Methylated biomarker for diagnosing gastric cancer and application of methylated biomarker

Abstract

The invention discloses a methylated biomarker for diagnosing gastric cancer and application of the methylated biomarker. The invention provides a methylation biomarker for diagnosing gastric cancer, and the methylation biomarker comprises a methylation region which is equal to and / or complementary to at least one of target sequences as shown in SEQ ID NO.1-6 and fragments of the target sequences as shown in SEQ ID NO.1-6, and the methylation region comprises at least one methylation site indicated by CG. The methylated biomarker provided by the invention can be used for diagnosing gastric cancer, and has good sensitivity, specificity and accuracy.

Description

Technical Field

[0001] The present invention belongs to the field of gene methylation detection, and in particular relates to a methylation biomarker for diagnosing gastric cancer and an application thereof. Background Art

[0002] Gastric cancer is an important cancer worldwide. The vast majority of gastric cancers are adenocarcinomas, which have no obvious symptoms in the early stages, or may present non-specific symptoms such as upper abdominal discomfort and belching, which are often similar to the symptoms of chronic gastric diseases such as gastritis and gastric ulcers and are easily overlooked. Early gastric cancer screening can increase the patient's 5-year survival rate to more than 90%. Therefore, careful screening of high-risk groups for gastric cancer and timely treatment of discovered early gastric cancer are important means to reduce gastric cancer mortality and prolong patient survival.

[0003] CpG island methylation is an important mechanism for the inactivation of tumor suppressor genes. Gastric cancer is one of the tumors that exhibits high-frequency abnormal CpG island methylation. By finding gastric cancer-specific methylation markers and detecting their methylation levels, we can effectively distinguish between cancer and non-cancer, and combine with other screening methods to improve the accuracy of gastric cancer detection.

[0004] So far, there are very limited reports on methylation analysis of gastric cancer. Existing products or reports list Septin9 or SDC2 as methylation marker genes for gastric cancer. However, Septin9 was found to be a specific marker in the early development of colorectal cancer (Grutzmann, R., et al., Sensitive detection of colorectal cancer in peripheral blood by septin 9DNA methylation assay. PLoS One, 2008. 3 (11): p. e3759.), and SDC2 is also considered to be a specific marker for stool detection of colorectal cancer (Oh, TJ, et al., Feasibility of quantifying SDC2methylation in stool DNA for early detection of colorectal cancer. Clin Epigenetics, 2017. 9: p. 126.). Therefore, the ability of these two genes to distinguish between gastric and intestinal cancer remains to be evaluated. Methylation detection of a single gene may lead to serious missed detection and misdetection, and combined detection of multi-gene methylation can achieve better detection results.

[0005] Therefore, new methylation biomarkers for the diagnosis of gastric cancer remain to be developed. Summary of the invention

[0006] Problems to be Solved by the Invention

[0007] To solve the above problems existing in the prior art, the present invention provides a methylation biomarker for diagnosing gastric cancer, and uses the DNA methylation biomarker for early gastric cancer detection.

[0008] Solutions for Solving the Problems

[0009] The first aspect of the present invention provides a methylation biomarker for diagnosing gastric cancer, wherein the methylation biomarker comprises: a methylation region equivalent to and / or complementary to at least one of the target sequences shown in SEQ ID NOs. 1-6 and fragments of the target sequences shown in SEQ ID NOs. 1-6, and the methylation region comprises at least one methylation site indicated by CG.

[0010] In some alternative embodiments, the methylation biomarker at least comprises: a methylation region equivalent to and / or complementary to at least one of the target sequences shown in SEQ ID NOs. 4-6 and fragments of the target sequences shown in SEQ ID NOs. 4-6.

[0011] In some embodiments, the gastric cancer is gastric cancer from a subject, and the subject is a mammal; preferably, the mammal is a human; and / or, the gastric cancer is selected from gastric cancers in stage I, II, III, or IV; and / or, the gastric cancer is selected from high-grade intraepithelial neoplasia, B-cell lymphoma, diffuse, intestinal type, or mixed gastric cancer.

[0012] In some embodiments, if the methylation level of the methylation biomarker in the test sample is different from the methylation level of the methylation biomarker in the sample of a subject without gastric cancer, it indicates that the subject corresponding to the test sample has gastric cancer.

[0013] In some embodiments, the test sample is selected from one or more of tissue, whole blood, plasma, saliva, serum, urine, urine exfoliated cells, urinary sediment, and urine supernatant; preferably, the test sample is tissue, whole blood, plasma, or serum, and more preferably, the test sample is whole blood, plasma, or serum.

[0014] In some embodiments, the methylation region is a methylation region present in cfDNA.

[0015] In some embodiments, the methylation level of the methylation biomarker is detected by one or more of the following methods: quantitative fluorescence PCR (qPCR), methylation-specific PCR (MSP), digital PCR (ddPCR), DNA methylation chip, targeted DNA methylation sequencing, whole-genome methylation sequencing (WGBS), methylation-sensitive restriction enzyme (MS-RE)-PCR / Southern method, direct sequencing method, methylation-sensitive single nucleotide primer extension (Ms-SnuPE), bisulfite-converted restriction enzyme method (COBRA), methylation-sensitive single-strand conformation analysis (MS-SSCA), methylation-sensitive denaturing gradient gel electrophoresis (MSDGGE), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO), methylation-sensitive melting curve analysis (MS-MCA), methylation-sensitive dot blot analysis (MS-DBA), methylation-specific multiplex ligation-dependent probe amplification, bisulfite sequencing, pyrosequencing, DNA methylation mass spectrometry (MassArray).

[0016] In some preferred embodiments, the method includes quantitative fluorescence PCR method.

[0017] The second aspect of the present invention provides the use of the following (i) or (ii):

[0018] (i) The use of the methylation biomarker for diagnosing gastric cancer as described in the first aspect of the present invention in the preparation of a reagent or kit for diagnosing gastric cancer;

[0019] (ii) The use of a reagent for determining the methylation level of the methylation biomarker for diagnosing gastric cancer as described in the first aspect of the present invention in the preparation of a reagent or kit for diagnosing gastric cancer.

[0020] The third aspect of the present invention provides a kit for diagnosing gastric cancer, wherein the kit contains a reagent for detecting the methylation level of the methylation biomarker for diagnosing gastric cancer as described in the first aspect of the present invention in a sample to be tested.

[0021] In some embodiments, the reagent is a reagent used in a method for detecting methylation level or detecting methylation levels of multiple methylated regions of DNA, including: quantitative fluorescence PCR (qPCR), methylation-specific PCR (MSP), digital PCR (ddPCR), DNA methylation chip, targeted DNA methylation sequencing, whole-genome bisulfite sequencing (WGBS), methylation-sensitive restriction enzyme (MS-RE)-PCR / Southern method, direct sequencing method, methylation-sensitive single nucleotide primer extension (Ms-SnuPE), bisulfite-converted restriction enzyme method (COBRA), methylation-sensitive single-strand conformation analysis (MS-SSCA), methylation-sensitive denaturing gradient gel electrophoresis (MSDGGE), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO), methylation-sensitive melting curve analysis (MS-MCA), methylation-sensitive dot blot analysis (MS-DBA), methylation-specific multiplex ligation-dependent probe amplification, bisulfite sequencing, pyrosequencing, and DNA methylation mass spectrometry (MassArray).

[0022] In some preferred embodiments, the method includes quantitative fluorescence PCR method.

[0023] In some embodiments, the reagent includes at least one set of primers and probes selected from the following:

[0024] (1) Primers shown in SEQ ID NO.7 and 8, and probe shown in SEQ ID NO.9;

[0025] (2) Primers shown in SEQ ID NO.10 and 11, and probe shown in SEQ ID NO.12;

[0026] (3) Primers shown in SEQ ID NO.13 and 14, and probe shown in SEQ ID NO.15;

[0027] (4) Primers shown in SEQ ID NO.16 and 17, and probe shown in SEQ ID NO.18;

[0028] (5) Primers shown in SEQ ID NO.19 and 20, and probe shown in SEQ ID NO.21;

[0029] (6) Primers shown in SEQ ID NO.22 and 23, and probe shown in SEQ ID NO.24.

[0030] In some alternative embodiments, the reagent includes at least one set of primers and probes selected from the following:

[0031] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0032] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0033] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0034] In some embodiments, the test sample is selected from one or more of tissue, whole blood, plasma, saliva, serum, urine, urinary exfoliated cells, urinary sediment, and urine supernatant; preferably, the test sample is tissue, whole blood, plasma or serum, and more preferably, the test sample is whole blood, plasma or serum.

[0035] The fourth aspect of the present invention provides the use of at least one set of a combination of primers and probes selected from the following in the preparation of a reagent or kit for diagnosing gastric cancer, wherein the combination of primers and probes is used to detect the methylation level of the methylation biomarker for diagnosing gastric cancer as described in the first aspect of the present invention, and the reagent includes at least one set of primers and probes selected from the following:

[0036] (1) Primers as shown in SEQ ID NO.7 and 8, and a probe as shown in SEQ ID NO.9;

[0037] (2) Primers as shown in SEQ ID NO.10 and 11, and a probe as shown in SEQ ID NO.12;

[0038] (3) Primers as shown in SEQ ID NO.13 and 14, and a probe as shown in SEQ ID NO.15;

[0039] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0040] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0041] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0042] In some alternative embodiments, the reagent includes at least one set of primers and probes selected from the following:

[0043] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0044] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0045] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0046] Effects of the Invention

[0047] The methylation biomarkers provided by the present invention can be used for diagnosing gastric cancer, and have good sensitivity, specificity and accuracy.

[0048] In some embodiments, the present invention has discovered multiple methylation biomarkers that can be used to identify the risk of gastric cancer. By detecting the co-methylation of multiple specific methylation regions (markers) related to gastric cancer, cancer / non-cancer can be effectively distinguished. The present invention has found that detecting the co-methylation status of a single methylation region may lead to serious missed detections and false detections, and the combination of the selected multi-gene methylation joint detections has better discrimination performance.

[0049] In some embodiments, in the reagent or kit for diagnosing gastric cancer provided by the present invention, the combination method of primer pairs and probes is crucial for simultaneously detecting the co-methylation degree of multiple methylation regions. The kit studies the compatibility of these primer-probe combinations in multiplex PCR by amplification primers and their probes, avoids false positives caused by their mismatches, designs corresponding reaction components, and reduces the background noise signal of the detection.

[0050] In some specific embodiments, the present invention selects multiple specific methylation regions related to gastric cancer, designs corresponding primer-probes for combined testing to form a fluorescence quantitative PCR detection kit for individual gastric cancer risk. The results of detecting clinical samples show that this kit is convenient to use and non-invasive, providing a rapid and effective means for detecting gastric cancer risk.

[0051] In some specific embodiments, the present invention discriminates and analyzes the risk of gastric cancer by detecting the combination of the co-methylation status of multiple specific methylation regions. This specific methylation combination detection method is simple and feasible, and has stronger detection performance for gastric cancer than similar commercially available products. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figures 1A to 1F : 6 targets ( Figure 1A : SEQ ID NO.1;Figure 1B : SEQ ID NO.2; Figure 1C : SEQ ID NO.3; Figure 1D : SEQ ID NO.4; Figure 1E : SEQ ID NO.5; Figure 1F : SEQ ID NO.6.) Schematic diagram of detection data for single target detection, showing amplification curves of samples with methylation rates of 2.5% (light blue), 5% (dark blue), and 10% (purple); where Rn is the ratio of the fluorescence of the reporter dye to the fluorescence of the inert reference dye; that is, Rn is the reporter group signal normalized to the fluorescence signal of the reference fluorescent dye, ΔRn is Rn minus the baseline, and the amplification plot shows the variation of log(ΔRn) with the number of PCR cycles. Detailed implementation manners

[0053] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosed content of the present invention more thorough and comprehensive.

[0054] For the experimental methods without specific conditions noted in the following examples, they are generally carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989); Oligonucleotide Synthesis (M.J. Gait, 1984); Current Protocols in Molecular Biology (F.M. Ausubel et al., 1987 edition); PCR: Polymerase Chain Reaction (Mullis et al., 1994 edition), or according to the conditions recommended by the manufacturer. All common chemical reagents used in the examples are commercially available products.

[0055] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the description of the present invention are only for the purpose of describing specific embodiments and are not used to limit the present invention. The term "and / or" used in the present invention includes any and all combinations of one or more of the related listed items.

[0056] Definitions

[0057] To facilitate the understanding of the present technology, some terms and phrases are defined below.

[0058] Throughout the specification and claims, the following terms have the meanings explicitly associated herein, unless the context clearly dictates otherwise. The phrase "in one embodiment" as used in the present invention does not necessarily refer to the same embodiment, although it may. Additionally, the phrase "in another embodiment" as used in the present invention does not necessarily refer to a different embodiment, although it may. Thus, as described below, the various embodiments of the present invention can be readily combined without departing from the scope or spirit of the present invention.

[0059] Furthermore, as used in the present invention, the term "or" is the inclusive "or" symbol and is equivalent to the term "and / or", unless the context clearly dictates otherwise. The term "based on" is not exclusive and allows for other factors not described, unless the context clearly dictates otherwise. Additionally, throughout the specification, the meanings of "a", "an", and "the" include plural referents. The meaning of "in" includes both "in" and "on".

[0060] As used in the present invention, the term "plural" means two or more. "And / or", which describes the relationship between associated objects, indicates that three relationships can exist. For example, A and / or B can represent: A exists alone, A and B exist simultaneously, and B exists alone. The character " / " generally indicates that the associated objects before and after are in an "or" relationship.

[0061] As used in the present invention, the term "can" includes the meanings of both performing a certain process and not performing a certain process.

[0062] As used in the present invention, the term "optional" or "optionally" means that the subsequent described event or situation may or may not occur, and this description includes the situation where the event occurs and the situation where the event does not occur.

[0063] As used in the present invention, the terms "comprise" and "have" and any variations thereof are intended to cover non-exclusive inclusion. For example, a process, method, apparatus, product, or device that includes a series of steps is not limited to the listed steps or modules, but optionally further includes steps not listed, or optionally further includes other steps inherent to these processes, methods, products, or devices.

[0064] As used in the present invention, the term "polymerase chain reaction" is used to amplify a target sequence, and the method consists of the following steps: introducing a large excess of two oligonucleotide primers into a DNA mixture containing the desired target sequence, followed by a precise thermal cycling sequence in the presence of a DNA polymerase. The two primers are complementary to the corresponding strands of the double-stranded target sequence. To effect amplification, the mixture is denatured and then the primers are annealed to their complementary sequences within the target molecule. After annealing, the primers are extended with a polymerase to form a new pair of complementary strands. The steps of denaturation, primer annealing, and polymerase extension can be repeated many times (i.e., denaturation, annealing, and extension constitute a "cycle"; there can be many "cycles") to obtain a high concentration of the amplified fragment of the desired target sequence. The length of the amplified fragment of the desired target sequence is determined by the relative positions of the primers with respect to each other, and thus this length is a controllable parameter. Because of the repetitive aspect of the method, the method is called the "polymerase chain reaction" ("PCR"). Since the desired amplified fragment of the target sequence becomes the major sequence (in terms of concentration) in the mixture, it is said to be "PCR amplified", is a "PCR product" or an "amplicon".

[0065] As used in the present invention, the term "nucleic acid detection assay" refers to any method for determining the nucleotide composition of a target nucleic acid. Nucleic acid detection assays include, but are not limited to, DNA sequencing methods, probe hybridization methods.

[0066] As used in the present invention, the term "amplifiable nucleic acid" refers to a nucleic acid that can be amplified by any amplification method. An "amplifiable nucleic acid" is expected to generally contain a "sample template".

[0067] As used in the present invention, the term "sample template" refers to a nucleic acid derived from a sample and used to analyze for the presence of a "target". In contrast, a "background template" is used to refer to a nucleic acid other than the sample template, which may or may not be present in the sample. Background templates are typically unintentional. This can be the result of carryover, or may be due to the presence of nucleic acid contaminants that were attempted to be purified away from the sample. For example, nucleic acids other than the nucleic acid to be detected from an organism can be present as background in a test sample.

[0068] As used in the present invention, the term "primer" refers to an oligonucleotide that occurs naturally in a purified restriction digest or is produced synthetically, and that is capable of acting as a point of synthesis when placed under conditions in which primer extension products complementary to a nucleic acid strand are induced (e.g., in the presence of nucleotides and an inducer such as a DNA polymerase and at a suitable temperature and pH). Primers are preferably single-stranded for maximum efficiency of amplification, but can also be double-stranded. If double-stranded, the primer is first treated to separate its strands before being used to prepare extension products. Preferably, the primer is an oligodeoxyribonucleotide. The primer must be long enough to prime the synthesis of an extension product in the presence of an inducer. The exact length of the primer will depend on many factors, including temperature, primer source, and the use of the method.

[0069] As used in the present invention, the term "probe" refers to an oligonucleotide (e.g., a nucleotide sequence) that occurs naturally in a purified restriction digest or is synthetic, recombinant, or produced by PCR amplification, and that is capable of hybridizing to another target oligonucleotide. The probe can be single-stranded or double-stranded. Probes can be used for the detection, identification, and isolation of specific gene sequences (e.g., "capture probes"). It is contemplated that in some embodiments, any probe used in the present invention can be labeled with any "reporter molecule" such that it is detectable in any detection system.

[0070] As used in the present invention, the terms "gastric cancer", "gastric carcinoma", and "stomach cancer" have the same meaning and refer to an epithelial-derived malignant tumor that originates in the stomach.

[0071] As used in the present invention, the term "gastric cancer staging" refers to the classification of gastric cancer into four stages according to the staging criteria jointly developed by the American Joint Committee on Cancer (AJCC), 8th Edition, and the Union for International Cancer Control (UICC). Based on the following three indicators: primary tumor (T), lymph node metastasis (N), and distant metastasis (M). "Stage I" refers to superficial gastric cancer without lymph node metastasis, or cancer that has invaded the muscular layer but has no local lymph node metastasis; "Stage II" refers to cancer that has invaded the mucosa or submucosa but has local lymph node metastasis more than 3 cm away from the primary focus; cancer that has invaded the muscular layer or subserosa but has only lymph node metastasis within 3 cm of the primary focus; or cancer that has penetrated the serosa but has no lymph node metastasis; "Stage III" refers to cancer that has invaded the muscular layer or subserosa and has lymph node metastasis more than 3 cm away from the primary focus; cancer that has penetrated outside the serosa but has only lymph node metastasis within 3 cm; or even cancer that has invaded adjacent tissues or organs but has no lymph node metastasis or lymph node metastasis within 3 cm; and "Stage IV" refers to cancer that has involved adjacent tissues or organs and has lymph node metastasis more than 3 cm away from the primary focus; or T and N with distant metastasis.

[0072] As used in the present invention, the term "gastritis" refers to gastric mucosal inflammation caused by various reasons. Clinically, it can generally be divided into acute and chronic gastritis according to the onset urgency. Chronic gastritis refers to chronic inflammation or atrophic lesions of the gastric mucosa caused by different etiologies. Combining clinical, endoscopic, and pathological histological results, chronic gastritis is divided into: non-atrophic (superficial), atrophic, and special type gastritis. Non-atrophic gastritis can be further divided into superficial gastritis and erosive gastritis under endoscopy. Atrophic gastritis is the atrophy of the glands of the gastric mucosal epithelium, with thinning and aging of the gastric mucosa, caused by long-term chronic inflammation of the gastric mucosa, and can be further divided into: atrophy with intestinal metaplasia and without intestinal metaplasia. Intestinal metaplasia is the repeated inflammation, necrosis, and repair of gastric mucosal epithelial cells. During this process, under the stimulation of certain factors, the gastric mucosal epithelial cells change and become similar to small intestine or large intestine epithelial cells. Atrophic gastritis is a pre-cancerous disease and may develop into gastric cancer. Incomplete intestinal metaplasia of the colon type is a pre-cancerous lesion prone to developing into gastric cancer.

[0073] As used in the present invention, the term "biomarker" refers to measurable molecules such as genes, proteins, metabolites, etc. The determination of variables related to diseases can be used to diagnose diseases or indicate the severity of diseases. The presence or risk of a disease can be inferred from this parameter of the biomarker without the need to measure the disease itself.

[0074] As used in the present invention, the term "real-time fluorescence quantitative PCR" refers to a method of measuring the total amount of products after each polymerase chain reaction (PCR) cycle with a fluorescent chemical substance in a DNA amplification reaction. It is a method of quantitatively analyzing a specific DNA sequence in a sample to be tested by an internal reference or external reference method. In this PCR technique, the meaning of the Ct value (Cycle threshold) is: the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold. For example, the method of setting the fluorescence threshold is as follows: The fluorescence signals in the first 15 cycles of the PCR reaction are used as the fluorescence background signals, and the default setting of the fluorescence threshold is 10 times the standard deviation of the fluorescence signals in cycles 3 - 15.

[0075] As used in the present invention, the term "amplification efficiency" is a method for evaluating the stability and reliability of PCR amplification efficiency. A series of diluted samples are used, and Ct values are obtained by amplification using a standard qPCR program. Finally, a standard curve is plotted based on the concentrations of each sample and the corresponding Ct values to obtain a linear equation Ct = -klgX0 + b, and the amplification efficiency E = 10(-1 / k) - 1. When using qPCR for quantitative analysis, the required amplification efficiency range is 90% - 110% (3.6 > k > 3.1).

[0076] As used in the present invention, the term "cut off value" refers to a critical Ct value for determining the positivity or negativity of a sample for a certain biomarker. According to some specific embodiments of the present application, "the critical Ct value (Cut Off value) is obtained based on statistical processing of a certain amount of sample data", and this critical Ct value can vary according to different requirements for sensitivity or specificity.

[0077] As used in the present invention, the term "sensitivity" refers to the proportion of positive samples detected from the confirmed positive samples, and its calculation formula is: sensitivity = (detected positive / true positive), where true positive means being confirmed as positive by the recognized gold standard. And "specificity" refers to the proportion of normal samples detected as normal among a certain number of normal samples, and its calculation formula is specificity = (detected negative / true negative).

[0078] As used in the present invention, the term "methylation" refers to the methylation of cytosine at position C5 or N4, the N6 site of adenine, or other types of nucleic acid methylation. DNA amplified in vitro is usually unmethylated because generally, in vitro DNA amplification methods cannot retain the methylation pattern of the amplification template. However, "unmethylated DNA" or "methylated DNA" can also refer to the amplified DNA with the original template being unmethylated or methylated, respectively.

[0079] As used in the present invention, "methylated nucleotide" or "methylated nucleobase" refers to the presence of a methyl moiety on the nucleobase, where the methyl moiety is not present in the recognized typical nucleobases. For example, cytosine does not contain a methyl moiety in its pyrimidine ring, but 5-methylcytosine contains a methyl moiety at the 5th position of its pyrimidine ring. Therefore, cytosine is not a methylated nucleotide, and 5-methylcytosine is a methylated nucleotide. In another example, thymine contains a methyl moiety at the 5th position of its pyrimidine ring; however, for the purposes of this article, thymine is not considered a methylated nucleotide when present in DNA because thymine is a typical nucleobase of DNA.

[0080] As used in the present invention, "DNA methylation site", "methylation site" refer to a single or multiple base positions where DNA methylation modification may occur. For example, CpG sites, CHG sites, or CHH sites. In some cases, the DNA methylation site is equivalent to the CpG site.

[0081] As used in the present invention, the "methylation level", "methylation degree", "methylation state", "methylation profile", and "methylation status" of a nucleic acid molecule refer to the presence or absence of one or more methylated nucleobases in the nucleic acid molecule. For example, a nucleic acid molecule containing methylated cytosine is considered methylated (for example, the methylation state of the nucleic acid molecule is methylated). A nucleic acid molecule without any methylated nucleotides is considered unmethylated.

[0082] As used in the present invention, the methylation status may optionally be represented or indicated by a "methylation value" (e.g., representing methylation frequency, fraction, ratio, percentage, etc.). The methylation value can be generated, for example, by quantifying the amount of intact nucleic acid present after restriction digestion with a methylation-dependent restriction enzyme, or by comparing the amplification profiles after bisulfite reaction, or by comparing the sequences of bisulfite-treated and untreated nucleic acids. Thus, a value such as the methylation value represents the methylation status and can therefore be used as a quantitative indicator of the methylation status in multiple copies of a locus. The degree of co-methylation is represented or indicated by the methylation status of more than one methylation site, and within a methylated region, it is defined as co-methylation when the methylation status of more than one methylation site is methylated.

[0083] As used in the present invention, the term "bisulfite reagent" refers to a reagent that contains bisulfite, disulfite, hydrogen sulfite, or a combination thereof in some embodiments. After treatment with the bisulfite reagent, the unmethylated cytosine nucleotides in the DNA will be converted to uracil, while the methylated cytosine and other bases remain unchanged. Therefore, it is possible to distinguish between methylated and unmethylated cytidines in, for example, CpG dinucleotide sequences.

[0084] The detection of the above-mentioned methylated DNA according to the present invention includes the following main steps: using a DNA extraction kit to extract genomic DNA and / or cell-free DNA from a biological sample to be tested; performing bisulfite conversion on the DNA; performing co-methylation detection on multiple methylated regions of the DNA after bisulfite conversion;

[0085] In some embodiments, DNA (e.g., genomic DNA, such as extracted genomic DNA or processed genomic DNA) is isolated by any standard means in the art, including using commercially available kits.

[0086] The detection of the above-mentioned methylated DNA according to the present invention preferably uses fluorescence quantitative PCR.

[0087] As used in the present invention, the term "sample" refers to any substance that may contain a target molecule to be analyzed, including biological samples. As used herein, "sample" or "biological sample" refers to any sample obtained from a living or viral (or prion) source or other macromolecular and biomolecular sources, and includes any cell type or tissue of a subject from which nucleic acids, proteins, and / or other macromolecules can be obtained. The sample or biological sample can be a sample obtained directly from a biological source or a processed sample. The sample or biological sample includes, but is not limited to, body fluids (such as whole blood, plasma, serum, cerebrospinal fluid, synovial fluid, urine, sweat, semen, feces, sputum, tears, mucus, amniotic fluid, etc.), exudates, bone marrow samples, ascites, pelvic washings, pleural fluid, spinal fluid, lymph fluid, ocular fluid, extracts from nasal, throat, or genital swabs, cell suspensions of digestive tissues, or extracts of fecal matter, as well as tissue and organ samples from humans, animals (such as non-human mammals), and plants, and processed samples derived therefrom.

[0088] As used in the present invention, the term "subject" can be a mammal or a cell, tissue, organ, or part of the mammal. In the present invention, the mammal refers to any kind of mammal, preferably a human (including a human, a human subject, or a human patient). The subject and the mammal include, but are not limited to, farm animals, sport animals, pets, primates, horses, dogs, cats, and rodents such as mice and rats.

[0089] As used in the present invention, the term "extracellular DNA" or its synonyms "cfDNA (circulating free DNA)", "circulating DNA", and "cell-free circulating DNA" refers to DNA that is freely circulating in a body fluid sample rather than being contained within intact cells in the corresponding body fluid from which the sample is taken or obtained. Extracellular DNA is typically fragmented genomic DNA.

[0090] As used in the present invention, diagnosis includes the detection or identification of the disease state or condition of a subject, determination of the likelihood that a subject will develop a given disease or condition, determination of the likelihood that a subject with a disease or condition will respond to treatment, determination of the prognosis (or its possible progression or regression) of a subject with a disease or condition, and determination of the effect of treatment on a subject with a disease or condition.

[0091] The following specifically describes the technical solutions of the present invention.

[0092] <Methylation biomarker>

[0093] In some aspects of the present invention, a methylation biomarker for diagnosing gastric cancer is provided, wherein the methylation biomarker comprises: a methylation region equivalent to and / or complementary to at least one of the target sequences shown in SEQ ID NOs. 1 to 6 and fragments of the target sequences shown in SEQ ID NOs. 1 to 6, and the methylation region comprises at least one methylation site indicated by CG.

[0094] Those skilled in the art will understand that in some embodiments, the methylation biomarker may comprise a fragment of nucleotides equivalent to and / or complementary to the full-length sequence of the target sequence shown in any one of SEQ ID NOs. 1 to 6 (i.e., the full-length sequence of the target sequence serves as the methylation region). In some embodiments, the methylation biomarker may also comprise at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% of the length of the continuous nucleotide sequence equivalent to and / or complementary to the full-length sequence of the target sequence shown in any one of SEQ ID NOs. 1 to 6 (i.e., the fragment of the target sequence serves as the methylation region). In some embodiments, the methylation region comprises at least one methylation site indicated by CG. In some embodiments, the methylation region comprises methylation sites indicated by CG equivalent to and / or complementary to some or all of the target sequences shown in any one of SEQ ID NOs. 1 to 6. In some embodiments, the methylation biomarker comprising a methylation region of the full-length sequence of one target sequence and the methylation biomarker comprising a methylation region of a partial continuous nucleotide sequence of another target sequence may also be used in combination to constitute the embodiments of the methylation biomarker described above.

[0095] In some embodiments, the methylation biomarker comprises at least a methylation region equivalent to and / or complementary to at least one of the target sequences shown in SEQ ID NOs. 4 to 6 and fragments of the target sequences shown in SEQ ID NOs. 4 to 6, and the methylation region comprises at least one methylation site indicated by CG.

[0096] In some embodiments, the methylation biomarker comprises: methylation regions equivalent to and / or complementary to at least two, at least three, at least four, or at least five of the target sequences shown in SEQ ID NOs. 1 to 6 and fragments of the target sequences shown in SEQ ID NOs. 1 to 6, and the methylation region comprises at least one methylation site indicated by CG.

[0097] In some embodiments, the methylation biomarker comprises: a methylation region equivalent to and / or complementary to six of the target sequences shown in SEQ ID NOs. 1-6 and fragments of the target sequences shown in SEQ ID NOs. 1-6, and the methylation region comprises at least one methylation site indicated by CG. Exemplarily, the methylation biomarker comprises: comprising a sequence equivalent to or complementary to the target sequence shown in SEQ ID NO. 1 or a fragment thereof, a sequence equivalent to or complementary to the target sequence shown in SEQ ID NO. 2 or a fragment thereof, a sequence equivalent to or complementary to the target sequence shown in SEQ ID NO. 3 or a fragment thereof, a sequence equivalent to or complementary to the target sequence shown in SEQ ID NO. 4 or a fragment thereof, a sequence equivalent to or complementary to the target sequence shown in SEQ ID NO. 5 or a fragment thereof, and a sequence equivalent to or complementary to the target sequence shown in SEQ ID NO. 6 or a fragment thereof.

[0098] In some embodiments, the gastric cancer is gastric cancer from a subject, and the subject is a mammal; preferably, the mammal is a human.

[0099] In some embodiments, if the methylation level of the methylation biomarker in the test sample is different from the methylation level of the methylation biomarker in the sample of a subject without gastric cancer, it indicates that the subject corresponding to the test sample has gastric cancer.

[0100] In some embodiments, there is no limitation on the typing and staging of gastric cancer. In some specific embodiments of the present invention, the gastric cancer is selected from gastric cancer of stage I, stage II, stage III or stage IV. In some specific embodiments of the present invention, the gastric cancer is selected from high-grade intraepithelial neoplasia, B-cell lymphoma, diffuse, intestinal type, or mixed-type gastric cancer.

[0101] In some embodiments, the subject without gastric cancer can be a healthy subject. In some embodiments, the subject without gastric cancer can include subjects suffering from non-gastric cancer diseases selected from non-atrophic gastritis, intestinal metaplasia, atrophic gastritis, gastric ulcer, gastric erosion, gastric polyp, gastric benign tumor, other gastric benign diseases, intestinal benign diseases or liver benign diseases.

[0102] In some embodiments, the methylation level of the methylation biomarker is detected by one or more of the following methods: quantitative fluorescence PCR (qPCR), methylation-specific PCR (MSP), digital PCR (ddPCR), DNA methylation chip, targeted DNA methylation sequencing, whole genome bisulfite sequencing (WGBS), methylation-sensitive restriction enzyme (MS-RE)-PCR / Southern method, direct sequencing method, methylation-sensitive single nucleotide primer extension (Ms-SnuPE), combined bisulfite restriction enzyme method (COBRA), methylation-sensitive single-strand conformation analysis (MS-SSCA), methylation-sensitive denaturing gradient gel electrophoresis (MSDGGE), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO), methylation-sensitive melting curve analysis (MS-MCA), methylation-sensitive dot blot analysis (MS-DBA), methylation-specific multiplex ligation-dependent probe amplification, bisulfite sequencing, pyrosequencing, DNA methylation mass spectrometry (MassArray).

[0103] In some preferred embodiments, the method includes quantitative fluorescence PCR, such as singleplex quantitative fluorescence PCR or multiplex quantitative fluorescence PCR.

[0104] In some specific embodiments of the present invention, the sample to be tested is selected from one or more of tissue, whole blood, plasma, saliva, serum, urine, urine exfoliated cells, urinary sediment, and urine supernatant. In some preferred embodiments of the present invention, the sample to be tested is tissue, whole blood, plasma or serum.

[0105] In some more preferred embodiments of the present invention, the sample to be tested is whole blood, plasma or serum. Due to aspects such as the convenience of sampling, the diagnosis described in the present invention includes early screening, detection / diagnosis, or auxiliary detection / diagnosis of gastric cancer. In some specific embodiments of the present invention, the methylation region is the methylation region present in cfDNA. In some more specific embodiments, the methylation region is the methylation region present in cfDNA in whole blood, plasma or serum samples.

[0106] <Use of methylation biomarker>

[0107] In some aspects of the present invention, there is provided the use of the above-mentioned methylation biomarker in the preparation of a reagent or kit for diagnosing gastric cancer.

[0108] In other aspects of the present invention, there is provided the use of a reagent for determining the methylation level of the above-mentioned methylation biomarker in the preparation of a reagent or kit for diagnosing gastric cancer.

[0109] In some embodiments, the reagent for determining the methylation level of the above-mentioned methylation biomarker comprises primers and / or probes; wherein, the primers amplify a sequence containing the above-mentioned methylation biomarker; the probe hybridizes at least partially with the sequence of the above-mentioned methylation biomarker.

[0110] Furthermore, the reagent comprises at least one set of primers and probes selected from the following:

[0111] (1) Primers as shown in SEQ ID NO.7 and 8, and a probe as shown in SEQ ID NO.9;

[0112] (2) Primers as shown in SEQ ID NO.10 and 11, and a probe as shown in SEQ ID NO.12;

[0113] (3) Primers as shown in SEQ ID NO.13 and 14, and a probe as shown in SEQ ID NO.15;

[0114] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0115] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0116] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0117] In some preferred embodiments, the reagent comprises at least one set of primers and probes selected from the following:

[0118] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0119] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0120] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0121] <Kit for diagnosing gastric cancer>

[0122] In some aspects of the present invention, a kit for diagnosing gastric cancer is provided, wherein the kit contains reagents for detecting the methylation level of the above-mentioned methylation biomarker in a sample to be tested.

[0123] In some embodiments, the reagent is a reagent used in a method for detecting the methylation level or detecting the methylation levels of multiple DNA methylation regions selected from the following: quantitative fluorescence PCR (qPCR), methylation-specific PCR (MSP), digital PCR (ddPCR), DNA methylation chip, targeted DNA methylation sequencing, whole-genome bisulfite sequencing (WGBS), methylation-sensitive restriction enzyme (MS-RE)-PCR / Southern method, direct sequencing method, methylation-sensitive single nucleotide primer extension (Ms-SnuPE), combined bisulfite restriction enzyme method (COBRA), methylation-sensitive single-strand conformation analysis (MS-SSCA), methylation-sensitive denaturing gradient gel electrophoresis (MSDGGE), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO), methylation-sensitive melting curve analysis (MS-MCA), methylation-sensitive dot blot analysis (MS-DBA), methylation-specific multiplex ligation-dependent probe amplification, bisulfite sequencing, and pyrosequencing, DNA methylation mass spectrometry (MassArray).

[0124] In some preferred embodiments, the method for detecting the methylation level or detecting the methylation levels of multiple DNA methylation regions includes the quantitative fluorescence PCR method.

[0125] In some specific embodiments, the reagent includes primers and / or probes; wherein, the primers amplify a sequence containing the above-mentioned methylation biomarker; the probe hybridizes at least partially with the sequence of the above-mentioned methylation biomarker.

[0126] Furthermore, the reagent includes at least one set of primers and probes selected from the following:

[0127] (1) Primers as shown in SEQ ID NO.7 and 8, and a probe as shown in SEQ ID NO.9;

[0128] (2) Primers as shown in SEQ ID NO.10 and 11, and a probe as shown in SEQ ID NO.12;

[0129] (3) Primers as shown in SEQ ID NO.13 and 14, and a probe as shown in SEQ ID NO.15;

[0130] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0131] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0132] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0133] In some preferred embodiments, the reagent at least includes at least one set of primers and probes selected from the following:

[0134] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0135] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0136] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0137] Typically, in a kit for diagnosing gastric cancer, the reagent further contains corresponding internal reference primers and probes and an internal reference sequence, such as the internal reference shown below:

[0138] Internal reference ACTB sequence (SEQ ID NO.28):

[0139] AAAACCTACTCCTCCCTTAAAAATTACAAAAACCACAACCTAATAAAAAAAATAACCACCACCCAACACACAATAACAAACACAAATTCACAATCCAAAAAACTTACTAAACCTCCTCCATCAC

[0140] The primers and probes corresponding to this internal reference sequence are:

[0141] Primers as shown in SEQ ID NO.25 and 26, and a probe as shown in SEQ ID NO.27.

[0142] In some specific embodiments of the present invention, the fluorescent group modification is, for example, probe reporter fluorescent groups such as FAM, VIC, NED, and CY5, and probe quenching fluorescent groups such as BHQ1, BHQ2, and BHQ3.

[0143] Primers and probes having at least 70%, 80%, 90%, 95% or 99% sequence identity with the sequences of the primers and probes shown in the context of the present invention are also included within the scope of the present invention.

[0144] In some specific embodiments of the present invention, the sample to be tested is selected from one or more of tissue, whole blood, plasma, saliva, serum, urine, exfoliated urinary cells, urinary sediment, and urine supernatant. In some preferred embodiments of the present invention, the sample to be tested is tissue, whole blood, plasma or serum. In some more preferred embodiments of the present invention, the sample to be tested is whole blood, plasma or serum. Due to aspects such as the convenience of sampling, the kit for diagnosing gastric cancer provided by the present invention can be a kit for early screening, detection or auxiliary detection of gastric cancer.

[0145] In some specific embodiments of the present invention, the sample to be tested is from a subject, and the subject is a mammal; preferably, the mammal is a human.

[0146] <Use of a combination of primers and probes>

[0147] Use of at least one group selected from the following combinations of primers and probes in the preparation of a reagent or kit for diagnosing gastric cancer, wherein the combination of primers and probes is used to detect the methylation level of the methylation biomarker as described above: The reagent includes at least one group of primers and probes selected from the following:

[0148] (1) Primers as shown in SEQ ID NO.7 and 8, and a probe as shown in SEQ ID NO.9;

[0149] (2) Primers as shown in SEQ ID NO.10 and 11, and a probe as shown in SEQ ID NO.12;

[0150] (3) Primers as shown in SEQ ID NO.13 and 14, and a probe as shown in SEQ ID NO.15;

[0151] (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18;

[0152] (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21;

[0153] (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24.

[0154] In some preferred embodiments, the reagent includes at least one group of primers and probes selected from the following:

[0155] (4) Primers shown in SEQ ID NO.16 and 17, and a probe shown in SEQ ID NO.18;

[0156] (5) Primers shown in SEQ ID NO.19 and 20, and a probe shown in SEQ ID NO.21;

[0157] (6) Primers shown in SEQ ID NO.22 and 23, and a probe shown in SEQ ID NO.24.

[0158] <Gastric cancer diagnosis system>

[0159] Some aspects of the present invention provide a system for diagnosing gastric cancer, wherein the system includes a detection device, a computing device, and an output device;

[0160] The detection device includes a sampler and a detector. The sampler is used to collect a sample from a subject, and the detector is used to detect the methylation level of the above-mentioned methylation biomarker in the sample;

[0161] The computing device includes a memory and a processor. A computer program is stored in the memory, and the processor is configured to execute the computer program stored in the memory to achieve the following discrimination:

[0162] If the methylation level of the methylation biomarker in the sample is different from the methylation level of the methylation biomarker measured in the samples from healthy subjects and / or subjects with benign gastric tumors, it is discriminated that the subject corresponding to the sample has gastric cancer.

[0163] In some specific embodiments, the output device is used to output the detection result of the detection device and / or the discrimination result of the computing device. The output device includes at least one of a display, a printer, and an audio output device; the computing device includes at least one of a computer mainframe, a central processing unit, and a network server.

[0164] <Gastric cancer diagnosis method>

[0165] In some aspects of the present invention, a method for diagnosing gastric cancer is provided, which includes the following steps:

[0166] Obtain a sample from a subject;

[0167] Extract genomic DNA and / or cell-free DNA of the sample;

[0168] Detect the methylation level of the above-mentioned methylation biomarker in the DNA;

[0169] Determine whether the subject has gastric cancer.

[0170] Example

[0171] The present invention will be further described below by way of examples and test examples, but it is not intended to limit the present invention. The specific materials used in the embodiments of the present invention and their sources are provided below. However, it should be understood that these are merely exemplary and are not intended to limit the present invention. Materials that are the same as or similar to the types, models, qualities, properties or functions of the following reagents and instruments can be used to implement the present invention. Unless otherwise specified, the experimental methods used in the following examples and test examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples and test examples can be obtained from commercial sources.

[0172] Example 1

[0173] This example discloses a DNA methylation marker region for detecting and diagnosing tumor diseases in an individual biological sample, which is selected from target sequences that are identical or complementary to at least one methylation region indicated by [CG] in the regions listed in Table 1.

[0174] Table 1. Target sequences of DNA methylation regions

[0175]

[0176] In Table 1 above, the base numbers are based on the human genome assembly GRCh37 / hg19 in February 2009 (see, for example, Rosenbloom et al. (2012) “ENCODE whole-genome data in the UCSC Genome Browser: update 2012” Nucleic Acids Research 40: D912-D917).

[0177] SEQ ID NO.1

[0178] AAGCGCGTTCACATAATACGAAGAACTCATAATTTTGACCTGTGATTTGTTGTCCGGCAGCTTTCAGTGTCGGTTTTACGAGGTAGAGTGATATATGATAACATTACACCCCCAGATTTACACCAAACCCCATTTTCTTTTGGACGGAGCTCGCCGCAGCACGTGACCGCCCACATGACCGCCTCCGCCAATCTCAGCAGTCCTCACAGGTGGTCTCGCTCCGCAGGGCCCGCAGCCGCCTAGAATGGAAGGGCAAGAGGCTCAAATATGCGGCCAAAGAATCCGCCCGCGCCCGGCGGGCCTGGCGCGTCCCGCGGAAAAAGACCTGGAGGCTCCGCGGGAGCGCCCAGCTGGCGGCCAACCTCCGCACTGGGGTCTGCGGACGCCAGGCGGCCCGGCCCCACGCAGCACCCCCCACCCCGCCCCCCCGCCGACTCCTGCTAGTGAGCCCTGGACCAAGCTTGGGATCCTCCCCATCCCTCTCCTGTCCGCCTGCCCAGACCCTGGAAGGGTCTCTGTCCCCCGCAACAGCCTGCCCCGCGGTGGCCTTGTGGGCAGGACTCAGCTATGAGCAGATCGACT

[0179] SEQ ID NO.2

[0180] AAGTCGGCTCAGCCGCCCGCGTTCCGGGGGACACTAGGTGTCGATCACCTGCGCGGGTCGGGGATGGGGCTATGCAAAGGGTGACTCACCAGACCGAAGTCGTTCTCAGCCTTGGACCAGGAGGCTGCCAGAGACAGCAGCAGGAAGATCGCGGCAAACACCCAAACCCTACAGCCTCCCCAGAAGCCCAGAATCCGCGGCCCCCAGCGTCTGTCCGGGAGCGCCGTGCTGGGTCGCTCCCCAGTCATCTCTCCCCGCAGCTGCCGCGACCCTGGCAGCTAGACTCCACAGAGTCGGGAGTCAGCTGACCCGGACCCTTTAAAGCGCAGATGTCACCCTTAAGCCCGCCCCGGTCTGGAGGCCCCGCCGCGCTTCCCGGACTCTAATTGGTCTTCAAGTAGCTCATCTCCTCCCACGTGATCACGCAGCATCTCGAAGCTTGCCCTTCCGATTGGCCCTCTTGGAGGCCCTCTTGGAGGCCCGGAGCGCGTGACCCGAACGGGAAGCGGACTGGCTGGGGTGAAGAAGGGACTGGCACCATCCTTATTGGGCTTTTTGATTGGCCGCGGCACCAGGACACGTCACAGGGGCGGGGCCGATTTTAAAGAGCCGGGCGCGGAAAAAAAAAGGCCGCCTGTCGTCGTGGAGAGAATGAGT

[0181] SEQ ID NO.3

[0182] TGTTCCCCGACTGGAAATGCTTTACGGAAGCGTCTTGGACAGGGTCTCCGCCAGGCGACAAGAGCTCGGTGCTGAGATGTGTTACGTTCTCATCTCCCCATCAATTATGGATGGAAACAAATAAGGAAGAGTCAATTTTGCTGAGCCCCTTCTCCGGCAACGAGAGGCGTTCTGCAGCCGGGAGGGAGCCGCCGCTCGCGCCGGCAGCCGCTGGCAGGGGCATGGTGAGGAGGAAGGTAGGGAAACTTTTATTTCCCGTCTTGACAGCGGCGGTGTTTGTCCCTGGTCTGCAGAAACTGATACAGTAGCCTCCTTCCTTGGGTAATTTAGGAGGGCTTGAAGCTTCTT

[0183] SEQ ID NO.4

[0184] GCAAGAGTCAGTCCCCAAACATATGTCACCGACTTCATAGCAGTGCACAAAGTGTCTCTGCCTGTAGAAGACTCTGTCTGAACCTTAAAGATCCGGTGTGGTGACAACGGAGCGCATCCCTGTGCAAGGCGAAGAGGCTGCGCTCCCGACGCACTTGGCCGCAGCGCCACCACGTGTTCTCAGGCGTCTGCACATTCCCCCGGCCAGGCATGCGGTTCAGTCTCTGCCTTCCACACAGGTCTGCTAAGAGCTCAGGAAGCGCCATGCACTGTGCTAGGGGTAGGATGAAAGCAGGACCAAGACAACGCTTACAGCCTGGGGGCTGAGCAGGGGATGCAATCACAAGAGGACGGGAGGCTT

[0185] SEQ ID NO.5

[0186] TGCCAAAACTAACTCCCACCACCTCCGGCGACCCACAGTCTTAGCAACAGTAGCTAGGGACACTACCCAGTGAGCACCTTGGCAGCCAGGATCCCGCCTCCTCCCTCTAATTGGTCGCGACCGGAAGGAGGCCACTACGGGGCGGGGCTAGGGAGGGGAGGGCGGGGGTGGAGAGGAGAGCGCTGCGCATGCGCATGAGCGAGTGTCTGGGCTCTGGGTTTAGCGCCGGACCCGGCCTGGACCGTGTGGTTAAAGGGGAACAACCACCATGCCTTGCCCCGCCCCGCTCATTCACCCATTTTATTCTCCATGCCCTTGCCTTTAAAAAAAAATACAGCACTGGGCCGGGCGTGGTGGCTC

[0187] SEQ ID NO.6

[0188] CAGGGCTCAGCTCTTTGGAGCTGCCCATTCCTCCGGCTGCGAGAAAGGACGCGCGCCCTGCGTCGGGCGAAGAAAAGAAGCAAAACTTGTCGGGAGGGTTTCGTCATCAACCTCCTTCCCGCAAACCTAAACCTCCTGCCGGGGCCATCCCTAGACAGAGGAAAGTTCCTGCAGAGCCGACCAGCCCTAGTGGATCTGGGGCAGGCAGCGGCGCTGGCTGTGGAATTAGATCTGTTTTGAACCCAGTGGAGCGCATCGCTGGGGCTCGGAAGTCACCGTCCGCGGGCACCGGGTTGGCGCTGCCCGAGTGGAACCGACAGTTTGCGAGCCTCGGCTGCAAGTGGCCTCTCCTCCCCGCGGTTGTTGTTCAGTGTCGGGTGAGGGCTGCGAGTGTGGCAAGTTGCAAAGAGAGCCTCAGAGGTCCGAAGAGCGCTGCGCTCCTACTCGCGTTCGCTTCTTCCTCTTCTCGGTTCCCTACTG

[0189] Example 2

[0190] This example discloses the primer-probe sequences of DNA multi-methylation markers for detecting the risk of gastric cancer in individuals.

[0191] Table 2. Primer Pairs and Probes for the Detection of Multigene Methylation in Gastric Cancer

[0192]

[0193] Among them, FAM, VIC, NED, and CY5 are probe reporting fluorophores; BHQ1, BHQ2, and BHQ3 are probe quenching fluorophores.

[0194] Example 3

[0195] This example discloses reagent components and a detection method for the detection of DNA multigene methylation for individual gastric cancer risk using the said primer probes.

[0196] Table 3. Composition of the Gastric Cancer Multigene Methylation Detection Kit

[0197]

[0198] Methylation detection is performed on 6 methylation regions (SEQ ID NO.1 - 6). The specific process is as follows:

[0199] 1. Take 2 mL or more of plasma samples, and extract cell-free DNA (cfDNA) using the QIAGEN cell-free DNA extraction kit (QIAamp Circulating Nucleic Acid Kit, product number 55114). For each sample to be detected, the cfDNA extracted from 2 mL of plasma is subjected to bisulfite conversion using the ZYMO conversion kit (EZ-96 DNA Methylation-Gold MagPrep, product number D5402). Commercial fully methylated (positive control) and non-methylated (negative control) standards (purchased from QIAGEN) are used for bisulfite conversion and subsequent detection synchronously with the samples.

[0200] 1) Reagent preparation: Take out Amplification Solution 1, Amplification Solution 2, Amplification Solution 3, and Amplification Solution 4 and equilibrate them to room temperature, then mix well for standby. Negative control, positive control, and blank control are detected synchronously with the samples.

[0201] 2) Preparation of PCR reaction solution:

[0202] Add each component according to Table 4 to prepare PCR reaction solutions containing Amplification Solution 1 or Amplification Solution 2 respectively:

[0203] Table 4. Preparation of PCR Reaction Solution

[0204]

[0205] 3) Preparation of PCR reaction plate: Add 15 μL of PCR reaction solution and 10 μL of transformed DNA to each reaction well of the 96-well plate. After sample addition, use a film press to seal and reinforce the sealing film of the 96-well plate, and centrifuge it at 1000×g (rcf) in a centrifuge for 1 min.

[0206] 4) PCR amplification

[0207] Place the PCR reaction plate into the ABI 7500 PCR instrument and perform the corresponding PCR program and fluorescence channel settings in the software:

[0208] Set the fluorescence quantitative PCR reaction program according to Table 5.

[0209] Table 5. PCR reaction program

[0210]

[0211] Note: "X" is to collect fluorescence signals.

[0212] The amplification curves obtained using the methylation rate standards of 2.5%, 5%, and 10% for the 6 targets are as Figures 1A to 1F shown.

[0213] The Ct values of the detected targets, or the relative Ct values obtained by subtracting the internal reference (target Ct value - internal reference Ct value), can be used for further data analysis. When PCR amplification is not detected, assign a value of 40 to the Ct value of the corresponding target and then perform subsequent data analysis.

[0214] Example 4 Establishment of clinical detection performance of target regions

[0215] 1. Sample collection

[0216] A total of 422 clinical samples of gastric cancer and non-gastric cancer were collected. Among them, the case group consisted of 83 blood samples from patients clinically and pathologically diagnosed with gastric cancer, and the control group consisted of 339 blood samples from patients clinically diagnosed as non-gastric cancer. The case group and the control group covered different age groups (18 years old to 88 years old). The tumor patient cases included different pathological types, different AJCC stages, and different classifications; the digestive system benign diseases included different benign disease subtypes. The classification and number of cases of the two groups of samples are statistically analyzed as shown in Table 6.

[0217] Table 6. Statistical analysis of case information of 422 clinical samples

[0218]

[0219] Note: There are cases where two or more benign diseases coexist in digestive system benign diseases.

[0220] 2. Performance analysis of target regions

[0221] The methylation detection of 6 target regions was performed on these samples according to the detection and data processing method of Example 3. The obtained target Ct values or relative Ct values were compared with the pathological results and clinical diagnoses. After comprehensively considering the gender, age, pathological type, and AJCC stage of the samples, the training set and validation set were randomly divided according to 6:4. The positive / negative was judged by the fitting score method of the logistic regression formula. The calculation formula of the logistic regression model obtained from the training set is as follows:

[0222] Logistic regression formula score = 1 / (1 + e (-x) )

[0223] where x = weight 1 × SEQ ID NO.1 + weight 2 × SEQ ID NO.2 + weight 3 × SEQ ID NO.3 + weight 4 × SEQ ID NO.4 + weight 5 × SEQ ID NO.5 + weight 6 × SEQ ID NO.6 + intercept, and weights 1-6 and the intercept are all constants. e represents the natural constant, and its value is approximately 2.718281828459045. The fitting of the 6-gene logistic regression formula was implemented using the Logistic Regression software package of Sklearn, and the parameters were default parameters.

[0224] The performance data of single-target and combined detection of any targets among the 6 targets are shown in Table 7. The sensitivity, specificity, and accuracy of the validation set are relatively similar to those of the training set, indicating that these markers and their combined models have good stability and generalization ability. For most of the markers and their combined models, their performance is compared with the currently marketed gastric cancer auxiliary detection product (RNF180 / Septin9 gene methylation detection kit (PCR fluorescence probe method) (National Medical Device Registration No. 20203400447), sensitivity 61.76%, specificity 85.07%, accuracy 72.04%). The accuracy of these markers and their combined models is better than that of the marketed products, and the others are at the same level as theirs.

[0225] Table 7. Clinical detection performance of the kit (established)

[0226]

[0227]

[0228]

[0229]

[0230]

[0231] Verification of clinical detection performance of target regions in Example 5

[0232] A total of 183 clinical samples of gastric cancer and non - gastric cancer were collected for the performance verification of the target regions. Among them, 39 blood samples of patients clinically and pathologically diagnosed with gastric cancer, and 144 blood samples of patients clinically diagnosed as non - gastric cancer in the control group. The case group and the control group covered samples of different age groups (17 years old to 86 years old). The tumor patient cases included different pathological types, different AJCC stages, and different classifications; the benign diseases of the digestive system included different subtypes of benign diseases. The classification and the number of cases of the two groups of samples are statistically shown in Table 8. According to the detection and data - processing methods of Example 3, methylation detection of 6 target regions was performed on these samples. The model method in Example 4 was applied to make a qualitative judgment on these samples.

[0233] Table 8. Statistical analysis of case information of 183 test set (independent verification) samples

[0234]

[0235]

[0236] Note: There are cases where two or more benign diseases of the digestive system co - occur.

[0237] The verification performance data of single - target and combined detection of any target of the 6 targets are shown in Table 9:

[0238] Table 9. Verification results of the performance of 6 target regions

[0239]

[0240]

[0241]

[0242]

[0243] For most of the markers and their combined models, their performance, compared with the currently marketed gastric cancer auxiliary detection products (RNF180 / Septin9 gene methylation detection kit (PCR fluorescence probe method) (National Medical Device Registration No. 20203400447), with a sensitivity of 61.76%, a specificity of 85.07%, and an accuracy of 72.04%), the accuracy of these markers and their combined models is better than that of the marketed products, and the others are at the same level as theirs.

[0244] The technical features of the above - described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above - described embodiments are described. However, as long as the combinations of these technical features do not conflict, they should all be considered as the scope described in this specification.

[0245] The embodiments described above merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A methylation biomarker for diagnosing gastric cancer, wherein, The methylated biomarker described above comprises: A methylated region equivalent to and / or complementary to at least one of the target sequences shown in SEQ ID NOs. 1 to 6 and fragments of the target sequences shown in SEQ ID NOs. 1 to 6, and the methylated region contains at least one methylation site indicated by CG; Optionally, the methylated biomarker at least comprises: A methylated region equivalent to and / or complementary to at least one of the target sequences shown in SEQ ID NOs. 4 to 6 and fragments of the target sequences shown in SEQ ID NOs. 4 to 6.

2. The methylation biomarker for diagnosing gastric cancer according to claim 1, wherein, The gastric cancer is gastric cancer from a subject, and the subject is a mammal; preferably, the mammal is a human; and / or, The gastric cancer is selected from gastric cancer in stage I, II, III or IV; and / or, The gastric cancer is selected from high-grade intraepithelial neoplasia, B-cell lymphoma, diffuse, intestinal, or mixed gastric cancer.

3. The methylation biomarker for diagnosing gastric cancer according to claim 1 or 2, wherein, If the methylation level of the methylated biomarker in the sample to be tested is different from the methylation level of the methylated biomarker in the sample of a subject without gastric cancer, it indicates that the subject corresponding to the sample to be tested has gastric cancer.

4. The methylation biomarker for diagnosing gastric cancer according to claim 3, wherein, The sample to be tested is selected from one or more of tissue, whole blood, plasma, saliva, serum, urine, urine exfoliated cells, urinary sediment, and urine supernatant; preferably, the sample to be tested is tissue, whole blood, plasma or serum, and more preferably, the sample to be tested is whole blood, plasma or serum.

5. The methylation biomarker for diagnosing gastric cancer according to any one of claims 1 to 4, wherein, The methylated region is a methylated region present in cfDNA.

6. The methylation biomarker for diagnosing gastric cancer according to any one of claims 1 to 5, wherein, Detecting the methylation level of the methylated biomarker by one or more of the following methods: fluorescence quantitative PCR (qPCR), methylation-specific PCR (MSP), digital PCR (ddPCR), DNA methylation chip, targeted DNA methylation sequencing, whole-genome methylation sequencing (WGBS), methylation-sensitive restriction endonuclease (MS-RE)-PCR / Southern method, direct sequencing method, methylation-sensitive single nucleotide primer extension (Ms-SnuPE), bisulfite-conjugated restriction endonuclease method (COBRA), methylation-sensitive single-strand conformation analysis (MS-SSCA), methylation-sensitive denaturing gradient gel electrophoresis (MSDGGE), methylation-specific denaturing high performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO), methylation-sensitive melting curve analysis (MS-MCA), methylation-sensitive dot blot analysis (MS-DBA), methylation-specific multiplex ligation-dependent probe amplification, bisulfite sequencing and pyrosequencing, DNA methylation mass spectrometry (MassArray); Preferably, the method includes the fluorescence quantitative PCR method.

7. Use of the following (i) or (ii): (i) Use of the methylated biomarker for diagnosing gastric cancer according to any one of claims 1 to 6 in the preparation of a reagent or kit for diagnosing gastric cancer; (ii) Use of a reagent for determining the methylation level of a methylation biomarker for diagnosing gastric cancer as described in any one of claims 1 to 6 in the preparation of a reagent or kit for diagnosing gastric cancer.

8. A kit for diagnosing gastric cancer, wherein, The kit contains a reagent for detecting the methylation level of a methylation biomarker for diagnosing gastric cancer as described in any one of claims 1 to 6 in a test sample.

9. The kit for diagnosing gastric cancer according to claim 8, wherein, The reagent is a reagent used in a method for detecting the methylation level or detecting the methylation levels of multiple DNA methylation regions selected from the following: Quantitative fluorescence PCR (qPCR), methylation-specific PCR (MSP), digital PCR (ddPCR), DNA methylation microarray, targeted DNA methylation sequencing, whole-genome bisulfite sequencing (WGBS), methylation-sensitive restriction enzyme (MS-RE)-PCR / Southern method, direct sequencing method, methylation-sensitive single nucleotide primer extension (Ms-SnuPE), bisulfite-converted restriction enzyme method (COBRA), methylation-sensitive single-strand conformation analysis (MS-SSCA), methylation-sensitive denaturing gradient gel electrophoresis (MSDGGE), methylation-specific denaturing high-performance liquid chromatography (MS-DHPLC), methylation-specific microarray (MSO), methylation-sensitive melting curve analysis (MS-MCA), methylation-sensitive dot blot analysis (MS-DBA), methylation-specific multiplex ligation-dependent probe amplification, bisulfite sequencing, and pyrosequencing, DNA methylation mass spectrometry (MassArray); Preferably, the method includes the quantitative fluorescence PCR method.

10. The kit for diagnosing gastric cancer according to claim 8 or 9, wherein, The reagent includes at least one set of primers and probes selected from the following: (1) Primers as shown in SEQ ID NO.7 and 8, and a probe as shown in SEQ ID NO.9; (2) Primers as shown in SEQ ID NO.10 and 11, and a probe as shown in SEQ ID NO.12; (3) Primers as shown in SEQ ID NO.13 and 14, and a probe as shown in SEQ ID NO.15; (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18; (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21; (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.24; Optionally, the reagent includes at least one set of primers and probes selected from the following: (4) Primers as shown in SEQ ID NO.16 and 17, and a probe as shown in SEQ ID NO.18; (5) Primers as shown in SEQ ID NO.19 and 20, and a probe as shown in SEQ ID NO.21; (6) Primers as shown in SEQ ID NO.22 and 23, and a probe as shown in SEQ ID NO.

24.

11. The kit for diagnosing gastric cancer according to any one of claims 8 to 10, wherein, The sample to be tested is selected from one or more of tissue, whole blood, plasma, saliva, serum, urine, urine exfoliated cells, urinary sediment, and urine supernatant; preferably, the sample to be tested is tissue, whole blood, plasma or serum, and more preferably, the sample to be tested is whole blood, plasma or serum.

12. Use of at least one set of combination of primers and probes selected from the following in the preparation of a reagent or kit for diagnosing gastric cancer, wherein The combination of the primers and probes is used to detect the methylation level of the methylation biomarker for diagnosing gastric cancer as described in any one of claims 1 to 6. The reagent includes at least one set of primers and probes selected from the following: (1) Primers shown in SEQ ID NO.7 and 8, and a probe shown in SEQ ID NO.9; (2) Primers shown in SEQ ID NO.10 and 11, and a probe shown in SEQ ID NO.12; (3) Primers shown in SEQ ID NO.13 and 14, and a probe shown in SEQ ID NO.15; (4) Primers shown in SEQ ID NO.16 and 17, and a probe shown in SEQ ID NO.18; (5) Primers shown in SEQ ID NO.19 and 20, and a probe shown in SEQ ID NO.21; (6) Primers shown in SEQ ID NO.22 and 23, and a probe shown in SEQ ID NO.

24. Optionally, the reagent includes at least one set of primers and probes selected from the following: (4) Primers shown in SEQ ID NO.16 and 17, and a probe shown in SEQ ID NO.18; (5) Primers shown in SEQ ID NO.19 and 20, and a probe shown in SEQ ID NO.21; (6) Primers shown in SEQ ID NO.22 and 23, and a probe shown in SEQ ID NO.24.

Images