Molecular marker related to chicken plasma natural immune globulin G antibody level and application thereof

Abstract

The invention relates to the technical field of livestock and poultry breeding, and discloses a molecular marker related to a chicken plasma natural immune globulin G antibody level and application of the molecular marker. The molecular marker related to the chicken plasma natural immune globulin G antibody level is the 251st nucleotide in SEQ ID NO: 1, and the polymorphic form is G or A. According to the SNP molecular marker related to the chicken plasma natural immune globulin G antibody level, the chicken plasma natural immune globulin G antibody level can be bred on the gene level, the chicken plasma natural immune globulin G antibody level is directly screened from the source, genetic information is accurately grasped, and the screening efficiency is improved. The method effectively avoids the defects of a traditional method, remarkably improves the breeding efficiency and accuracy, can be applied to chicken breeding practice on a large scale, and promotes industrial development.

Description

Technical Field

[0001] The present invention relates to the technical field of livestock and poultry breeding, and more specifically, to a molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma and its application. Background Art

[0002] Natural antibodies, as antibodies produced by animal bodies without any antigen stimulation, belong to the innate immune system and are the first line of defense against pathogens. The level of natural antibodies can reflect the potential immune capacity and disease resistance of animals. The efficient production of laying hens and broilers highly depends on the continuous and intense selection of key economic traits such as growth rate, feed conversion efficiency, and egg production, as well as the cultivation of specialized breeds. However, while improving production performance, it usually leads to a decrease in animal immunity and a weakening of general disease resistance. This phenomenon poses new challenges to poultry farming, that is, while pursuing efficient production, animal health is threatened. Some studies have shown that the level of natural immunoglobulin G antibody in chicken plasma is closely related to the general disease resistance, viability, and production performance of chickens. The higher the IgG antibody level, the stronger its resistance to common diseases. This trait has moderate heritability and is therefore a suitable trait for selection. However, the measurement process of this trait is rather cumbersome, and the measurement week age usually needs to be carried out after the chickens reach adulthood, resulting in a longer selection cycle. The traditional breeding method based on the combination of trait measurement and pedigree has the problems of high cost and slow breeding progress. Genome-wide association analysis (GWAS) deeply excavates genetic variations such as SNPs related to complex traits at the genome level, and uses SNP and other molecular marker technologies to select genetic variations, achieving early and precise selection of traits, thereby significantly improving the breeding efficiency of target traits at the genetic level and accelerating genetic progress. Based on this, providing a molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma and applying it to chicken breeding is expected to breed chickens with a high level of natural immunoglobulin G antibody in plasma. Summary of the Invention

[0003] The purpose of the present invention is to provide a molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma and its application.

[0004] To achieve the above purpose, the present invention provides the following technical solutions:

[0005] One of the technical solutions of the present invention:

[0006] An SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma, wherein the SNP molecular marker is the 251st nucleotide in SEQ ID NO: 1, and the polymorphism form is G or A.

[0007] Furthermore, when the SNP molecular marker is of the AA genotype, the level of natural immunoglobulin G antibody in chicken plasma is high; when the SNP molecular marker is of the GG genotype, the level of natural immunoglobulin G antibody in chicken plasma is low.

[0008] The second technical solution of the present invention:

[0009] A primer pair for detecting the above SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma. In the primer pair, the nucleotide sequence of the upstream primer is ACCGTCACAGCACTCACCTCT, and the nucleotide sequence of the downstream primer is CACACCACAACAAGCAGAACCT.

[0010] The third technical solution of the present invention: The application of the above SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma in identifying or assisting in identifying the level of natural immunoglobulin G antibody in breeder chicken plasma. The specific application is: detecting the genotype of the SNP in the chicken to be tested. The individual chicken to be tested with the AA genotype is an individual with a high level of natural immunoglobulin G antibody in plasma, and the individual chicken to be tested with the GG genotype is an individual with a low level of natural immunoglobulin G antibody in plasma.

[0011] The fourth technical solution of the present invention:

[0012] The application of the above SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma in chicken breeding. The specific application is: detecting the genotype of the SNP in the chicken to be tested, and selecting the parent with the AA genotype for breeding the strain with a high level of natural immunoglobulin G antibody in plasma.

[0013] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0014] The present invention provides an SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma, which can select and breed the level of natural immunoglobulin G antibody in chicken plasma at the gene level, directly screen the level of natural immunoglobulin G antibody in chicken plasma from the source, accurately grasp the genetic information, effectively avoid the drawbacks of traditional methods, significantly improve the efficiency and accuracy of selection and breeding, can be widely applied to chicken breeding practice, and promote the development of the industry;

[0015] The present invention provides a primer pair for detecting the SNP molecular marker related to the level of natural immunoglobulin G antibody in chicken plasma, which further facilitates the detection of the SNP molecular marker and the identification of the genotype, and provides strong technical support for chicken breeding. Description of the Drawings

[0016] Upon reading the following detailed description of the preferred embodiments, various other advantages and benefits will become apparent to those of ordinary skill in the art. The drawings are only for the purpose of illustrating the preferred embodiments and are not to be considered as limiting the present invention. Also, throughout the drawings, the same reference numerals are used to denote the same components. In the drawings:

[0017] Figure 1 It is a Manhattan plot for the genome-wide association analysis of the trait of the natural immunoglobulin G antibody level in the plasma of 50-week-old chickens. Detailed embodiments

[0018] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention. It should be understood that the terms used in the present invention are only for describing specific embodiments and are not used to limit the present invention.

[0019] In addition, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0020] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes the preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0021] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and embodiments of the present invention are only exemplary.

[0022] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0023] Example 1

[0024] Identifying SNP molecular markers related to the traits of the natural immunoglobulin G antibody level in chicken plasma

[0025] 1. Experimental animals

[0026] In this example, a total of 872 mixed populations (including White Leghorn chickens, Beijing Fatty chickens, and reciprocal cross populations of White Leghorn and Beijing Fatty chickens) were used. During the feeding period, free access to food and water was implemented, and the feeding standards followed the relevant regulations of the industry standard (NY / T 33 - 2004).

[0027] 2. Phenotypic determination

[0028] When the chicken flock reached 50 weeks of age, 1 mL of wing vein blood was collected from all experimental chickens using anticoagulant vacuum blood collection tubes, centrifuged at 200 g for 2 minutes using a 4°C low - temperature centrifuge, and the upper - layer plasma was separated and stored at - 80°C for later use; the level of natural immunoglobulin G antibody in the plasma was determined by the ELISA method reported in the literature (Poultry Science, 2011, 90:2263 - 2274).

[0029] 3. Extraction of genomic DNA

[0030] 0.5 mL of wing vein blood was collected from all experimental chickens using anticoagulant vacuum blood collection tubes, and genomic DNA was extracted using the phenol - chloroform extraction method. DNA samples with qualified concentration and purity were detected, and then agarose gel electrophoresis was performed to further detect the purity and integrity of the DNA samples; the sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was 1.8 - 2.0, and the integrity was good; the DNA samples were stored at - 20°C for later use.

[0031] 4. Whole - genome re - sequencing

[0032] For the DNA samples of all experimental chickens, using the DNBSEQ sequencing platform, individual whole - genome re - sequencing was performed according to the standard operation procedure, and the sequencing depth was approximately 15×; the BWA and GATK software were used for sequence alignment and genotype extraction; after further quality control using SNPcall rate and MAF, 11,892,646 SNPs and 872 individuals were obtained for subsequent analysis.

[0033] 5. Genome - wide association study

[0034] After organizing the pedigree data, phenotypic data, and genomic SNP locus data, genome - wide association analysis was performed using the GCTA software. The univariate mixed - linear model was:

[0035] y = Xb + jα+u + e

[0036] y - phenotypic value;

[0037] b - fixed effects (including population effects and cage effects);

[0038] X - corresponding relationship matrix;

[0039] j - Additive genotype of the SNP locus to be detected;

[0040] α - Additive SNP effect;

[0041] u - Random animal effect, following where G is the genomic relationship matrix, is the additive genetic variance;

[0042] e - following the residual effect of, where I is the identity matrix, is the residual variance. Define P < 1E - 6 as the significance threshold;

[0043] The results of GWAS analysis are as Figure 1 shown. There is a significant association between the trait of the level of natural immunoglobulin G antibody in chicken plasma at 50 weeks of age and the interval of 1.48 Mb on chromosome 31 (chr31: 137183 - 1613893). Further verification is carried out on all loci in the genomic association region, and the locus chr31: 386365 is locked as the candidate locus;

[0044] The genetic markers affecting the trait of the level of natural immunoglobulin G antibody in chicken plasma at 50 weeks of age are shown in Table 1;

[0045] Table 1 Genetic markers affecting the trait of the level of natural immunoglobulin G antibody in chicken plasma at 50 weeks of age

[0046]

[0047] Example 2

[0048] Correlation between different genotypes at the chr31: 386365 locus and the level of natural immunoglobulin G antibody in chicken plasma

[0049] 1. Experimental animals

[0050] In this example, a total of 872 mixed populations (including White Leghorn chickens, Beijing Fatty chickens, and reciprocal cross populations of White Leghorn and Beijing Fatty chickens) were used. During the feeding period, free access to food and water was implemented, and the feeding standards followed the relevant regulations of the industry standard (NY / T 33 - 2004);

[0051] 2. Phenotypic determination

[0052] When the chickens were raised to 50 weeks of age, 1 mL of wing vein blood was collected from all experimental chickens using an anticoagulant vacuum blood collection tube, centrifuged at 200 g for 2 minutes using a 4 °C low-temperature centrifuge, and the upper plasma was separated and stored at -80 °C for later use; the level of natural immunoglobulin G antibody in the plasma was determined by the ELISA method reported in the literature (Poultry Science, 2011, 90: 2263 - 2274);

[0053] 3. Extraction of genomic DNA

[0054] 0.5 mL of wing vein blood was collected from all experimental chickens using an anticoagulant vacuum blood collection tube, and genomic DNA was extracted using the phenol-chloroform extraction method. DNA samples with qualified concentration and purity were detected, and then agarose gel electrophoresis was performed to further detect the purity and integrity of the DNA samples; the sample concentration was required to be greater than 50 ng / μL, the purity OD260 / 280 was 1.8 - 2.0, and the integrity was good; the DNA samples were stored at -20 °C for later use;

[0055] 4. Genotyping of the chr31:386365 locus

[0056] For the DNA samples of all experimental chickens, using the DNBSEQ sequencing platform, individual whole-genome resequencing was performed according to the standard operating procedure, and the sequencing depth was approximately 15×; sequence alignment and genotype extraction were performed using BWA and GATK software; 11,892,646 SNPs and 872 individuals were obtained for subsequent analysis after further quality control using SNPcall rate and MAF;

[0057] The pedigree data, phenotypic data, and genomic SNP locus data were sorted out, the chr31:386365 locus was locked, and the genotypes of the chr31:386365 locus were classified into three types: GG genotype, GA genotype, and AA genotype;

[0058] 5. Determination of the phenotypic dominant genotype

[0059] The plasma natural immunoglobulin G antibody levels of individuals with different genotypes at the chr31:386365 SNP locus of chickens at 50 weeks of age are shown in Table 2; at the chr31:386365 locus, the plasma natural immunoglobulin G antibody titer of individuals with the GG genotype at 50 weeks of age was 7.99, that of individuals with the GA genotype was 8.58, and that of individuals with the AA genotype reached 9.00;

[0060] The data showed that there was a significant correlation between the AA genotype and high levels of plasma natural immunoglobulin G antibody, while the GG genotype was correlated with low levels of plasma natural immunoglobulin G antibody;

[0061] Table 2 Plasma natural immunoglobulin G antibody levels of individuals with different genotypes at the 50th week of age at the chr31:386365 SNP locus in chickens

[0062]

[0063] Note: Different lowercase letters in the superscripts between groups indicate significant differences (P<0.05).

[0064] Example 3

[0065] Establishment of a molecular marker detection method for the chr31:386365 SNP locus and its application in breeding

[0066] 1. Construction of the molecular marker detection method

[0067] Based on the DNA sequence information adjacent to the chr31:386365 SNP locus published in the Ensembl database, specific primers were designed and synthesized in this example for PCR amplification;

[0068] The nucleotide sequence of SEQ ID NO: 1 corresponds to the region of the 386,365th nucleotide from the 5'-end on chromosome 31 and 250 bases upstream and downstream thereof;

[0069] SEQ ID NO: 1:

[0070] TACAGTCTTCCTAACTTTTCATGGGCTTTTAATTTTGTTTCTTTGCAGAAAATGAGGATGCAGAGAA

[0071] AAGAATTGGTAAGGATAATTTTAACTTAGAAAAGTCCTTAAAAAACATTTAAGTTTTGTTTGATCAG

[0072] AAATACTATTTTAGAATGGACTAGTGAAACATTTTGAGATCTTTAAAGGACTGGAGGACCGTCACAGCACTCACCTCTCTTTCACACTTTGAGGCTTAGTTGTCCCTGAAAAAAAGG / ATTGTATCTGCCACAA TCTTTGTCTCTGGAATGTCTATTTCCATAGTAAGGGAGTATCATTTAAGTAGTCCGGCAGAGGTTCTTTTTTTTTTTTTTTTTTCTGTAAGTGAGAAAAAATGTCTCTTTCTACTAACTAACTTACATATCTAAAGAGGGGAATAATACCTATAGAGAGAGGGAGACACATTCATATGCACTTTGACTCTTGGCAACGTAAAGGTTCTGCTTGTTGTGGTGTGAAGCATATCCAC

[0073] The primer sequences for PCR amplification are shown in Table 3;

[0074] Table 3 Primer sequences for PCR amplification

[0075]

[0076] The PCR amplification system is shown in Table 4;

[0077] Table 4 PCR amplification system

[0078]

[0079] The PCR amplification conditions are shown in Table 5;

[0080] Table 5 PCR amplification conditions

[0081]

[0082] The amplified products were analyzed by first-generation sequencing technology to determine the genotypes at the chr31:386365 locus; the genotype results cover three types: GG, GA, and AA;

[0083] 2. Selection of chicken plasma natural immunoglobulin G antibody levels using the molecular marker at the chr31:386365 locus

[0084] To select individuals with a relatively high level of chicken plasma natural immunoglobulin G antibody, 220 Beijing Fatty Chicken individuals were selected as the research subjects in this example; at 5 weeks of age, blood samples were collected from each research subject one by one, and then genomic DNA was extracted with reference to step 3 of Example 1; specific primers were used to amplify the target site sequence, and genotype typing was carried out with the help of first-generation sequencing technology;

[0085] The genotyping results showed that the number of GG genotype individuals was 15, the number of GA genotype individuals was 80, and the number of AA genotype individuals was 125;

[0086] In view of the genotype with a relatively high level of chicken plasma natural immunoglobulin G antibody, AA genotype individuals were preferentially selected; then, these chickens were raised to 50 weeks of age and their plasma natural immunoglobulin G antibody levels were measured; the correlation between different genotype individuals at the chicken chr31:386365 locus and the plasma natural immunoglobulin G antibody level at 50 weeks of age in Beijing Fatty Chicken is shown in Table 6; the average plasma natural immunoglobulin G antibody titer of GG genotype individuals at 50 weeks of age was 7.89; that of GA genotype individuals was 8.25; and that of AA genotype individuals reached 8.96.

[0087] Table 6 Correlation between different genotype individuals at the chicken chr31:386365 locus and the plasma natural immunoglobulin G antibody level at 50 weeks of age in Beijing Fatty Chicken

[0088]

[0089] Note: Different letters in the superscripts between groups indicate significant differences (P<0.05).

[0090] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the above embodiments, those of ordinary skill in the art should understand that: the specific implementation manners of the present invention can still be modified or equivalently replaced, and any modification or equivalent replacement that does not depart from the spirit and scope of the present invention shall be covered by the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker related to the natural immune globulin G antibody level in chicken plasma, characterized in that, The SNP molecular marker is the 251st nucleotide in SEQ ID NO: 1, and the polymorphic form is G or A.

2. A SNP molecular marker related to the natural immune globulin G antibody level in chicken plasma according to claim 1, characterized in that When the SNP molecular marker is of the AA genotype, the level of natural immunoglobulin G antibody in chicken plasma is high; when the SNP molecular marker is of the GG genotype, the level of natural immunoglobulin G antibody in chicken plasma is low.

3. A primer pair for detecting SNP molecular markers related to the natural immunoglobulin G antibody level in chicken plasma as described in any one of claims 1 to 2, characterized in that, In the primer pair, the nucleotide sequence of the upstream primer is ACCGTCACAGCACTCACCTCT, and the nucleotide sequence of the downstream primer is CACACCACAACAAGCAGAACCT.

4. Use of an SNP molecular marker related to the natural immunoglobulin G antibody level in chicken plasma as described in any one of claims 1 to 2 in identifying or assisting in identifying the natural immunoglobulin G antibody level in chicken plasma, characterized in that, The specific application is as follows: Detect the genotype of the SNP in the chicken to be tested. The individual chicken to be tested with the AA genotype is an individual with a high level of natural immunoglobulin G antibody in plasma, and the individual chicken to be tested with the GG genotype is an individual with a low level of natural immunoglobulin G antibody in plasma.

5. Use of an SNP molecular marker related to the natural immune globulin G antibody level in chicken plasma as described in any one of claims 1 to 2 in chicken breeding, characterized in that, The specific application is as follows: Detect the genotype of the SNP in the chicken to be tested, and select the parent with the AA genotype for breeding of the strain with a high level of natural immunoglobulin G antibody in plasma.

Images