Lipid metabolism related disease biomarker miR-19899 cluster and application thereof

Abstract

The invention belongs to the technical field of biological detection, and particularly relates to a lipid metabolism related disease biomarker miR-19899 cluster and application thereof. The lipid metabolism related disease biomarker miR-19899 cluster provided by the invention comprises miR-19899, and the nucleotide sequence of the miR-19899 is as shown in SEQ ID NO: 1. According to the present invention, the expression of the miRNA of the miR-19899 cluster in the Alzheimer's disease is significantly reduced, and the miR-19899 cluster can be adopted as the AD biomarker so as to be used for AD detection and / or treatment.

Description

Technical Field

[0001] The present invention belongs to the technical field of biological detection, and in particular relates to a lipid metabolism-related disease biomarker miR-19899 cluster and an application thereof. Background Art

[0002] Alzheimer's disease (AD) is a progressive neurodegenerative disease with an insidious onset and is highly correlated with age. The clinical features of AD are cognitive decline with decreased learning and memory. The pathological mechanism of AD is complex, and the main pathological mechanisms are: extracellular senile plaque deposition formed by amyloid protein aggregation and intracellular neurofibrillary tangles formed by tau protein hyperphosphorylation. Due to the complexity and unclear pathological mechanism of AD, the lack of reliable biomarkers and effective drug targets makes the diagnosis and treatment of AD face severe challenges. At present, the diagnosis of AD is mainly based on neuropsychological tests, supplemented by the examination of body fluid pathological markers. The diagnostic methods lack sensitivity, specificity and accuracy, and poor adaptability. However, the efficacy of anti-AD drugs in clinical use or in the research stage is limited and cannot delay or cure the progression of the disease. Seeking reliable AD diagnostic biomarkers and drug intervention targets is a scientific problem that needs to be solved in the prevention and treatment of AD.

[0003] Lipids are the main components of brain tissue, accounting for more than 50% of the dry weight of brain tissue, making brain tissue the second largest lipid-rich organ after adipose tissue. Studies have shown that the content of unsaturated fatty acids in brain tissue, cerebrospinal fluid and plasma of AD patients is decreased. As a key component of brain lipids, changes in the content and composition of fatty acids may significantly affect neurological function and even lead to neurological dysfunction. Therefore, whether microRNA (miRNA) regulates fatty acid metabolism in brain tissue in the context of AD has become a new direction for studying the mechanism of the occurrence and development of AD.

[0004] miRNA is an important class of endogenous molecules, whose expression has significant tissue specificity and temporal sequence, regulating the expression level of key genes and affecting the progression of the disease. PSEN1 , PSEN2 , APPIt is closely related to gene mutations such as , etc. Therefore, early diagnosis and intervention of diseases can be carried out through genotype identification. However, lipid-related diseases represented by AD lack effective therapeutic targets and reagents, and the current research on the immune regulation mechanism of non-coding genes is still in its initial stage. Based on the multi-targeted characteristics of miRNAs, the miRNA-mediated epigenetic regulation mechanism is expected to intervene in the lipid metabolism process at the upstream gene level by regulating the complex and interactive lipid metabolism signaling pathway network. Therefore, discovering novel gene biomarkers for AD and new targets for regulating lipid metabolism at the gene level is of great significance for curing AD and other chronic diseases caused by lipid metabolism. Summary of the Invention

[0005] The object of the present invention is to provide a miR-19899 cluster as a biomarker for lipid metabolism-related diseases and its applications, and to effectively diagnose and / or treat lipid metabolism-related diseases, judge the prognosis of the diseases, and improve the quality of life of patients by designing an early detection kit.

[0006] A miR-19899 cluster as a biomarker for lipid metabolism-related diseases, wherein the miR-19899 cluster includes miR-19899, and the nucleotide sequence of miR-19899 is as shown in SEQ ID NO:1.

[0007] The present invention also provides the use of a substance for detecting the miR-19899 cluster as described above in the preparation of a kit having one or more functions of detecting, diagnosing, and monitoring the treatment status of lipid metabolism-related diseases; the monitoring of the treatment status includes the monitoring of the status during the treatment process and the prognosis monitoring.

[0008] The present invention also provides the use of the miR-19899 cluster as described above or a substance overexpressing the miR-19899 cluster in the preparation of a drug for preventing and / or treating lipid metabolism-related diseases.

[0009] Preferably, the lipid metabolism-related diseases include Alzheimer's disease.

[0010] Preferably, the drug includes one or both of 1) to 2): 1) A drug that inhibits the Rock2 / Plin4 signaling pathway in microglia and reduces lipid accumulation; the lipids include lipid droplets, triglycerides, and cholesterol; 2) A drug that promotes lipid metabolism; the lipids include lipid droplets, triglycerides, and cholesterol.

[0011] The present invention also provides a drug for treating lipid metabolism-related diseases, and the active ingredient of the drug includes the miR-19899 cluster as described above or a substance overexpressing the miR-19899 cluster.

[0012] The present invention also provides a primer set for detecting the miR-19899 cluster as described above, and the primer set includes a reverse transcription primer, an upstream primer, and a downstream primer; The reverse transcription primer includes the nucleotide sequence shown in SEQ ID NO:2; The upstream primer includes the nucleotide sequence shown in SEQ ID NO:3; The downstream primer includes the nucleotide sequence shown in SEQ ID NO:4.

[0013] The present invention also provides the application of the primer set as described above in preparing a kit having one or more functions in the detection, diagnosis, and monitoring of the treatment status of lipid metabolism-related diseases; The monitoring of the treatment status includes the monitoring of the status during the treatment process and the prognosis monitoring.

[0014] The present invention also provides a kit for screening lipid metabolism-related diseases, and the kit includes the primer set as described above.

[0015] The beneficial effects of the present invention are as follows: The lipid metabolism-related disease biomarker miR-19899 cluster provided by the present invention includes miR-19899, and the nucleotide sequence of miR-19899 is shown in SEQ ID NO:1. Through the detection of AD model cells, AD model animals, and clinical blood samples, the present invention finds that the microRNA of the miR-19899 cluster is significantly down-regulated in Alzheimer's disease, and the miR-19899 cluster can be used as a biomarker for detecting AD.

[0016] In addition, the present invention uses a laser confocal microscope, Western blot, dual-luciferase reporter assay, gene function gain and knockout experiments to conduct an in-depth and systematic study on the function of miR-19899, and finds that miR-19899 can alleviate lipid accumulation in microglia and alleviate the pro-inflammatory cell phenotype; down-regulation of miR-19899 expression induces microglia to present a lipid accumulation type and an inflammatory phenotype. After down-regulating miR-19899, Rock2 / Plin4 The signaling pathway is activated, thereby inducing lipid accumulation in microglia and promoting the inflammatory response. Therefore, substances overexpressing or restoring miR-19899 can inhibit lipid accumulation in microglia, improve the inflammatory pathological process of AD, and effectively prevent and treat AD. Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0018] Figure 1 Heat map of the expression level of miR-19899 cluster in the cerebral cortex of 5×FAD mice detected by miRNA high-throughput sequencing; Figure 2 Expression level of miR-19899 in APPswe cells at different time points of the AD neuron cell model after copper ion treatment detected by qRT-PCR; Figure 3 Expression level of miR-19899 in the neuroinflammatory cell model after LPS treatment of microglia detected by qRT-PCR; Figure 4 Results of the expression level of miR-19899 detected by qRT-PCR in the cerebral cortex of animal models, including 5×FAD mice and WT mice; Figure 5 Results of the expression level of miR-19899 detected by qRT-PCR in the hippocampal brain tissue of animal models, including 5×FAD mice and WT mice; Figure 6 Expression level of miR-19899 detected by qRT-PCR in plasma of AD patients and age-matched healthy volunteers (HAVs); Figure 7 Diagnostic prediction value of miR-19899 in AD patients analyzed by ROC curve; Figure 8 Results of the expression level of miR-19899 detected by qRT-PCR in different tissues of WT mice; Figure 9 Levels of lipid droplet changes in resting and activated microglia with miR-19899 downregulation detected by laser confocal microscopy; Figure 10 Representative pictures of lipid droplet changes in resting and activated microglia with miR-19899 downregulation detected by laser confocal microscopy; Figure 11 Levels of lipid droplet changes in resting and activated microglia with miR-19899 upregulation detected by laser confocal microscopy; Figure 12 Representative pictures of lipid droplet changes in resting and activated microglia with miR-19899 upregulation detected by laser confocal microscopy; Figure 13 Results of KEGG pathway enrichment analysis of potential binding targets of miR-19899 using bioinformatics software; Figure 14 Results of KEGG pathway enrichment analysis of potential binding targets predicted by miR-19899 using online software; Figure 15 Schematic diagram of the results of GO analysis of potential binding targets predicted by miR-19899 using online software; Figure 16 For qRT-PCR detection of the expression of Rock2 in APPswe cells with overexpressed miR-19899 downregulated; Figure 17 For qRT-PCR detection of the expression of Plin4 in APPswe cells with overexpressed miR-19899 downregulated; Figure 18 For qRT-PCR detection of the expression of Rock2 in resting (unactivated) microglial cells with overexpressed miR-19899 downregulated; Figure 19 For qRT-PCR detection of the expression of Plin4 in resting (unactivated) microglial cells with overexpressed miR-19899 downregulated; Figure 20 For dual-luciferase reporter analysis of the binding of miR-19899 to the 3'UTR of the target gene Rock2 ; Figure 21 For dual-luciferase reporter analysis of the binding of miR-19899 to the 3'UTR of the target gene Plin4 ; Detailed implementation mode

[0019] The present invention provides a miR-19899 cluster as a biomarker for lipid metabolism-related diseases. The miR-19899 cluster includes miR-19899, and the nucleotide sequence of miR-19899 is shown as SEQ ID NO:1.

[0020] SEQ ID NO:1: 5'-UGACUCUCAUUCCUUUCUGUAGU-3'; As an implementation mode, the miR-19899 cluster of the present invention includes but is not limited to miR-19899. Genes with sequences similar to miR-19899 all fall within the protection scope of the present invention. For example, derivatives of miR-19899 after modification, microRNAs with a length of 18-26 nt and functions identical or substantially identical to miR-19899, or any one of the derivatives of the microRNAs after modification can be used as biomarkers for lipid metabolism-related diseases. miR-19899 cannot be simply understood as the entire protection scope of the present invention. As an implementation mode, the lipid metabolism-related disease of the present invention is Alzheimer's disease.

[0021] The present invention uses 7-month-old five-transgenic mice stably transfected with the 5×FAD gene and wild-type mice as experimental subjects, and performs second-generation sequencing of high-throughput genomics expression profiles with "high throughput, high accuracy, and low cost" using a sequencing technology based on the combination of bridge PCR and sequencing-by-synthesis. The RNA of mouse brain tissue is extracted by the Trizol method and separated to construct a sequencing gene library, and miR-19899 with clear characteristic changes and a brand-new sequence is excavated. miR-19899 is downregulated in the brain tissues of 5×FAD mice of different months of age. Moreover, the present invention uses qRT-PCR technology for reverse transcription and real-time fluorescence quantitative detection, and miR-19899 is downregulated in AD model cells, AD model animals, and the sera of AD patients. The miR-19899 cluster is associated with the disease of AD and can be used as a biomarker for AD diagnosis.

[0022] The present invention also provides the application of a substance for detecting the miR-19899 cluster as described above in the preparation of a kit having one or more functions in the detection, diagnosis, and monitoring of the treatment status of lipid metabolism-related diseases; the monitoring of the treatment status includes the monitoring of the status during the treatment process and the prognosis monitoring. As an implementation manner, the lipid metabolism-related diseases include Alzheimer's disease.

[0023] The present invention uses the miR-19899 cluster as described above as a detection target. By measuring the expression of the miR-19899 cluster in a sample, it is possible to screen and diagnose lipid metabolism-related diseases, and monitor the status of people with lipid metabolism-related diseases after treatment, enriching the diagnostic markers for Alzheimer's disease.

[0024] The present invention also provides the application of the miR-19899 cluster as described above or a substance overexpressing the miR-19899 cluster in the preparation of a drug for preventing and / or treating lipid metabolism-related diseases. As an implementation manner, the lipid metabolism-related diseases include Alzheimer's disease. By overexpressing miR-19899 or restoring the expression of miR-19899, the present invention can reduce the pathological process of lipid accumulation in AD and effectively prevent and treat lipid metabolism-related diseases including AD.

[0025] As an implementation manner, the drug includes one or both of 1) to 2): 1) A drug that inhibits the Rock2 / Plin4 signaling pathway in microglia and reduces lipid accumulation; the lipids include lipid droplets, triglycerides, and cholesterol; 2) A drug that promotes lipid metabolism; the lipids include lipid droplets, triglycerides, and cholesterol.

[0026] As an implementation manner, the active ingredient includes a chemical small molecule drug, a nucleic acid drug, and / or an antibody drug.

[0027] The present invention also provides a drug for treating lipid metabolism-related diseases, and the active ingredient of the drug comprises the miR-19899 cluster as described above or a substance overexpressing the miR-19899 cluster.

[0028] The present invention also provides a primer set for detecting the miR-19899 cluster as described above, and the primer set comprises a reverse transcription primer, an upstream primer and a downstream primer; The reverse transcription primer comprises a nucleotide sequence as shown in SEQ ID NO:2; SEQ ID NO:2: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACTACA-3'; The upstream primer comprises a nucleotide sequence as shown in SEQ ID NO:3; The downstream primer comprises a nucleotide sequence as shown in SEQ ID NO:4.

[0029] Forward primer (SEQ ID NO:3): 5'-CCTGCTGGTGACTCTCATTCCTT-3'; Reverse primer (SEQ ID NO:4): 5'-ATCCAGTGCAGGGTCCGAGG-3'.

[0030] The present invention also provides an application of the primer set in preparing a kit having one or more functions of detecting, diagnosing and monitoring the treatment status of lipid metabolism-related diseases; the monitoring of the treatment status includes the monitoring of the status during the treatment process and the prognosis monitoring.

[0031] The present invention also provides a lipid metabolism-related disease screening kit, and the kit comprises the primer set as described above.

[0032] Based on the discovery that the miR-19899 cluster can be used as a biomarker for Alzheimer's disease, the present invention can also be used as a molecular therapeutic target to develop drugs for treating lipid metabolism-related diseases. Through in-depth and systematic research on the functions of the microRNA of the miR-19899 cluster, it is found that down-regulating the miR-19899 cluster can induce the activation of lipid-accumulating microglia, and activate Rock2 / Plin4The signaling pathway regulates the expression of molecular markers related to lipid metabolism in microglia and promotes lipid accumulation. It can be seen that the down-regulation of the expression of microRNAs in the miR-19899 cluster activates microglia to present a lipid-accumulating type and promotes the inflammatory response. Therefore, overexpressing miR-19899 or restoring its expression can reduce the pathological process of lipid accumulation and effectively prevent and treat Alzheimer's disease. The present invention discovers the relationship between the miR-19899 cluster and Alzheimer's disease, provides a potential new target for reducing lipid accumulation, solves the problem of the lack of diagnostic markers for Alzheimer's disease at the gene level in the prior art, and helps to solve the current situation of the lack of effective targets for lipid metabolism treatment including Alzheimer's disease in the prior art.

[0033] To further illustrate the present invention, a miR-19899 cluster, a biomarker related to lipid metabolism diseases, and its application provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0034] Unless otherwise specified, the methods described in the present invention are all conventional operations in the art, and the time described in the present invention can be obtained conventionally or configured according to the product instructions by oneself.

[0035] Example 1 Detection of differentially expressed microRNAs in the pathological process of AD by miRNA high-throughput sequencing technology Using 5×FAD five-transgenic mice (denoted as 5×FAD mice, purchased from Zhishan (Beijing) Health Medical Research Institute) and wild mice (denoted as WT mice, purchased from Zhishan (Beijing) Health Medical Research Institute) as experimental materials, the mice were sacrificed by excessive inhalation of ether, the brain tissues of 7-month-old 5×FAD mice and WT mice were taken, the cerebral cortex and hippocampus were separated, immediately placed in liquid nitrogen, and transferred to a -80°C refrigerator for storage overnight. Using a sequencing technology combining bridge PCR and sequencing-by-synthesis, high-throughput genomics expression profile second-generation sequencing with "high throughput, high accuracy, and low cost" was carried out. The total RNA of the cerebral cortex and hippocampus of 5×FAD mice and WT mice was extracted by the Trizol method, and it was separated and a sequencing gene library was constructed. The constructed sample gene library was single-end sequenced using Illumina HiSeq 2500, the quality of the raw sequencing data was evaluated using FastQC, and miRNA was aligned with the reference genome, miRNA secondary structure analysis, and miRNA differential expression analysis were carried out through the miRDeep2 software. It was found that there were differentially expressed non-coding RNAs (such as Figure 1 shown, the results are expressed as mean ± SEM ( n =3)), denoted as miR-19899.

[0036] Among them, the nucleotide sequence of the precursor mir-19899 for synthesizing miR-19899 is shown in SEQ ID NO:1; miR-19899 is the mature form, and its nucleotide sequence is determined to be shown in SEQ ID NO:1; the reverse transcription primer sequence of miR-19899 is shown in SEQ ID NO:2.

[0037] The miR-19899 was detected by real-time fluorescence quantitative PCR (qRT-PCR), and the primer pairs for detecting miR-19899 are shown in SEQ ID NO:3 and SEQ ID NO:4 respectively.

[0038] The above steps were entrusted to Sangon Biotech (Shanghai) Co., Ltd.

[0039] Example 2 Expression changes of microRNAs in the miR-19899 cluster in Alzheimer's disease (AD) model cells (1) Using cell culture technology, transient transfection with polyethyleneimine (CAS: 49553-93-7, German Darmstadt Merck Group), antibiotic pressure screening, and limited dilution method to obtain monoclonal strains, and at the same time using Western Blot or ELISA for related protein detection to construct stably transfected human-mouse chimeric APP human neuroblastoma cells (APPswe cells) with genes, specifically referring to the literature (Wang, C. Y., et al. (2011). Huperzine A activates Wnt / β-catenin signaling and enhances the nonamyloidogenic pathway in an Alzheimer transgenic mouse model. Neuropsychopharmacology . 36(5), 1073–1089.).

[0040] (2)The APPswe cells constructed in step (1) were cultured in DMEM medium containing 10 v / v% FBS (fetal bovine serum) at 5% CO2 and 37°C. Puromycin was used to maintain the phenotypic traits of the stable transfected cell line. The concentration of puromycin in DMEM medium containing 10 v / v% FBS was 1 μg / ml. When the cell confluence reached 80%, the cells were treated with copper ions. The concentration of copper ions in DMEM medium containing 10 v / v% FBS was 200 μM. After treating the APPswe cells with copper ions, copper ions formed chelates with APP and Aβ, exacerbating the production and deposition of Aβ, inducing oxidative stress response and apoptosis of nerve cells. Therefore, the APPswe cells treated with copper ions can be used to simulate the pathological state of AD nerve cells and study the mechanism of drug action.

[0041] Total RNA of APPswe cells treated with copper ions for 0, 12, 24, 36, and 48 h was extracted using the Trizol method (ComWin Biotech kit, CW0581). Subsequently, reverse transcription reaction was carried out using the stem-loop method (Novizan Nanjing, MIR-101), and qRT-PCR technology of real-time fluorescence quantitative polymerase chain reaction (Novizan Nanjing, MQ-101) was used to quantitatively detect the expression level of miR-19899 in APPswe cells. The operation was carried out according to the instructions of the reagent manufacturer. The reverse transcription primer sequence was as shown in SEQ ID NO:2, the forward primer sequence for real-time fluorescence quantitative detection was as shown in SEQ ID NO:3, and the reverse primer sequence for real-time fluorescence quantitative detection was as shown in SEQ ID NO:4.

[0042] The detection results are as Figure 2 shown, where the results are presented as mean ± SEM ( n n = 3), * indicates compared with 0 h without adding copper ions, P < 0.05, ** indicates compared with 0 h, P < 0.01.

[0043] According to Figure 2 it can be seen that the cell damage induced by copper ion stimulation worsens with time, and the expression level of miR-19899 decreases accordingly, indicating that miR-19899 is down-regulated in the pathological process of AD.

[0044] (3)Mouse microglial EOC20 cells (purchased from ATCC, cat. no.: EOC20(CRL-2469)) were grown in DMEM conditioned medium containing 10 v / v% fetal bovine serum and 20 v / v% LADMAC medium at 5% CO2 and 37°C. The EOC20 cells were seeded at 1×10 5Inoculate at a density of U6 cells / mL in a six-well plate, and simultaneously add LPS at a final concentration of 500 ng / mL and 1000 ng / mL LPS. After 24 h, extract total cellular RNA using the Trizol method (ComWin Biotech kit, CW0581), reverse transcribe (Novizan, Nanjing, R323), and perform real-time fluorescence quantitative polymerase chain reaction (Novizan, Nanjing, Q711). Using U6 gene as an internal reference, the expression level of miR-19899 in the neuroinflammatory cell model was detected by reverse transcription and real-time fluorescence quantitative detection using qRT-PCR technology, where: U6 The sequence of the U6 gene is shown in SEQ ID NO:5,

[0045] SEQ ID NO:5: 5'-gtcccttcggggacatccgataaaattggaacgatacagagaagattagcatggcccctgcgcaaggatgacacgcacaaatcgagaaatggtccaaaatttt-3'; SEQ ID NO:6: 5'-GTCGTATCCAGTGCAGGGTCCGAGG TATTCGCACTGGATACGACAAAATA-3'; SEQ ID NO:7: 5'-CAAATTCGTGAAGCGTTCCA-3'; SEQ ID NO:8: 5'-AGTGCAGGGTCCGAGGTATT-3'.

[0046] The reverse transcription primer sequence is shown in SEQ ID NO:2, the forward primer sequence for real-time fluorescence quantitative detection is shown in SEQ ID NO:3, and the reverse primer sequence for real-time fluorescence quantitative detection is shown in SEQ ID NO:4.

[0047] The detection results are as shown in Figure 3 , where the results are expressed as mean ± SEM ( n =3), ** indicates P <0.01 compared with the resting microglia treatment group, P *** indicates

[0048] <0.001 compared with the resting microglia treatment group. Figure 3 It can be seen that the expression level of miR-19899 in the inflammatory cell model decreased significantly.

[0049] Example 3 Expression changes of microRNAs in the miR-19899 cluster in animal models of Alzheimer's disease (AD) Taking 5×FAD five-transgenic mice at 3, 6, 7, 9, and 12 months of age as the experimental group (denoted as 5×FAD mice, purchased from Zhishan (Beijing) Health Medical Research Institute), and wild-type control mice at 3, 6, 7, 9, and 12 months of age as the control group (denoted as WT mice, purchased from Zhishan (Beijing) Health Medical Research Institute), the mice were sacrificed using an anesthesia method. The cerebral cortex and hippocampal brain tissues of 5×FAD mice and WT mice at 3, 6, 7, 9, and 12 months of age were rapidly isolated on ice. After freezing in liquid nitrogen, the total mRNA of the cerebral cortex and hippocampal brain tissues of 5×FAD mice and WT mice was extracted using the Trizol method respectively. The concentration and purity of the total RNA were measured using ultraviolet spectrophotometry, and the expression changes of miR-19899 in the AD pathological process were detected using qRT-PCR technology. The results are as Figure 4 and Figure 5 shown, where Figure 4 is the detection result of the mouse cerebral cortex, Figure 5 is the detection result of the hippocampal brain tissue. Figure 4 and Figure 5 The results shown are expressed as mean ± SEM ( n = 3), and * indicates that compared with WT mice, P < 0.05.

[0050] According to Figure 4 and Figure 5 it can be seen that the expression level of miR-19899 in the cerebral cortex and hippocampal brain tissues of 5×FAD mice was significantly decreased at 7, 9, and 12 months compared with that of WT mice of the same age.

[0051] Example 4 Expression changes of microRNAs in the miR-19899 cluster in the serum of AD patients Collect the sera of 13 AD patients and 12 normal peers of the same age (denoted as HAVs). Using these as experimental materials, the total RNA of the patients and normal peers was extracted, the RNA concentration and purity were verified using ultraviolet spectrophotometry, and the content of miR-19899 in the sera of AD patients was detected using qRT-PCR technology. The ROC curve was used to analyze the ability of differentially expressed miR-19899 as a diagnostic indicator to distinguish between AD patients and healthy people. The results are as Figure 6 and Figure 7 shown, where Figure 6 is the detection result of the qRT-PCR technology. The results are expressed as mean ± SEM ( n ≥ 12), and ** indicates that compared with HAVs,P <0.01; Figure 7 This is the result of ROC curve analysis, where the area under the ROC curve is AUC = 0.80 (CI: 0.800 - 1.00, P <0.01), the sensitivity is 69.2%, and the specificity is 83.3%.

[0052] According to Figure 6 and Figure 7 it can be seen that the relative expression level of miR-19899 in the blood of AD patients is significantly decreased, and both the sensitivity and specificity detected by the ROC curve are relatively high. Using the differential relative expression of miR-19899 as a diagnostic method can effectively distinguish patients from healthy people with high accuracy.

[0053] Example 5 Expression levels of microRNAs in the miR-19899 cluster in different tissues of wild-type mice Taking 7-month-old wild-type mice (denoted as WT mice, purchased from Zhishan (Beijing) Health Medical Research Institute) as the research objects, the mice were sacrificed using an anesthetic method. The brain tissues, livers, spleens, kidneys, lungs, hearts, stomachs, thymuses, tracheas, skins, fats, muscles, eyes, intestines, bone tissues and sera of 7-month-old WT mice were quickly isolated on ice. After being frozen in liquid nitrogen, the total mRNAs of different tissues of WT mice were extracted using the Trizol method respectively. The concentration and purity of the total RNA were determined using ultraviolet spectrophotometry, and the expression changes of miR-19899 in different tissues were detected using qRT-PCR technology. The results are as Figure 8 shown. Figure 8 The results shown are presented as mean ± SEM ( n = 3).

[0054] According to Figure 8 it can be seen that the expression of miR-19899 is mainly enriched in brain tissues. Secondly, miR-19899 is highly expressed in lipid-rich organs such as the heart and liver.

[0055] Example 6 Effects of dysregulated expression of microRNAs in the miR-19899 cluster on lipid accumulation in resting and activated microglia (1) Based on miRNA inhibitors (inhibitor), a miRNA knockout model of resting and activated microglia was constructed using the polyethyleneimine transient transfection technique. The following operations were designed and synthesized by Sangon Biotech (Shanghai) Co., Ltd.: The EOC20 mouse microglia were evenly divided into 4 groups, and the following operations were performed respectively: NCI group: Transiently transfected with 50 nM miRNA irrelevant sequence negative control using polyethyleneimine. The NCI sequence of the miRNA irrelevant sequence negative control is as shown in SEQ ID NO:9: SEQ ID NO:9: 5'-CAGUACUUUUGUGUAGUACAA-3'; NCI + LPS group: On the basis of the NCI group, lipopolysaccharide (LPS) was added to the culture medium, and the concentration of LPS in the culture medium was 500 ng / mL; miR-19899 inhibitor group: Transiently transfected with 50 nM miR-19899 inhibitor using polyethyleneimine. The miR-19899 inhibitor is the sequence of SEQ ID NO:10 modified by / i2OMe methylation. The nucleotide sequence of SEQ ID NO:10 before methylation modification is as follows: SEQ ID NO:10: 5'-ACUACAGAAAGGAAUGAGAGUCA-3'; miR-19899 inhibitor + LPS group: On the basis of the miR-19899 inhibitor group, LPS was added to the culture medium, and the concentration of LPS in the culture medium was 500 ng / mL.

[0056] After the treatment of each treatment group, the cells were incubated at 37°C. After 36 h, the cells in different groups were stained with DAPI (4’,6-diamidino-2-phenylindole, CAS: 28718-90-3, Shanghai Haoyuan Biomedical Technology Co., Ltd.) and BODIPY (boron dipyrromethene difluoride, CAS: 121207-31-6, Shanghai Haoyuan Biomedical Technology Co., Ltd.) dyes to examine the lipid change levels.

[0057] (2) After the end of step (1), laser confocal microscopy was used to detect the lipid-related change indexes of microglia. The results are as Figures 9 - 12 shown, where Figure 9 is the level of lipid droplet changes in resting and activated microglia with down-regulated miR-19899; Figure 10 is a representative picture of lipid droplet changes in resting and activated microglia with down-regulated miR-19899; Figure 11 is the level of lipid droplet changes in resting and activated microglia with up-regulated miR-19899; Figure 12 is a representative picture of lipid droplet changes in resting and activated microglia with up-regulated miR-19899. Figure 9 and Figure 11The results are presented as mean ± SEM (n > 25). *, **, and *** indicate P < 0.05, P < 0.01, and P < 0.001, respectively, when comparing two different treatment groups. **** indicates P < 0.0001 when compared with NCI. Figure 10 and Figure 12 In Figure 12 , DAPI represents the representative image of cell morphology after staining cells with DAPI dye; BODIPY represents the representative image of lipid droplet changes after staining cells with BODIPY dye, and Merge represents the representative image of lipid droplet changes in each cell after merging the staining results of DAPI and BODIPY.

[0058] According to Figures 9 - 12 It can be seen that inhibiting the expression of miR-19899 induces lipid accumulation in resting and activated microglia, while overexpressing miR-19899 alleviates lipid accumulation in resting and activated microglia.

[0059] Example 7 Prediction of microRNA target genes of miR-19899 cluster Use the bioinformatics software miRDB to predict the potential binding targets of miR-19899, and use the DAVID and Metascape online software to perform KEGG pathway enrichment analysis and GO analysis on the predicted binding genes of miR-19899. The results are as Figures 13 - 15 shown. According to Figures 13 - 15 It can be seen that the target genes of miR-19899 are enriched in pathways related to inflammation, nerves, and lipid metabolism, suggesting that miR-19899 may have a regulatory effect on the immune metabolism pathway.

[0060] Example 8 Specific regulation of microRNA of miR-19899 cluster at the translational level Rock2 and Plin4 expression of Construct miRNA mimics / inhibitor according to the overexpression / silencing miRNA technical method shown in step (3) of Example 2. Use the polyethyleneimine transient transfection technique to establish a neuron cell model with overexpressed or knocked-down miR-19899. The specific operation is as follows: Divide neuron cells (APPwse cells) into 4 groups on average, and label them as NCM group, NCI group, miR-19899 mimics group, and miR-19899 inhibitor group in sequence; NCM group: Transiently transfect 50 nM miRNA irrelevant sequence negative control using polyethyleneimine. Among them, the sequences of NCM are shown in SEQ ID NO:11 and SEQ ID NO:12: Sense (SEQ ID NO:11): 5'-UUGUACUACACAAAAGUACUG-3'; Antisense (SEQ ID NO:12): 5'-GUACUUUUGUGUAGUACAAUU-3'; NCI group: Transiently transfected with 50 nM miRNA irrelevant sequence negative control using polyethyleneimine, and the NCI sequence is shown in SEQ ID NO:9; miR-19899 mimics group: Transiently transfected with 50 nM miR-19899 mimics using polyethyleneimine. Among them, the sequences of miR-19899 mimics are shown in SEQ ID NO:13 and SEQ ID NO:14; Sense (SEQ ID NO:13): 5'-UGACUCUCAUUCCUUUCUGUAGU-3'; Antisense (SEQ ID NO:14): 5'-UACAGAAAGGAAUGAGAGUCAUU-3'; miR-19899 inhibitor group: Transiently transfected with 50 nM miR-19899 inhibitor using polyethyleneimine, and the sequence of miR-19899 inhibitor is shown in SEQ ID NO:10.

[0061] After 36 h of transfection, qRT-PCR was used to detect the miR-19899 target gene Rock2 and Plin4 expression. The results are shown in Figure 16 and Figure 17 . Among them, the results are expressed as mean ± SEM ( n =3), ** indicates a comparison between two different treatment groups, P <0.01, *** indicates P <0.001, **** indicates P <0.0001.

[0062] The procedure of qRT-PCR is as follows: (1) Total RNA extraction and reverse transcription APPswe cells: APPswe cells with different Cu 2+ stimulation durations of 0 h, 12 h, 24 h, 36 h, and 48 h in a six-well plate were used for total RNA extraction. The culture medium was aspirated, and 1 mL of TRIzon reagent was added to each six-well plate, and the cells were lysed by repeated pipetting.

[0063] Brain tissue: Mice were anesthetized and sacrificed. The mouse brains were isolated on ice and the hippocampus and cortex were distinguished, then quickly frozen in liquid nitrogen and subsequently transferred to -80 °C for storage. 1 mL of TRIzon reagent was added to every 50 mg of the sample, and homogenized in an ice bath for 40 s. The cell and tissue samples containing TRIzon were collected in 1.5 mL RNase-free centrifuge tubes and left standing at room temperature for 5 min to fully dissociate and release the nucleic acids.

[0064] (2)RNA isolation 200 μL of chloroform was added to each tube, shaken vigorously for 15 s, and left standing at room temperature for 2 min to denature the protein and separate the organic and aqueous phases. Subsequently, it was centrifuged at 12000 rpm (~13400×g) at 4 °C for 10 min. The upper aqueous phase containing RNA was collected and transferred to a new RNase-Free centrifuge tube, removing the middle and lower organic phases containing denatured protein and high molecular weight DNA molecules.

[0065] (3)Adsorption Isopropanol (600 μL of isopropanol corresponding to every 1 mL of Trizol) was added to the collected upper aqueous phase, inverted up and down 10 times, left standing for 10 min, centrifuged at 12000 rpm at 4 °C for 10 min, and the supernatant was discarded.

[0066] (4)Purification 1 mL of 75% ethanol was added to each centrifuge tube, centrifuged at 12000 rpm at 4 °C for 2 min, and the supernatant was discarded. This step was repeated 2 times.

[0067] (5)Elution After the centrifuge tube was completely air-dried, an appropriate amount (20 - 100 μL) of RNase-free water was added, left standing at room temperature for 3 min, and then the RNA concentration and purity were detected using a Spark microplate reader. The samples were immediately used for experiments or stored at -80 °C.

[0068] (6)mRNA cDNA strand synthesis was carried out according to the Nanjing Novizan HiScript III 1st Strand cDNA Synthesis Kit. The experiment was carried out on ice and divided into two steps: first, genomic DNA was removed, and second, the cDNA synthesis reaction was carried out.

[0069] ① Genomic DNA removal: The following reagents shown in Table 1 were added to an RNase-free PCR tube, and each component was pipetted and mixed well, and then reacted in a 42 °C water bath for 2 min.

[0070] Table 1 Reagents for genomic DNA removal

[0071] ② cDNA synthesis reaction: Prepare the mixture in Table 2 below, and pipette to mix well.

[0072] Table 2 Reagents for cDNA synthesis

[0073] The reaction is carried out under the conditions shown in Table 3: Table 3 Conditions for cDNA synthesis

[0074] (7)qRT-PCR reaction Use ChamQ Universal SYBR qPCR Master Mix from Nanjing Novizan for qPCR detection. Prepare a reaction system of 20 µL per well according to the ratio shown in Table 4, and set 3 replicates for each sample: Table 4 qPCR reaction system

[0075] The qPCR primer sequences are shown in Table 5: Table 5 qPCR primer sequences

[0076] According to Figure 16 and Figure 17 it can be seen that overexpression of miR-19899 will inhibit the Rock2 and Plin4 expression in the neuron cell model, while knockdown of miR-19899 can promote the Rock2 and Plin4 expression in the neuron cell model.

[0077] Example 9 Specific regulation of microRNA in the miR-19899 cluster at the translational level Rock2 and Plin4 expression Based on miRNA mimics / inhibitor, use the polyethyleneimine transient transfection technique to establish a microglial cell (mouse microglial cell EOC20 cell) model with overexpression or knockdown of miR-19899.

[0078] Specifically: Divide the microglial cells into 4 groups on average according to the method shown in Example 7, and record them as the NCM group, NCI group, miR-19899 mimics group, and miR-19899 inhibitor group in sequence, and transfect the corresponding miRNA; After 36 h of transfection, detect the miR-19899 target gene according to the qRT-PCR detection method shown in Example 7Rock2 and Plin4 expression conditions, and the results were as Figure 18 and Figure 19 . Among them, the results were expressed as mean ± SEM ( n = 3), * indicates a comparison between two different treatment groups, P <0.05, ** indicates P <0.01, *** indicates P <0.001.

[0079] According to Figure 18 and Figure 19 it can be seen that overexpression of miR-19899 inhibits Rock2 and Plin4 expression in the microglia model, while knockdown of miR-19899 can promote Rock2 and Plin4 expression in the microglia model.

[0080] Example 10 Binding of microRNA in the miR-19899 cluster to its target genes Rock2 and Plin4 According to the steps of Example 6, a cell model with overexpression or knockdown of miR-19899 was constructed by polyethyleneimine transfection technology, and the binding of miR-19899 to its target genes Rock2 and Plin4 was detected by the dual-luciferase reporter gene technology. The results were as Figures 20 - 21 shown, where Figure 20 represents the direct binding effect of miR-19899 to the 3'UTR of its target gene Rock2 Figure 21 ; Figure 21 represents the direct binding effect of miR-19899 to the 3'UTR of its target gene Plin4 Plin4 Figures 20 - 21 The results were expressed as mean ± SEM ( n = 3), * indicates compared with NCM, P <0.05.

[0081] According to Figures 20 - 21 it can be seen that miR-19899 can directly bind to its target genes Rock2 and Plin4 .

[0082] In summary, the miR-19899 provided by the present invention is significantly decreased in the pathological process of Alzheimer's disease. The ROC curve based on the serum expression level shows that miR-19899 has a good diagnostic effect and can be used as a biomarker for detecting AD, and negatively regulates Rock2 andPlin4 Gene expression. Inhibiting miR-19899 expression activates microglial lipid accumulation, while overexpressing miR-19899 reduces microglial lipid accumulation and alleviates AD symptoms.

[0083] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments without creative efforts as in this embodiment, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A biomarker miR-19899 cluster related to lipid metabolism diseases, characterized in that, The miR-19899 cluster includes miR-19899, and the nucleotide sequence of miR-19899 is shown in SEQ ID NO:

1.

2. Use of a substance for detecting the miR-19899 cluster according to claim 1 in the preparation of a kit having one or more functions in the detection, diagnosis, and monitoring of treatment conditions of lipid metabolism-related diseases; The monitoring of the treatment conditions includes the monitoring of the conditions during the treatment process and the prognosis monitoring.

3. Use of the miR-19899 cluster according to claim 1 or a substance overexpressing the miR-19899 cluster according to claim 1 in the preparation of a drug for preventing and / or treating lipid metabolism-related diseases.

4. The application according to claim 2 or 3, characterized in that, The lipid metabolism-related diseases include Alzheimer's disease.

5. The application according to claim 3, characterized in that, The drug includes one or both of 1) to 2): 1) A drug that inhibits the Rock2 / Plin4 signaling pathway and reduces lipid accumulation; the lipids include lipid droplets, triglycerides, and cholesterol; 2) A drug for improving lipid metabolism; the lipids include lipid droplets, triglycerides, and cholesterol.

6. A drug for treating lipid metabolism-related diseases, characterized in that, The active ingredient of the drug includes the miR-19899 cluster according to claim 1 or a substance overexpressing the miR-19899 cluster according to claim 1.

7. A primer set for detecting the miR-19899 cluster according to claim 1, characterized in that, The primer set includes a reverse transcription primer, an upstream primer, and a downstream primer; The reverse transcription primer includes the nucleotide sequence shown in SEQ ID NO:2; The upstream primer includes the nucleotide sequence shown in SEQ ID NO:3; The downstream primer includes the nucleotide sequence shown in SEQ ID NO:

4.

8. Use of the primer set according to claim 7 in the preparation of a kit having one or more functions in the detection, diagnosis, and monitoring of treatment conditions of lipid metabolism-related diseases; The monitoring of the treatment conditions includes the monitoring of the conditions during the treatment process and the prognosis monitoring.

9. A kit for screening lipid metabolism-related diseases, characterized in that, The kit includes the primer set according to claim 7.

Images