Kit for detecting breast cancer methylation marker and application thereof

By detecting the methylation markers of ENPP2 and NPTX2 genes in breast cancer patients, specific PCR technology is used to solve the problems of false positive and false negative in breast cancer detection, and achieve high sensitivity and high specificity of breast cancer diagnosis.

CN120272592APending Publication Date: 2025-07-08WUHAN AIMISEN LIFE TECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311641063.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-11-30
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

In the prior art, false positive and false negative results are prone to detect breast cancer, especially when triple negative and HER-2 positive breast cancer, and the detection accuracy is low.

Method used

A kit is provided to distinguish methylated and unmethylated DNA sequences by detecting methylation markers of the ENPP2 gene and NPTX2 gene, including specific target regions and corresponding primer pairs and detection probes.

Benefits of technology

It improves the sensitivity and specificity of breast cancer detection, especially for malignant breast cancer detection, with a sensitivity of 85.71%-94.29% and a specificity of 91.07%-94.7%, effectively avoiding false positive and false negative results and improving the detection accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272592A_ABST
    Figure CN120272592A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to a kit for detecting a breast cancer methylation marker and application of the kit. The kit provided by the invention has a better detection effect on four types of breast cancer by detecting the methylation level of a combination of the ENPP2 gene and the NPTX2 gene in a sample, and the detection sensitivities of the kit to breast cancer types with higher malignancy and poor prognosis of three-negative and HER-2 positive tumors can reach 94.29% and 93.75% respectively; the kit has relatively high detection specificity for mammary gland fibroma patients, mammary gland hyperplasia patients, mammary cyst patients and healthy people, detection of false negative and false positive results can be effectively avoided, and the detection accuracy is high.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and more specifically, relates to a kit for detecting breast cancer methylation markers and its application. Background Art

[0002] Breast cancer is classified into luminal A type (both ER and PR are highly expressed, HER-2 is negative, Ki67 is lowly expressed), luminal B type (ER and / or PR are positive, HER-2 is negative, Ki67 is highly expressed), triple-negative type (ER, PR, and HER-2 are all negative), and HER-2 positive type (ER and PR are negative, HER-2 is positive) according to the expression of immunohistochemical indexes. Luminal breast cancer has relatively low tumor malignancy, is sensitive to endocrine therapy, has obvious treatment effects, and relatively good prognosis, especially for luminal A breast cancer with high expression of ER and PR and low expression of Ki-67. Triple-negative breast cancer has no effect on targeted therapy and endocrine therapy due to the lack of ER and PR and the expression of HER-2, and triple-negative breast cancer is prone to early recurrence and metastasis, with relatively poor prognosis. HER-2 positive breast cancer has relatively high tumor malignancy and poor prognosis due to the overexpression of HER-2.

[0003] Currently, the treatment of breast cancer mainly depends on molecular typing, including comprehensive treatment such as surgery, radiotherapy, chemotherapy, targeted therapy, immunotherapy, and endocrine therapy. Early breast cancer can be cured, and advanced patients can also obtain considerable disease remission and survival after comprehensive treatment. Therefore, early diagnosis and early treatment are the keys to improving the survival and efficacy of breast cancer patients. Summary of the Invention

[0004] Aiming at the defects of the prior art, the purpose of the present invention is to provide a kit for detecting breast cancer methylation markers and its application, so as to improve the technical problems in the prior art for breast cancer detection, especially the easy occurrence of false positive and false negative results and low detection accuracy in the detection of triple-negative breast cancer and HER-2 positive breast cancer.

[0005] To achieve the above purpose, the present invention provides a breast cancer methylation marker, including ENPP2 gene and NPTX2 gene.

[0006] Preferably, the above breast cancer methylation marker includes at least one of target region G1 and target region G2 in the ENPP2 gene, and also includes at least one of target region G3 and target region G4 in the NPTX2 gene.

[0007] Further preferably, using GRCh38.p14 as the reference genome, the target region G1 is selected from Chr8:119638645-119638839, the target region G2 is selected from Chr8:119672875-119672976, the target region G3 is selected from Chr7:98616603-98616819, and the target region G4 is selected from Chr7:98616640-98616763.

[0008] The present invention also provides a kit for detecting the above-mentioned breast cancer methylation markers, which includes primer pairs for detecting the methylation levels of the above-mentioned breast cancer methylation markers.

[0009] Preferably, the above primer pairs include at least one of the first primer pair for detecting the methylation level of the above target region G1 and the second primer pair for detecting the methylation level of the above target region G2, and also include at least one of the third primer pair for detecting the methylation level of the above target region G3 and the fourth primer pair for detecting the methylation level of the above target region G4.

[0010] Preferably, the nucleotide sequences of the above first primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequences of the above second primer pair are shown in SEQ ID NO.8 and SEQ ID NO.9, the nucleotide sequences of the above third primer pair are shown in SEQ ID NO.13 and SEQ ID NO.14, and the nucleotide sequences of the above fourth primer pair are shown in SEQ ID NO.16 and SEQ ID NO.17.

[0011] Preferably, the above kit further includes detection probes corresponding to the above primer pairs; wherein,

[0012] The nucleotide sequence of the first detection probe corresponding to the above first primer pair is shown in SEQ ID NO.5, the nucleotide sequence of the second detection probe corresponding to the above second primer pair is shown in SEQ ID NO.10, the nucleotide sequence of the third detection probe corresponding to the above third primer pair is shown in SEQ ID NO.15, and the nucleotide sequence of the fourth detection probe corresponding to the above fourth primer pair is shown in SEQ ID NO.18.

[0013] Preferably, the 5' end of the above detection probe contains a fluorescent reporter group, and the 3' end contains a fluorescent quenching group.

[0014] Preferably, the above kit further includes one or more of detection primer pairs and detection probes for internal reference genes, nucleic acid extraction reagents, nucleic acid purification reagents, methylation conversion reagents, PCR reaction reagents, and quality control products.

[0015] The present invention also provides the application of the above-mentioned kit in the preparation of breast cancer diagnostic products.

[0016] Preferably, the above-mentioned breast cancer includes at least one of triple-negative breast cancer and HER-2 positive breast cancer; the above-mentioned breast cancer diagnostic products include one or more of a kit, a chip, and a sequencing library.

[0017] Generally speaking, compared with the prior art by the above technical solution conceived by the present invention, the following

[0018] Advantageous effects are achieved:

[0019] A kit for detecting breast cancer methylation markers provided by the present invention has good detection effects on four subtypes of breast cancer (including luminal A, luminal B, triple-negative, and HER-2 positive) by detecting the methylation levels of the ENPP2 gene and the NPTX2 gene combination in a sample. Specifically, the detection sensitivities for the two types of breast cancer with higher malignancy and poor prognosis, triple-negative breast cancer and HER-2 positive breast cancer, are 85.71% - 94.29% and 90.63% - 93.75% respectively, which can effectively avoid the detection of false negative results. In addition, the specificity of this kit for detecting plasma samples of patients with breast benign tumors (including patients with breast fibroids, breast hyperplasia, and breast cysts) can reach 91.07%, and the specificity for detecting plasma samples of healthy people can reach 94.7%, which can effectively avoid the detection of false positive results and avoid over-treatment of breast benign tumors, with high detection accuracy. Description of the Drawings

[0020] Figure 1 are the methylation levels of the ENPP2 gene and the NPTX2 gene in breast cancer patients and healthy people;

[0021] Figure 2 are the performances of the combined detection of target region G1 + target region G3 for training set samples and test set samples, where content a is the training set samples and content b is the test set samples;

[0022] Figure 3 are the performances of the combined detection of target region G1 + target region G4 for training set samples and test set samples, where content a is the training set samples and content b is the test set samples;

[0023] Figure 4 are the performances of the combined detection of target region G2 + target region G3 for training set samples and test set samples, where content a is the training set samples and content b is the test set samples;

[0024] Figure 5 are the performances of the combined detection of target region G2 + target region G4 for training set samples and test set samples, where content a is the training set samples and content b is the test set samples. Detailed implementation manners

[0025] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0026] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the description of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention. Unless otherwise specified, the raw materials and reagents used in the following embodiments are all commercially available products or can be prepared by methods known in the art.

[0027] The term "subject" refers to an object that is observed, detected or experimented on. In some embodiments, the subject can be a mammal. Mammals include, but are not limited to, primates (including humans and non-human primates) and rodents (e.g., mice and rats). In some embodiments, the mammal can be a human.

[0028] The term "diagnosis" refers to determining the health status of a subject, covering aspects such as detecting the presence or absence of a disease, response to treatment means, assessment of recurrence risk, assessment of cancer risk and degree of canceration, and prognosis judgment. In some cases, the term "diagnosis" refers to being used as a single factor to determine, verify or confirm the clinical status of a patient, and "auxiliary diagnosis" is used to provide various information to assist in judgment during the determination or verification of the patient's clinical status and is not used as the only determining indicator. In some embodiments, "detecting" breast cancer refers to detecting the presence or absence of the disease, that is, determining whether the subject has breast cancer.

[0029] The term "oligonucleotide" or "polynucleotide" or "nucleotide" or "nucleic acid" refers to a molecule having two or more deoxyribonucleotides or ribonucleotides, preferably more than three, and usually more than ten. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. Oligonucleotides can be produced in any manner, including chemical synthesis, DNA replication, reverse transcription, or a combination thereof. The typical deoxyribonucleotides of DNA are thymine, adenine, cytosine, and guanine. The typical ribonucleotides of RNA are uracil, adenine, cytosine, and guanine.

[0030] The term "methylation" refers to a form of chemical modification of DNA that can alter genetic expression without changing the DNA sequence. DNA methylation refers to the covalent binding of a methyl group to the 5th carbon position of cytosine in genomic CpG dinucleotides under the action of DNA methyltransferase. DNA methylation can cause changes in chromatin structure, DNA conformation, DNA stability, and the way DNA interacts with proteins, thereby controlling gene expression.

[0031] The term "methylation level" refers to whether cytosine in one or more CpG dinucleotides in a DNA sequence is methylated, or the frequency / ratio / percentage of methylation, representing both qualitative and quantitative concepts. In practical applications, different detection indicators can be used to compare DNA methylation levels according to actual situations. For example, in some cases, comparison can be made based on the Ct value detected in the sample; in some cases, the proportion of gene methylation in the sample can be calculated, i.e., the number of methylated molecules / (the number of methylated molecules + the number of non-methylated molecules) × 100%, and then comparison can be made; in some cases, statistical analysis and integration of each indicator are also required to obtain the final determination indicator.

[0032] The term "methylation marker" or "marker" refers to a genetic indicator that can mark changes or potential changes in the structure or function of a system, organ, tissue, cell, and subcellular structure, and can be used for disease diagnosis, determination of disease stage, or evaluation of the safety and effectiveness of new drugs and new therapies in the target population.

[0033] The term "primer" refers to an oligonucleotide that can be used in an amplification method (such as polymerase chain reaction PCR) to amplify a target sequence based on a polynucleotide sequence corresponding to the target gene or a part of its region. Usually, at least one of the PCR primers used to amplify a polynucleotide sequence is sequence-specific for that polynucleotide sequence. The exact length of the primer depends on many factors, including temperature, primer source, and the method used, etc. For example, for diagnostic and prognostic applications, depending on the complexity of the target sequence, oligonucleotide primers usually contain at least 10, 15, 20, 25 or more nucleotides, but can also contain fewer nucleotides. In the disclosure of the present invention, the term "primer" refers to a pair of primers that can hybridize with the double strand of the target DNA molecule or with the regions flanking the nucleotide sequence to be amplified in the target DNA molecule. A "primer pair" refers to a group consisting of an upstream primer and a downstream primer.

[0034] The term "methylation-specific PCR" is one of the most sensitive experimental techniques for studying methylation at present and can detect methylation in as little as about 50 pg of DNA. After single-stranded DNA is converted by bisulfite, all unmethylated cytosines are deaminated and converted to uracil, while methylated cytosines in CpG sites remain unchanged. Therefore, by designing two pairs of primers targeting methylated and unmethylated sequences respectively, methylated and unmethylated DNA sequences can be distinguished through PCR amplification.

[0035] The term "quantitative methylation-specific PCR (qMSP)" is an experimental technique that combines fluorescence quantitative PCR technology and methylation-specific PCR technology. This technique also designs appropriate primer pairs based on the sequence differences of DNA with different methylation states after bisulfite conversion to distinguish methylated and unmethylated sequences. However, the final detection index of qMSP is the fluorescence signal. Therefore, in the qMSP reaction system, in addition to adding methylation detection primers, a fluorescence probe or a fluorescent dye also needs to be added. Compared with the traditional methylation-specific PCR technology, qMSP has higher sensitivity and specificity in detecting DNA methylation levels, is more suitable for detecting trace abnormally methylated DNA fragments mixed in the DNA of early-stage cancer patients, and this technique does not require gel electrophoresis detection and is more convenient to operate. In the disclosure of this application, when performing real-time quantitative methylation-specific PCR, methylation primers are added. If the Ct value meets the requirements (for example, Ct ≤ 45 in plasma samples), it indicates that the target sequence is methylated.

[0036] The term "TaqMan probe" refers to an oligonucleotide sequence containing a 5'-fluorescent group and a 3'-quenching group. When the probe binds to the corresponding site on the DNA, since the quenching group is near the fluorescent group, the probe does not emit fluorescence. During the amplification process, if the probe binds to the amplified strand, the 5'-3' exonuclease activity of DNA polymerase (such as Taq enzyme) will digest the probe, and the fluorescent group will be far away from the quenching group, and its energy will not be absorbed, that is, a fluorescent signal is generated. After each PCR cycle, the fluorescent signal, like the target fragment, has a synchronous exponential growth process.

[0037] ENPP2 gene: The protein encoded by this gene can act as a phosphodiesterase to cleave the phosphodiester bond at the 5' end of oligonucleotides, and can also act as a phospholipase to catalyze the production of lysophosphatidic acid (LPA) in extracellular fluid. LPA causes growth factor-like responses, including stimulating cell proliferation and chemotaxis. The gene product stimulates the movement of tumor cells and has angiogenic properties, and its expression is upregulated in several cancers.

[0038] NPTX2 gene: This gene encodes a protein of the neuritin family. This protein is a synaptic protein related to C-reactive protein, which is involved in the formation of excitatory synapses and also in the clustering of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA)-type glutamate receptors on established synapses, leading to non-apoptotic cell death of dopaminergic neurons.

[0039] The present invention provides a breast cancer methylation marker, including the ENPP2 gene and the NPTX2 gene.

[0040] In some embodiments, the above-mentioned breast cancer methylation marker includes at least one of target region G1 and target region G2 in the ENPP2 gene, and also includes at least one of target region G3 and target region G4 in the NPTX2 gene.

[0041] In some embodiments, with GRCh38.p14 as the reference genome, the above-mentioned target region G1 is selected from Chr8:119638645-119638839, the above-mentioned target region G2 is selected from Chr8:119672875-119672976, the above-mentioned target region G3 is selected from Chr7:98616603-98616819, and the above-mentioned target region G4 is selected from Chr7:98616640-98616763.

[0042] The present invention also provides a kit for detecting the above-mentioned breast cancer methylation marker, which includes primer pairs for detecting the methylation level of the above-mentioned breast cancer methylation marker.

[0043] In some embodiments, the above-mentioned primer pairs include at least one of the first primer pair for detecting the methylation level of the above-mentioned target region G1 and the second primer pair for detecting the methylation level of the above-mentioned target region G2, and also include at least one of the third primer pair for detecting the methylation level of the above-mentioned target region G3 and the fourth primer pair for detecting the methylation level of the above-mentioned target region G4.

[0044] In a preferred embodiment, the above-mentioned primer pairs include at least one of the first primer pair for detecting the methylation level of the above-mentioned Chr8:119638645-119638839 and the second primer pair for detecting the methylation level of the above-mentioned Chr8:119672875-119672976, and also include at least one of the third primer pair for detecting the methylation level of the above-mentioned Chr7:98616603-98616819 and the fourth primer pair for detecting the methylation level of the above-mentioned Chr7:98616640-98616763.

[0045] In some embodiments, the nucleotide sequences of the above-mentioned first primer pair are shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequences of the above-mentioned second primer pair are shown in SEQ ID NO.8 and SEQ ID NO.9, the nucleotide sequences of the above-mentioned third primer pair are shown in SEQ ID NO.13 and SEQ ID NO.14, and the nucleotide sequences of the above-mentioned fourth primer pair are shown in SEQ ID NO.16 and SEQ ID NO.17. It should be noted that if a primer pair has at least 85% (such as 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%, etc.) or more sequence identity with the nucleotide sequences shown by the above-mentioned primer pairs (the first primer pair, the second primer pair, the third primer pair, the fourth primer pair), and this primer pair also has a certain breast cancer diagnostic function (compared with the primer pairs of the present application, the specificity or sensitivity is equivalent, slightly decreased, slightly increased, or greatly increased, etc.), it is also within the protection scope of the present invention.

[0046] With the in-depth research in the field of molecular biology, it has been found that abnormal regulation other than DNA sequences is more common in the occurrence and development of tumors. This heritable regulation that does not depend on DNA sequence changes is called epigenetic alteration, which mainly includes DNA methylation, histone modification, gene imprinting, and microRNA regulation, etc. As a potential biomarker and drug target, epigenetics has been increasingly valued in the field of tumor prevention and treatment, and one of its main forms is DNA methylation. DNA methylation refers to the process in which an organism, under the catalysis of DNA methyltransferase (DNMT), uses S-adenosylmethionine (SAM) as a methyl donor to transfer a methyl group to a specific base. DNA methylation can occur at the C5 position of cytosine, the N6 position of adenine, the N4 position of cytosine, or the N7 position of guanine, etc. DNA methylation is an early event in tumorigenesis and plays an important role in the occurrence and development of tumors. And the present application constructs corresponding primer pairs and combined detection strategies for specific breast cancer methylation markers (ENPP2 gene and NPTX2 gene) to obtain a new diagnostic strategy.

[0047] In some embodiments, by jointly detecting the methylation levels of the above-mentioned ENPP2 gene and NPTX2 gene, breast cancer samples can be accurately detected. Compared with existing methylation markers, the present application provides breast cancer methylation markers with excellent detection effects for breast cancer, especially with excellent detection sensitivity and specificity for malignant breast cancer (including triple-negative breast cancer and HER-2 positive breast cancer). This breast cancer methylation marker is expected to be truly used for the clinical detection of breast cancer. At the same time, primer pairs and detection probes are one of the influencing factors for the breast cancer methylation marker to play a role. The above-mentioned primer pairs and the following detection probes provided in the present application can enable the above-mentioned breast cancer methylation marker to play a role in specific detection.

[0048] In some embodiments, the above-mentioned kit further includes detection probes corresponding to the above-mentioned primer pairs; among them, the nucleotide sequence of the first detection probe corresponding to the above-mentioned first primer pair is shown in SEQ ID NO.5, the nucleotide sequence of the second detection probe corresponding to the above-mentioned second primer pair is shown in SEQ ID NO.10, the nucleotide sequence of the third detection probe corresponding to the above-mentioned third primer pair is shown in SEQ ID NO.15, and the nucleotide sequence of the fourth detection probe corresponding to the above-mentioned fourth primer pair is shown in SEQ ID NO.18.

[0049] In some embodiments, the 5' end of the above-mentioned detection probe contains a fluorescent reporter group, and the 3' end contains a fluorescent quenching group.

[0050] In some embodiments, the above-mentioned kit further includes one or more of detection primer pairs and detection probes for internal reference genes, nucleic acid extraction reagents, nucleic acid purification reagents, methylation conversion reagents, PCR reaction reagents, and quality control products.

[0051] In some embodiments, the above-mentioned internal reference gene can be, but is not limited to, ACTB. In an optional specific example, the nucleotide sequence of the detection primer pair for the internal reference gene ACTB is shown in SEQ ID NOs. 19-20, and the nucleotide sequence of the detection probe is shown in SEQ ID NO.21. It can be understood that in other embodiments, other genes can also be selected as internal reference genes. At this time, the internal reference primer pairs can be designed correspondingly.

[0052] In some embodiments, the 5'-end of the detection probe and the detection probe of the internal reference gene described above contains a fluorescent reporter group, and the 3'-end contains a fluorescent quenching group. The fluorescent reporter groups of the above-mentioned probes are independently selected from any one of FAM, VIC, HEX, NED, ROX, TET, JOE, CY3, and CY5; the fluorescent quenching groups of the above-mentioned probes are independently selected from any one of TAMRA, MGB, BHQ, BHQ1, BHQ2, and BHQ3. When there are more than two detection probes in the same reaction system, the fluorescent groups linked to different detection probes are different. It can be understood that the fluorescent groups of the detection probes are not limited to the above, and other fluorescent groups can also be used.

[0053] In some embodiments, the above-mentioned methylation conversion reagent is used to deaminate cytosine that is not methylated in DNA to convert it into uracil, while methylated cytosine remains unchanged. The present invention places no particular limitation on the methylation conversion reagent. Any reagent that can achieve the conversion of cytosine to uracil reported in the prior art can be used, such as one or more of hydrazine salts, bisulfite salts, and hydrogen sulfite salts (such as sodium metabisulfite, potassium bisulfite, cesium bisulfite, ammonium bisulfite, etc.).

[0054] In some embodiments, the above-mentioned nucleic acid extraction reagent may include, but is not limited to, any one or more of lysis buffer, binding buffer, washing buffer, and elution buffer. In some embodiments, the above-mentioned PCR reaction reagent includes amplification buffer, dNTPs, DNA polymerase, and Mg 2+ and one or more of them. In some embodiments, the above-mentioned quality control product includes a positive reference product and a negative reference product. The positive reference product refers to one that contains a methylated marker and is used to monitor the detection performance of the reagents in the kit. The negative reference product refers to one that does not contain a methylated marker and is used to monitor whether the experiment is contaminated.

[0055] In some embodiments, the above-mentioned breast cancer methylation markers can be detected by methods well-known in the art. The detection methods include, but are not limited to, methylation-sensitive arbitrarily primed polymerase chain reaction (MS AP-PCR), methylation-sensitive single nucleotide primer extension (Ms-SNuPE), methylation-specific PCR (qMSP), methylation-sensitive DNA restriction enzyme analysis, restriction enzyme-based sequencing, restriction enzyme-based microarray analysis, combined bisulfite restriction analysis (COBRA), methylation CpG island amplification (MCA), methylation CpG island amplification and microarray (MCAM), HpaII tiny fragment enrichment by ligation-mediated PCR (HELP), bisulfite sequencing, bisulfite microarray analysis, methylation-specific pyrosequencing, HELP sequencing (HELP-seq), TET-assisted pyridine borane sequencing (TAPS), Gal hydrolysis and ligation adaptor-dependent PCR (GLAD-PCR), methylated DNA immunoprecipitation sequencing (MeDIP-Seq) or methylated DNA immunoprecipitation-microarray analysis (MeDIP-chip), Southern blotting using methylation-sensitive restriction enzymes, and microarray analysis based on methylation-specific giant magnetoresistive sensors.

[0056] The present invention also provides the application of the above-mentioned kit in the preparation of breast cancer diagnostic products. The breast cancer diagnostic products can be one or more of kits, chips, sequencing libraries, etc. Optionally, the above products can be in the form of freeze-dried powder, solution, suspension, emulsion, etc.

[0057] The kit provided by the present invention can be used for the diagnosis of breast cancer. Further, the above-mentioned breast cancer includes at least one of triple-negative breast cancer and HER-2 type breast cancer.

[0058] In addition to the diagnosis of malignant breast cancer, the kit of the present invention is also expected to be applied to breast cancer screening, risk assessment, prognosis, disease identification, diagnosis of disease stage, and screening of therapeutic targets. Similarly, the kit of the present invention is also expected to be applied to prediction, that is, when the methylation level of the above-mentioned breast cancer methylation marker in an individual shows an upward trend within a certain period of time, it is possible to develop breast cancer, and the detection of the above-mentioned breast cancer methylation marker can play a predictive role.

[0059] The present invention also provides a method for diagnosing breast cancer by detecting the methylation level of breast cancer methylation markers in a sample, including the following steps: extracting the sample DNA of a subject and treating it with a methylation conversion reagent, using the transformed and purified DNA as a template, adding a primer pair for detecting the methylation level of breast cancer methylation markers and a detection probe corresponding to the primer pair, as well as other components of the kit, performing a qPCR reaction, and based on the detection result, further determining whether the sample to be tested is negative or positive for breast cancer.

[0060] In some embodiments, the above-mentioned sample may be a tissue, body fluid or excrement sample. Further, the above-mentioned tissue includes mammary gland tissue; the above-mentioned body fluid includes blood (including whole blood, plasma, serum), extracellular fluid, tissue fluid, lymph fluid, cerebrospinal fluid or aqueous humor; the above-mentioned excrement includes sputum, urine, saliva or feces. Even further, in a specific embodiment of the present invention, the sample to be tested is a plasma sample.

[0061] The above method provided by the present invention can perform highly sensitive and highly specific breast cancer diagnosis with low invasiveness, especially for the detection of malignant breast cancer, thereby bringing early treatment and improved prognosis. Further, it can also monitor the effectiveness of disease aversion, surgical treatment, radiotherapy treatment and chemotherapy treatment.

[0062] The above technical solutions will be described in detail below in conjunction with specific embodiments.

[0063] Example 1

[0064] Based on the TCGA database and high-throughput methylation sequencing data of clinical samples, this example downloads the TCGA methylation 450k chip data, retains the sample types of cancer and normal, and performs differential analysis on the methylation data of 857 breast cancer patients (cancer) and 81 healthy people (normal) in the database. The average methylation Beta value is calculated respectively to screen for methylation differential sites. The higher the Beta value, the higher the methylation level. As Figure 1 shown, the ENPP2 gene and the NPTX2 gene show high methylation in breast cancer patients and low methylation in healthy people. Therefore, the present invention attempts to use the ENPP2 gene and the NPTX2 gene as differentially methylated marker genes to determine whether a subject has breast cancer.

[0065] Design the first nucleic acid combination and the second nucleic acid combination for the ENPP2 gene. Among them, the target region G1 amplified by the first nucleic acid combination is the negative strand of Chr8:119638645-119638839, and its DNA sequence is (5’-3’):

[0066] ATAATAAGGTGCTATCTTAATTTGCACAACAAAAAGGAAAATGCCAATCAGTCACTGATTCTGAAGATCAAGCATGTCCCCCGTCATTCCTCCGTTCTCCCACCTGACACGACTGGAACGAGCTCCTCCTTGCCATGTCGAGGATTCTTGGAAAGCCTTTTGCAGCGTGTTCTCTTTGCCTTCACGGAGTGCACT(SEQ ID NO.1).

[0067] The DNA sequence of the completely methylated target region G1 (Chr8: 119638645 - 119638839) after bisulfite conversion is (5'-3'):

[0068] ATAATAAGGTGTTATTTTAATTTGTATAATAAAAAGGAAAATGTTAATTAGTTATTGATTTTGAAGATTAAGTATGTTTTTCGTTATTTTTTCGTTTTTTTATTTGATACGATTGGAACGAGTTTTTTTTTGTTATGTCGAGGATTTTTGGAAAGTTTTTTGTAGCGTGTTTTTTTTGTTTTTACGGAGTGTATT(SEQ ID NO.2).

[0069] The first nucleic acid combination includes the following methylation primer pairs and probes:

[0070] Forward primer: 5'-ATAATAAGGTGTTATTTTAATTTGT-3' (SEQ ID NO.3);

[0071] Reverse primer: 5'-AATACACTCCGTAAAAACAAA-3' (SEQ ID NO.4);

[0072] Detection probe: 5'-label - TCGTTTTTTTATTTGATACGATTGG - 3'-label (SEQ ID NO.5). In one embodiment, the 5'-label is VIC and the 3'-label is BHQ1.

[0073] The target region G2 amplified by the second nucleic acid combination is the negative strand of Chr8: 119672875 - 119672976, and its DNA sequence is (5'-3'):

[0074] AGCCGGGCCCGTCTCGCCGCCCAGGAGGGCAGAGCTTGCAGTGCCC TGCGGCTGGTAAGGCTGAGGGTCGCCCGCTTGCAGTCGAGCCGTGGTGA ACCGAGA(SEQ ID NO.6).

[0075] The DNA sequence of the completely methylated target region G2 (Chr8: 119672875 - 119672976) after bisulfite conversion is (5'-3'):

[0076] AGTCGGGTTCGTTTCGTCGTTTAGGAGGGTAGAGTTTGTAGTGTTTTG CGGTTGGTAAGGTTGAGGGTCGTTCGTTTGTAGTCGAGTCGTGGTGAATC GAGA(SEQ ID NO.7).

[0077] The second nucleic acid combination includes the following methylation primer pairs and probes:

[0078] Forward primer: 5'-AGTCGGGTTCGTTTCGTCG-3' (SEQ ID NO.8);

[0079] Reverse primer: 5'-TCTCGATTCACCACGACTCG-3' (SEQ ID NO.9);

[0080] Detection probe: 5'-label-CGGTTGGTAAGGTTGAGGGTCGTTCG-3' label (SEQ ID NO.10). In one embodiment, the 5' label is VIC and the 3' label is BHQ1.

[0081] The third nucleic acid combination and the fourth nucleic acid combination are designed for the NPTX2 gene. The target region G3 amplified by the third nucleic acid combination is the positive strand of Chr7: 98616603 - 98616819, and the target region G4 amplified by the fourth nucleic acid combination is the positive strand of Chr7: 98616640 - 98616763.

[0082] The DNA sequence (5'-3') of the target region G3 (Chr7: 98616603 - 98616819) is:

[0083] TCCTGGTCCCGGTCCCCGAGGCCCCCGGGATTCTTCCCGAGCGTTTTCCGAGTTGGCGCGGGGGGTGGAGGCGGGGCCATGGAGCGCGTCCCGGGGACCGTTGCATCCGGAGGCGGCCGTCGTGCGGCTCCTTCCCGCCTCGAGAGTGAGGTGGCCGGGCCTTGACGAGAAGGCCCACGCCTGCCGCGGGGGTGGCTCGCGATGGCAGTCGGGGTTC(SEQ ID NO.11).

[0084] The target region G3 (Chr7: 98616603-98616819) is completely methylated, and the DNA sequence after bisulfite conversion is (5'-3'):

[0085] TTTTGGTTTCGGTTTTCGAGGTTTTCGGGATTTTTTTCGAGCGTTTTTCGAGTTGGCGCGGGGGGTGGAGGCGGGGTTATGGAGCGCGTTTCGGGGATCGTTGTATTCGGAGGCGGTCGTCGTGCGGTTTTTTTTCGTTTCGAGAGTGAGGTGGTCGGGTTTTGACGAGAAGGTTTACGTTTGTCGCGGGGGTGGTTCGCGATGGTAGTCGGGGTTC(SEQ ID NO.12).

[0086] The third nucleic acid combination includes the following methylation primer pairs and probes:

[0087] Forward primer: 5'-TTTTGGTTTCGGTTTTCGAGGTT-3' (SEQ ID NO.13);

[0088] Reverse primer: 5'-GAACCCCGACTACCATCGCG-3' (SEQ ID NO.14);

[0089] Detection probe: 5'-label - CGCGTTTCGGGGATCGTTGTATTCG-3'-label (SEQ ID NO.15).

[0090] The fourth nucleic acid combination includes the following methylation primer pairs and probes:

[0091] Forward primer: 5'-CGAGCGTTGTTCGAGTTGG-3' (SEQ ID NO.16);

[0092] Reverse primer: 5’-AACCCGACCACCTCACTCTC-3’ (SEQ ID NO.17);

[0093] Detection probe: 5’-label -TTCGGGGATCGTTGTATTCGGAGGC-3’-label (SEQ ID NO.18). In one embodiment, the 5’-label is ROX and the 3’-label is BHQ2.

[0094] The detection primer pair and probe for the internal reference gene ACTB are as follows:

[0095] Forward primer: 5’-GTGATGGAGGAGTTTAGTAAGTT-3’ (SEQ ID NO.19);

[0096] Reverse primer: 5’-GCACTCTTCCGAAACGAAACG-3’ (SEQ ID NO.20);

[0097] Detection probe: 5’-label -ACCACCACCCAAACACAATAACAAACACA-3’-label (SEQ ID NO.21). In one embodiment, the 5’-label is FAM and the 3’-label is MGB.

[0098] Example 2

[0099] 1) Sample collection

[0100] The samples collected in this example are plasma samples. A total of 133 plasma samples from breast cancer patients were collected, including 45 cases of luminal A breast cancer, 21 cases of luminal B breast cancer, 35 cases of triple-negative breast cancer, and 32 cases of HER-2 positive breast cancer; 124 plasma samples from the control group were collected, including 56 cases of patients with breast benign tumors (11 cases of breast fibroids, 35 cases of breast hyperplasia, and 10 cases of breast cysts) and 68 cases of healthy people. The volume of each blood sample is greater than 8 mL. The collection process of all samples has been approved by the ethics committee, all volunteers have signed the informed consent form, and all samples have been anonymized.

[0101] 2) Extraction, transformation, and purification of DNA samples

[0102] cfDNA was extracted from plasma using the QIAamp Circulating Nucleic Acid kit (Qiagen, Valencia, CA, USA). DNA was quantified using a Qubit 2.0 fluorimeter (ThermoFisher Scientific, Waltham, MA, USA). Genomic DNA was chemically modified with sodium bisulfite to convert unmethylated cytosine to uracil while leaving methylated cytosine unchanged. DNA conversion and purification were performed using the EZ DNA Methylation-Gold Kit provided by ZYMO Corporation, and the specific operations were completed according to the kit instructions.

[0103] 3) qPCR amplification

[0104] qMSP amplification was performed according to the reaction system and reaction program shown in Table 1 and Table 2. After the qMSP reaction, the baseline was adjusted. The baseline was usually the fluorescence signal of 3 - 15 cycles, and the threshold was set within the exponential amplification phase.

[0105] Table 1 qMSP reaction system

[0106]

[0107]

[0108] Table 2 qMSP reaction program

[0109]

[0110] 4) Quality control

[0111] Negative control tube: Prepare the PCR reaction system according to Table 1, where the DNA template is TE buffer.

[0112] Positive control tube: Prepare the PCR reaction system according to Table 1, where the DNA templates are synthetic plasmids containing ACTB (sequence after bisulfite conversion) and synthetic plasmids of each target region (fully methylated and sequence after bisulfite conversion), with a concentration of 10 3 copies / μL, and mix them in equal volumes.

[0113] The preparation method of the DNA template is as follows: Manually synthesize the sequence corresponding to the amplified region of the ACTB gene after complete bisulfite conversion, and clone it into a vector to obtain a synthetic plasmid containing ACTB (converted sequence); Manually synthesize the nucleotide sequences of each target region that are fully methylated and completely converted by bisulfite, and clone them into vectors respectively to obtain synthetic plasmids containing each target region (fully methylated and sequence after bisulfite conversion).

[0114] The negative control should show no amplification, the positive control should have an obvious exponential growth phase, and the Ct values of each gene in the positive control should be between 26 and 30. The Ct value of the reference gene in the sample to be tested should be ≤35. After the negative control, positive control, and reference gene all meet the above requirements, it indicates that this experiment is valid and the next step of sample result determination can be carried out. Otherwise, the experiment of that time is invalid and the detection must be carried out again.

[0115] 5) qMSP detection and result analysis

[0116] The methylation level of the sample to be tested is judged according to the Ct values detected in each target region. For plasma samples, if the Ct value of amplifying a certain region is ≤45, it is considered that this region in the sample is methylated positive; if the Ct value of amplifying a certain region is >45, it is considered that this region in the sample is methylated negative. When jointly detecting target regions, if any one region in the target region combination of the sample to be tested is methylated positive, then the sample is a breast cancer positive sample; only when both of the two target regions in the target region combination of the sample to be tested are methylated negative, then the sample is a breast cancer negative sample. The specific detection results are shown in Table 3 and Table 4.

[0117] Table 3 Performance of combined detection of target regions for breast cancer plasma samples

[0118]

[0119] Table 4 Performance of combined detection of target regions for control group plasma samples

[0120]

[0121] As can be seen from Table 3, when using the kit provided by the present invention to screen breast cancer, it has good detection sensitivity for all four subtypes of breast cancer, and the total detection sensitivity ranges from 88.72% to 93.98%. Specifically, the sensitivity ranges of the kit provided by the present invention for detecting luminal A breast cancer and luminal B breast cancer are 86.67% to 91.11% and 80.95% to 100.00% respectively; the sensitivity ranges for detecting the two subtypes of breast cancer with high malignancy and poor prognosis, triple-negative breast cancer and HER-2 positive breast cancer, are 85.71% to 94.29% and 90.63% to 93.75% respectively.

[0122] From the performance of detecting breast cancer plasma samples by the above four different combinations of target regions, the best performance in diagnosing different subtypes of breast cancer is achieved by jointly detecting the methylation levels of target region G2 + target region G4. The sensitivities for diagnosing luminal A breast cancer and luminal B breast cancer are 91.11% and 100.00% respectively, and the sensitivities for diagnosing triple-negative breast cancer and HER-2 positive breast cancer, which are two types of breast cancers with high malignancy and poor prognosis, are 94.29% and 93.75% respectively.

[0123] As can be seen from Table 4, the specificity range of the kit provided by the present invention for detecting plasma samples of the control group is 87.10% - 91.13%. Specifically, the specificity range for detecting plasma samples of patients with breast benign tumors (including patients with breast fibroids, breast hyperplasia, and breast cysts) is 82.14% - 91.07%, and the specificity range for detecting plasma samples of healthy people is 86.76% - 92.65%. It can effectively avoid the detection of false negative results, avoid over-treatment of breast benign tumors, and has high detection accuracy.

[0124] From the performance of detecting plasma samples of the control group by the above four different combinations of target regions, the optimal specificity for diagnosing plasma samples of patients with breast cancer benign tumors is achieved by jointly detecting the methylation levels of target region G1 + target region G3 or target region G2 + target region G4, reaching 91.07%. The specificities for diagnosing plasma samples of healthy people by jointly detecting the methylation levels of target region G1 + target region G4, or target region G2 + target region G3, or target region G2 + target region G4 are relatively excellent, all greater than 91%.

[0125] Example 3

[0126] To further verify the detection effect of the breast cancer methylation markers provided by this application on malignant breast cancer, another experimental group and control group different from those in Example 2 were collected and established for experiments. In this example, a total of 183 breast cancer patient samples were collected as the experimental group, including 52 cases of luminal epithelial A breast cancer, 27 cases of luminal epithelial B breast cancer, 39 cases of triple-negative breast cancer, and 65 cases of HER-2 positive type; a total of 175 healthy human plasma samples were collected as the control group. The sample collection process was the same as that in Example 2. After blinding all the above samples, the experimental group and the control group were randomly divided into a training set sample (Training set) and a test set sample (Test set) according to a ratio of 5:5 in total. Among them, the training set sample included 88 cases of the experimental group (including 25 cases of luminal epithelial A breast cancer, 14 cases of luminal epithelial B breast cancer, 16 cases of triple-negative breast cancer, and 33 cases of HER-2 positive breast cancer) and 91 cases of the control group, and the test set sample included 95 cases of the experimental group (including 27 cases of luminal epithelial A breast cancer, 13 cases of luminal epithelial B breast cancer, 23 cases of triple-negative breast cancer, and 32 cases of HER-2 positive breast cancer) and 84 cases of the control group. The provided kit of this application was used for detection by methylation-specific qPCR method, and the detection method was the same as that in Example 2. After the detection was completed, the blinding was lifted, and MedCalc software was used for analysis according to the detection results to obtain the ROC curve.

[0127] The performance of the combined detection of target regions for the training set samples and test set samples is shown in Table 5. Among them, the performance of the combined detection of target region G1 + target region G3 for the training set samples and test set samples is respectively as Figure 2 Content a, Figure 2 Content b shown; the performance of the combined detection of target region G1 + target region G4 for the training set samples and test set samples is respectively as Figure 3 Content a, Figure 3 Content b shown; the performance of the combined detection of target region G2 + target region G3 for the training set samples and test set samples is respectively as Figure 4 Content a, Figure 4 Content b shown; the performance of the combined detection of target region G2 + target region G4 for the training set samples and test set samples is respectively as Figure 5 Content a, Figure 5 Content b shown.

[0128] Table 5 Performance of the combined detection of target regions for the training set samples and test set samples

[0129]

[0130] As can be seen from Table 5, the qMSP method has excellent performance in detecting the methylation levels of the target region combinations for the training set samples and test set samples, and their AUC values are all greater than 0.81. Specifically, for the four different target region combination methods in Table 5, the sensitivity ranges for detecting the training set samples and test set samples are 78.0% - 85.7% and 76.2% - 86.9% respectively; the specificity ranges for detecting the training set samples and test set samples are 79.5% - 90.9% and 78.9% - 94.7% respectively. Among them, the sensitivity for diagnosing the training set samples and test set samples by detecting the methylation level of target region G2 + target region G4 is the best, both being greater than or equal to 85.7%; the specificity for diagnosing the training set samples and test set samples by detecting the methylation level of target region G1 + target region G4 is the best, both being greater than or equal to 90.9%.

[0131] Comparative Example 1

[0132] The samples in this comparative example are the same as those in Example 2. The detection method of serum markers was used to detect the contents of tumor markers CA125 (carbohydrate antigen 125) and CA153 (carcinoembryonic antigen 153) in breast cancer plasma samples, so as to evaluate the performance of detecting breast cancer patient plasma samples by tumor markers CA125 and CA153. The detection results are shown in Table 6.

[0133] Table 6 Performance of Detecting Breast Cancer Plasma Samples by Tumor Markers CA125 and CA153

[0134]

[0135] From Tables 3, 4, 5, and 6, it can be seen that compared with the conventional CA125 and CA153 tumor markers, the kit provided by the present invention jointly detects the methylation of the ENPP2 gene and NPTX2 gene combination, and the sensitivity for detecting breast cancer patient plasma samples and the specificity for detecting control group plasma samples are greatly improved, especially the improvement of detection sensitivity is remarkable.

[0136] Those skilled in the art can easily understand that the above are only the preferred embodiments of the present invention, and are not used to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Claims

1. A breast cancer methylation marker, characterized in that, It includes the ENPP2 gene and the NPTX2 gene.

2. The breast cancer methylation marker according to claim 1, characterized in that, It includes at least one of target region G1 and target region G2 in the ENPP2 gene, and also includes at least one of target region G3 and target region G4 in the NPTX2 gene; Using GRCh38.p14 as the reference genome, the target region G1 is selected from Chr8:119638645-119638839, the target region G2 is selected from Chr8:119672875-119672976, the target region G3 is selected from Chr7:98616603-98616819, and the target region G4 is selected from Chr7:98616640-98616763.

3. A kit for detecting the breast cancer methylation marker described in claim 1 or 2, characterized in that, It includes primer pairs for detecting the methylation level of the breast cancer methylation marker.

4. The kit according to claim 3, wherein The primer pairs include at least one of the first primer pair for detecting the methylation level of the target region G1 and the second primer pair for detecting the methylation level of the target region G2, and also include at least one of the third primer pair for detecting the methylation level of the target region G3 and the fourth primer pair for detecting the methylation level of the target region G4.

5. The kit according to claim 4, wherein the nucleotide sequences of the first primer pair are as shown in SEQ ID NO.3 and SEQ ID NO.4, the nucleotide sequences of the second primer pair are as shown in SEQ ID NO.8 and SEQ ID NO.9, the nucleotide sequences of the third primer pair are as shown in SEQ ID NO.13 and SEQ ID NO.14, and the nucleotide sequences of the fourth primer pair are as shown in SEQ ID NO.16 and SEQ ID NO.

17.

6. The kit according to claim 4 or 5, characterized in that, It also includes detection probes corresponding to the primer pairs; wherein, The nucleotide sequence of the first detection probe corresponding to the first primer pair is as shown in SEQ ID NO.5, the nucleotide sequence of the second detection probe corresponding to the second primer pair is as shown in SEQ ID NO.10, the nucleotide sequence of the third detection probe corresponding to the third primer pair is as shown in SEQ ID NO.15, and the nucleotide sequence of the fourth detection probe corresponding to the fourth primer pair is as shown in SEQ ID NO.

18.

7. The kit according to claim 6, wherein The 5' end of the detection probe contains a fluorescent reporter group, and the 3' end contains a fluorescent quenching group.

8. The kit according to claim 3, wherein It also includes one or more of detection primer pairs and detection probes for internal reference genes, nucleic acid extraction reagents, nucleic acid purification reagents, methylation conversion reagents, PCR reaction reagents, and quality control products.

9. Use of the kit according to any one of claims 3 to 8 in the preparation of breast cancer diagnostic products.

10. The application according to claim 9, wherein The breast cancer includes at least one of triple-negative breast cancer and HER-2 positive breast cancer; the breast cancer diagnostic products include one or more of kits, chips, and sequencing libraries.