mM MgCl2 solution, and add 5 μL of H2O to make up to a total volume of 10 μL. Mix well and react at 55-75℃ in the dark for 4 hours. Detect the FL of the reaction product. It was found that the FL reached its peak at a reaction temperature of 70℃. Therefore, 70℃ was selected as the optimal reaction temperature. Figure 4 C).

[0071] Take 1 μL of 10 μM OMP 1+2, 1 μL of 1 μM ssDNA, and 3 μL of 100 mM MgCl2 solution, and add 5 μL of H2O to make up to a total volume of 10 μL. Mix well and react at 70 °C in the dark for 0.5–5 h. Detect the flux (FL) of the reaction product. It was found that the FL reached its maximum at 0.5 h and did not increase further thereafter. Therefore, 0.5 h was selected as the optimal reaction time. Figure 4 D).

[0072] Take 1 μL of 10 μM OMP 1+2, 1 μL of 1 μM ssDNA, and 3 μL of 100 mM MgCl2 solution, and add 5 μL of H2O to make up to a total volume of 10 μL. Mix well and react at 70 °C in the dark for 0.5 h. After the reaction is complete, add 200 μL of H2O and mix well. Detect the emission spectrum values ​​of the excitation source at a wavelength of 490 nm and 500-700 nm using a fluorescence spectrophotometer. The results show that a significant fluorescence intensity peak is only produced when all components of the MNAzyme system are present. Figure 5 ).

[0073] 6. Combined use of SPEXPAR and MNAzyme reaction

[0074] Take 1 μL of 10 μM OMP 1 and / or OMP 2, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL Nb.BbvCl endonuclease, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10×NEB buffer. Make up to 10 μL of total volume with 3 μL H2O. Mix well and incubate at 37°C for 1 h. After the reaction, remove the D-MH magnetic beads on a magnetic rack, and take 10 μL of the reaction supernatant. Add 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution, and make up to 100 μL of total volume with 77 μL H2O. Mix well and incubate at 70°C in the dark for 0.5 h. After the reaction, add 100 μL of H2O. After mixing with H2O, the emission spectrum values ​​of the excitation source wavelength at 490 nm and 500-700 nm were detected on a fluorescence spectrophotometer. The results showed that the combination of the two methods produced a significantly increased fluorescence peak. Figure 6 ).

[0075] 7. Methodological Evaluation

[0076] ① Specific detection of synthesized nucleic acid sequences NC1, NC2, and NC3, which are mismatched with 1 or 2 bases in OMP1 and OMP2, respectively.

[0077] NC 1 5'TGGAGAGCCTGAAGCAGTGCGGGGAGAAGCGCCAG 3'

[0078] NC 2 5'AGCGCCTGTCGGACCTGGCCGAGATCCGCAAGGTC 3'

[0079] NC 3 5'TGGAGAGCCTGAAGCAGTACGGGGAGAAGCGCCAG 3'

[0080] The fluorescence intensity of the test sequences was detected using SPEXPAR combined with the MNAzyme method for 5 μM OMP 1 and OMP 2, 100 nM OMP 1 and OMP 2, 10 μM NC 1, 10 μM NC 2, and 10 μM NC 3. 1 μL of the test sequence, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL Nb.BbvCI endonuclease, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10×NEB buffer were added. 3 μL of H2O was added to make a total volume of 10 μL. The mixture was thoroughly mixed and incubated at 37°C for 1 h. After the reaction, the D-MH magnetic beads were removed from the magnetic rack, and 10 μL of the reaction supernatant was aspirated. 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution were added to a final volume of 77 μL. Add H2O to make up the total volume to 100 μL, mix well, and react at 70°C in the dark for 0.5 h. After the reaction is complete, add 100 μL of H2O, mix well, and then use a fluorescence spectrophotometer to detect the emission spectrum values ​​of the excitation source wavelength at 490 nm and the 500-700 nm range. The results show that the present invention has good specificity. Figure 7 ).

[0081] ② Linear Range Detection: OMP 1 and OMP 2 were diluted to 10 μM, 1 μM, 100 nM, 10 nM, 1 nM, 100 pM, 10 pM, and 1 pM solutions, respectively. Take 1 μL of each of the above concentrations of the target sequence, 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL Nb.BbvCI endonuclease, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10×NEB buffer. Add 3 μL of H2O to a total volume of 10 μL, mix well, and incubate at 37°C for 1 h. After the reaction, remove the D-MH magnetic beads from the magnetic rack, take 10 μL of the reaction supernatant, add 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution, and 77 μL of... Add H2O to make up the total volume to 100 μL, mix well, and react at 70 °C in the dark for 0.5 h. After the reaction is complete, add 100 μL of H2O, mix well, and then use a fluorescence spectrophotometer to detect the emission spectrum values ​​of the excitation source wavelength at 490 nm and the 500-700 nm range. The results show that the fluorescence intensity gradually increases with the increase of the target sequence concentration. Figure 8 A). Using the fluorescence intensity value FL at 522 nm as the ordinate and log(sample concentration) as the abscissa, a regression equation was plotted. The results showed that the present invention exhibits good linearity in the 100 nM-1 pM range, with the linear equation being Y = 302.08X + 1467.6, R0. 2 =0.9975( Figure 8 B).

[0082] ③ For the lowest detection limit (LOD), without adding the target sequence, take 1 μL of 1 μM D-MH magnetic beads, 1 μL of 1 U / μL Klenow DNA polymerase, 1 μL of 1 U / μL Nb.BbvCI endonuclease, 1 μL of 2.5 mM dNTP solution, and 1 μL of 10×NEB buffer. Add 5 μL of H2O to a total volume of 10 μL, mix well, and incubate at 37°C for 1 h. After the reaction, remove the D-MH magnetic beads on a magnetic rack, take 10 μL of the reaction supernatant, add 10 μL of 1 μM ssDNA and 3 μL of 1 M MgCl2 solution, and add 77 μL of H2O to a total volume of 100 μL. Mix well and incubate at 70°C in the dark for 0.5 h. After the reaction, add 100 μL of... After mixing with H2O, the emission spectrum of the excitation source wavelength was detected at 490 nm and 500-700 nm on a fluorescence spectrophotometer. The FL of the blank sample was measured and repeated 10 times. The standard deviation (N) of the FL of the blank sample was calculated, and the limit of detection (LOD) was calculated according to the formula LOD = 3N / S (where S is the slope in the linear regression equation). The limit of detection in this example is 1.06 pM.

[0083] It should be noted that the preparation method described in this embodiment can also be used to construct a fluorescent biosensor for detecting other sites of the OMP gene or other genes based on isothermal self-primer noncomponent amplification reaction using a multicomponent nuclease.

[0084] The above description is merely an embodiment of the present invention and does not limit the patent scope of the present invention. Any equivalent structural or procedural transformations made based on the content of the present invention's specification and drawings, or direct or indirect applications in other related technical fields, are similarly included within the patent protection scope of the present invention.

Claims

1. A method for preparing a biosensor for detecting olfactory marker proteins using a multi-component nuclease, characterized in that: The biosensor components include: two target sequences OMP1 and / or OMP2 at different sites of the OMP gene, hairpin molecule D-MH for isothermal amplification reaction, substrate nucleic acid ssDNA of multi-component nuclease complex, DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP, 10×NEB buffer and MgCl2 solution. Preparation method: SPEXPAR isothermal amplification reaction can specifically recognize the OMP genes OMP1 and OMP2 through its hairpin molecule D-MH, and initiate the isothermal amplification reaction without the need for primers, generating a new nucleotide molecule OMP1+2; in addition to the target sequence and D-MH molecule, SPEXPAR reaction also requires DNA polymerase Klenow, endonuclease Nb.BbvCI, substrate dNTP and 10×NEB buffer; D-MH molecule binds to avidinized magnetic beads through biotin-avidin reaction and is removed from SPEXPAR reaction product by magnetic adsorption. The D-MH-biotin-avidin magnetic beads can be reused after washing; the newly generated nucleic acid molecule undergoes MNAzyme reaction with ssDNA molecule and MgCl2 solution, and after complementation and folding, forms a multi-component nuclease complex with cleavage activity, which specifically cleaves the rGrU site on ssDNA, causing the separation of the fluorescent reporter group and quencher group modified at both ends of ssDNA, thereby generating a detectable fluorescent signal; The nucleic acid sequence is as follows: OMP 1: 5' TGGAGAGCCTGAAGCAGCGCGGGGAGAAGCGCCAG 3' OMP 2: 5' AGCGCCTGTCGGACCTGGCCAAGATCCGCAAGGTC 3' D-MH: 5'AGCAGCGGCTTAGCAGTCTACTGTTACTAAAAGCCGCTGCTCCTCAGCTGCGGATCTTGGCCAGGTCCGACAGTAGACTGCTTCTCCCCGCGCTGCTTCAGGCT-Biotin 3' ssDNA: 5'FAM-GCTGCGGATCTTGGCCAGGTCCGACrGrUTCTCCCCGCGCTGCTTCAGGCT -BHQ 3'.

2. The method for preparing a biosensor for detecting olfactory marker proteins using a multi-component nuclease according to claim 1, characterized in that: The 3' end of the D-MH molecule is modified with biotin, and then linked to avidinized magnetic beads via a biotin-avidin reaction. After the SPEXPAR reaction is completed, the D-MH molecule is removed from the reaction product using a magnetic frame. The D-MH molecule coated with the magnetic beads can be recycled after cleaning.

3. The method for preparing a biosensor for detecting olfactory marker proteins using a multi-component nuclease according to claim 1, characterized in that: In the SPEXPAR reaction, the final concentrations of D-MH, Klenow, Nb.BbvCI, and dNTP were 100 nM, 0.1 U / μl, 0.1 U / μl, and 0.25 mM, respectively.

4. The method for preparing a biosensor for detecting olfactory marker proteins using a multi-component nuclease according to claim 1, characterized in that: The SPEXPAR reaction temperature is 37℃ and the SPEXPAR reaction time is 1h.

5. The method for preparing a biosensor for detecting olfactory marker proteins using a multi-component nuclease according to claim 1, characterized in that: The optimal final concentration of ssDNA is 100 nM, Mg 2+ The final concentration was 30 mM; the reaction temperature of MNAzyme depended on the Tm value of the nucleic acid molecule, the reaction temperature was 70℃, and the reaction time of MNAzyme was 0.5 h.

Images