Molecular marker related to abdominal fat weight character of chicken and application of molecular marker
GWAS is used to identify SNP molecular markers related to chicken abdominal fat weight, and use PCR amplification technology to screen low abdominal fat heavy broilers, which solves the problem of early selection in broiler breeding and improves breeding efficiency and meat quality.
Patent Information
- Application Number
- CN202510441792.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-09
- Publication Date
- 2025-07-08
AI Technical Summary
The prior art is difficult to achieve early and precise selection of abdominal fat heavy traits in broiler breeding, resulting in long breeding cycles, high cost and deterioration of meat quality.
Genome-wide association analysis (GWAS) identified SNP molecular markers related to chicken abdominal fat weight, and PCR amplification was performed using specific primers to detect the genotype of the chicken to be tested, and individuals with low abdominal fat weight were screened out.
实现了肉鸡腹脂重性状的早期选择,降低生产成本,提高育种效率和肉质,缩短育种周期30%-50%。
Smart Images
Figure CN120272608A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of gene detection, and particularly relates to a molecular marker related to the abdominal fat weight trait of chickens and its application. Background Art
[0002] The core objectives of broiler breeding are to shorten the slaughter cycle, increase daily weight gain and feed conversion rate. However, the excessive pursuit of growth rate has also led to the deterioration of chicken meat quality, abnormal fat metabolism, significant growth of broiler fat, and most of it accumulates to form abdominal fat. As an important economic trait in broiler production, the deposition level of abdominal fat directly affects carcass utilization rate and production efficiency. An excessive abdominal fat rate also increases the burden of feed conversion, while moderately regulating abdominal fat deposition helps to maintain the body's metabolic balance and indirectly affects meat quality. Traditional breeding methods rely on phenotypic determination of abdominal fat weight after slaughter, which has significant bottlenecks such as a long generation interval and the inability to achieve early live selection.
[0003] Molecular marker-assisted selection (MAS) is a modern breeding technology based on the tight linkage between molecular markers and target trait genes. By detecting molecular markers co-segregating with the target gene, rapid and accurate selection of the target trait can be achieved. This technology breaks through the limitations of traditional breeding relying on phenotypic screening and has multiple advantages: firstly, it can directly screen genotypes at the DNA level, avoiding the interference of environmental factors, and is particularly suitable for the breeding of complex traits such as disease resistance and stress resistance; secondly, early selection can be achieved using co-dominant molecular markers (such as SSR, SNP), shortening the breeding cycle; thirdly, multiple trait-related markers can be screened simultaneously, significantly improving the selection efficiency. Molecular marker-assisted selection has covered the entire industrial chain of laying hens, broilers, and native chickens. However, the development of molecular markers for the economic trait of chicken abdominal fat weight still faces challenges. Currently, its specific regulatory network has not been systematically analyzed, especially the lack of functional SNP loci with a strong causal association with abdominal fat deposition. This is mainly because abdominal fat deposition is regulated by multiple genes and the complexity of the phenotype-genotype association is high, and the insufficient coverage of existing markers restricts the application of MAS technology. In the future, it is necessary to combine means such as genome-wide association study (GWAS) and transcriptomics to accelerate the discovery of key SNPs regulating abdominal fat deposition and provide precise molecular tools for broiler breeding.
[0004] Genome-wide association study (GWAS) has significant advantages in identifying abdominal fat-related molecular markers by detecting the polymorphisms (SNPs) of genetic variations (markers) across the whole genome of multiple individuals to obtain genotypes and then performing population-level statistical analysis of genotypes and phenotypes. Its core lies in more precisely identifying genes and variations of important traits and systematically analyzing the genetic basis of complex traits through high-throughput genotyping technologies and statistical methods. Through the polymorphism detection of millions of SNP loci across the whole genome, GWAS can comprehensively cover genetic variations in coding regions, regulatory regions, and non-coding regions, and is particularly good at mining the synergistic effects of minor polygenes, which is especially important for abdominal fat deposition traits regulated by multiple genes. In addition, GWAS supports joint analysis of multiple traits and can simultaneously screen loci related to traits such as growth rate and meat quality that have genetic antagonism or synergistic effects with abdominal fat deposition, providing a strategy for aggregating pleiotropic loci for marker-assisted selection (MAS). By developing high-density SNP chips or targeted PCR detection systems, the significantly associated loci identified by GWAS can be directly converted into operable molecular markers to achieve early genotype screening, shortening the traditional breeding cycle by 30%-50% and laying a genetic foundation for breeding broilers with low abdominal fat and high production efficiency. Summary of the Invention
[0005] In order to accurately determine the genotype of the chicken to be tested for the convenience of early selection of abdominal fat weight traits, save production costs and accelerate genetic progress, the present invention provides a molecular marker related to the abdominal fat weight trait of chickens and its application, providing a basis for molecular marker breeding and selection work.
[0006] An SNP molecular marker related to the abdominal fat weight trait of chickens, wherein the SNP (single nucleotide polymorphism) molecular marker is located at position 73,936,270 on chromosome 1.
[0007] In the present invention, the genotype of the polymorphic locus contained in the molecular marker chr1:73936270 is AA, corresponding to a low abdominal fat weight level; the genotype of the polymorphic locus contained is GA, corresponding to a high abdominal fat weight level.
[0008] Application of a detection reagent for the above-mentioned molecular marker related to the abdominal fat weight of chickens in detecting the abdominal fat trait of chickens.
[0009] The present invention also provides a primer for amplifying the chr1:73936270 molecular marker. The specific sequences are as follows:
[0010] Forward primer F: AACACAAATAACTCAACAAC;
[0011] Reverse primer R: TCCATCAGTAAGCCAAATGTC.
[0012] The present invention also provides an application of the above primers in detecting the abdominal fat weight of chickens or in preparing a kit for detecting the abdominal fat of chickens.
[0013] The present invention also provides a method for detecting the abdominal fat weight of chickens, which comprises detecting the genotype of the molecular marker as described above in a test sample chicken.
[0014] A molecular marker related to the abdominal fat weight trait of chickens and its application, for early selection of the abdominal fat weight trait of chickens according to the genotype of the above SNP locus, comprising the following steps:
[0015] (1) Extract the genomic DNA of the test chicken.
[0016] (2) Use the above primers for PCR amplification to detect the genotype of the SNP locus at position 13,936,270 on chromosome 1 of the test chicken.
[0017] (3) After sequencing the amplification product, obtain the genotype of the molecular marker.
[0018] (4) According to the genotyping result, judge the abdominal fat weight trait of the test sample chicken.
[0019] The method for extracting the genomic DNA of the test chicken in step (1) is as follows: Collect blood from the wing vein of the test chicken, anticoagulate it with an anticoagulant, then perform lysis and protease digestion treatment, and then extract the genomic DNA by the phenol-chloroform method and dissolve it with ddH2O.
[0020] The reaction conditions of the PCR method in step (2) are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 34 s, extension at 72°C for 40 s, for 30 cycles; extension at 72°C for 10 min.
[0021] The amplification system for the PCR amplification in step (2) includes: 1 μL of DNA, 10 μL of 2x TaqMasterMix, 1 μL of each of the upstream and downstream primers, and 7 μL of ddH2O.
[0022] The present invention also provides a molecular marker related to the abdominal fat weight trait of chickens and its application, and it can be applied in the breeding of broilers with low abdominal fat weight. Detect and judge the genotype based on the above method; when the genotype is AA, it indicates that the test chicken has a low abdominal fat weight.
[0023] The present invention discloses the following beneficial effects:
[0024] Reducing abdominal fat deposition in chickens through breeding can significantly reduce production costs and improve production and slaughter efficiency. At the same time, breeding chicken breeds with low abdominal fat weight can increase intramuscular fat and muscle synthesis. This not only improves feed conversion rate, but also enhances the nutritional value and meat quality of the carcass, enabling more efficient conversion of breeding resources into high-quality products. To achieve this goal, the present invention provides a molecular marker related to chicken abdominal fat weight, which is located at position 73936270 on chromosome 1 of Qibainong chickens. Through research, it is found that the allele AA at this locus is beneficial to reducing chicken abdominal fat weight. Compared with the method of enzyme digestion used in the market for identifying molecular markers related to abdominal fat weight, the method provided by us is more simple, accurate, and has low detection cost and conditions. There are no false positive results, and it can perform early selection on the abdominal fat weight of broilers, eliminate genotypes that do not meet the standards, save breeding costs, increase the retention rate of superior genotypes, improve economic benefits, and accelerate genetic progress. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 Fig. is the Manhattan plot of genome-wide association study (GWAS) for abdominal fat weight on chromosome 1 of Qibainong chickens; the abscissa represents the chromosome number of the chicken; the ordinate represents the -logP value of the SNP locus.
[0026] Figure 2 Fig. is the QQ plot of genome-wide association study (GWAS) for abdominal fat weight on chromosome 1 of Qibainong chickens.
[0027] Figure 3 Fig. is the linkage disequilibrium (LD) heat map of significant SNPs output by genome-wide association study (GWAS) for abdominal fat weight in Qibainong chickens.
[0028] Figure 4 Fig. shows the phenotypes of abdominal fat weight with different genotypes at chr1:73936270 DETAILED DESCRIPTION OF THE EMBODIMENTS
[0029] The present invention will be further elaborated in detail below with reference to the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified.
[0030] Example 1. Determination of SNP markers related to chicken abdominal fat weight
[0031] (1) Animal materials
[0032] This invention uses 313 individuals of the local chicken breed Qibainong chicken from Dahua Yao Autonomous County. The Qibainong chicken has tender meat, a delicate taste, is firm and elastic. During the breeding process, free access to food and water was adopted, and the diet was formulated with reference to the feeding standard for yellow - feather broilers (NY / T33 - 2004).
[0033] (2) DNA extraction and phenotype determination
[0034] Collect 0.5 mL of wing vein blood from all experimental chickens using blood collection tubes, and extract genomic DNA using the standard phenol - chloroform method. Accurately measure the concentration and purity of the DNA sample (OD values: OD260 / 280, OD260 / 230) using a NanoPhotometer nucleic acid and protein detector; for DNA samples that pass the detection, perform electrophoresis using 2% agarose gel to detect the purity and integrity of the DNA sample. All chickens to be tested were slaughtered at 180 days of age to collect abdominal fat tissue samples from 313 individuals and weigh them.
[0035] Table 1 Descriptive statistics of phenotypic data
[0036] Phenotype Number of individuals Mean Standard deviation Coefficient of variation AFW 313 32.46 18.98 58.48％
[0037] (3) Genome - wide SNP association analysis of abdominal fat weight
[0038] The DNA samples of all chickens to be tested were sent to Beijing Genomics Institute for whole - genome re - sequencing detection, and a total of 24,855,857 SNP loci were obtained. In the GWAS model, batch effects and population structure were corrected and fixed. In this study, the GEMMA software was used to perform GWAS analysis of abdominal fat traits using the 313 individuals after quality control and 12,583,842 SNPs. After Bonferroni multiple - test correction, the genome - wide significance threshold was - log10(0.05 / 12,583,842) = 8.426, and the suggestive threshold was - log10(1 / 12,583,842) = 7.125.
[0039] The results of the genome - wide association analysis were plotted as a Manhattan plot (see Figure 1 ), and a QQ plot (see Figure 2 )
[0040] As shown in the figure, there is a significant association between abdominal fat weight and the region on chromosome 1 (chr1:73936269 - 73936270). Further verification was performed on all loci in the genome - associated region. Five loci in this region (chr1:73936269, chr1:73936270, chr1:73936380, chr1:73936382, chr1:73936383), such as Figure 3As shown, after Haploview analysis, these five loci are completely linked. Among them, the locus chr1:73936270 reaches the genome-wide significant level (p < 8.19×10 -42 ), indicating that the effect of this SNP on the phenotype may truly exist. Finally, the locus 1:73936270 was locked as a candidate locus. VEP annotation shows that this locus is located in the intron region of the KCNA1 (voltage-gated potassium channel gene), and may affect the lipid metabolism pathway by regulating gene expression levels. It was verified that chr1:73936270 has the potential to be used as a molecular marker for genetic improvement of lipid metabolism traits in Qibainong chickens.
[0041] Example 2. Correlation between the genotype of chr1:73936270 and the abdominal fat weight trait of chickens
[0042] Using the same animal population as in the GWAS analysis in Example 1, the AApubr package of R 4.0.4 software was used to calculate the phenotype.
[0043] As shown in Table 1, in the Qibainong chicken population, the abdominal fat weight of individuals with the AA genotype at the chr1:73936270 locus is significantly lower than that of the GA genotype, indicating that the AA genotype is beneficial for screening individuals with low abdominal fat deposition.
[0044] Table 2 Genotype analysis of chr1:73936270
[0045]
[0046] Example 3. Effects of the mutation at the locus chr1:73936270 on the abdominal fat weight phenotype and contribution rate of Qibainong chickens
[0047] (1) Contribution of chr1:73936270 to the variation of the genome-wide abdominal fat weight phenotype
[0048] The analysis process is as follows:
[0049] Based on the abdominal fat weight phenotypes and individual genotypes of all individuals used, the GEMMA software was used to construct the G matrix;
[0050] Calculate PVE (equivalent to broad-sense heritability, according to the formula, i.e., genetic variance / phenotypic variance = Vg / Vp);
[0051] Perform Linear Mixed Model (LMM) analysis;
[0052] The output results of GEMMA were used to calculate PVE (equivalent to broad-sense heritability, i.e., genetic variance / phenotypic variance = Vg / Vp) with R4.0.4, and the algorithm is as follows:
[0053]
[0054] The proportion of the phenotypic variance explained (PVE) by locus in the whole genome is the contribution rate of the locus. The specific results are shown in Table 2.
[0055] Table 3 Analysis of the contribution rate of chr1:73936270 to the variation of abdominal fat weight trait in the whole genome of Qibainong chickens
[0056]
[0057] 1 V(g): Genotypic variance; 2 V(p): Phenotypic variance; 3 PVE: Proportion of variance explained (percentage at the whole genome level).
[0058] (2) Verification of Qibainong chicken-specific loci
[0059] Take Qibainong chickens (n = 313), Beijing You chickens (n = 438), Wenchang chickens (n = 459), and Jingxing yellow chickens (n = 520), a total of 1730 chicken individuals in the population, and measure the abdominal fat weight after slaughter. At the same time, collect venous blood and extract genomic DNA. Resequencing obtains a VCF file, which is converted into PLINK format (bed, bim, fam) through PLINK software. The locus chr1:73936270 in the Qibainong chicken genome was not found in the gene files of other chicken breeds. Therefore, it is considered that the locus chr1:73936270 is a breed-specific marker for Qibainong chickens, and the phenomenon of its deletion in other breeds confirms the reshaping effect of geographical isolation and artificial selection on the genome structure. Through large-scale cross-breed sample verification (n = 1,730), the statistical power and repeatability of the conclusion are ensured.
[0060] Example 4. Establishment of a molecular marker detection method for locus chr1:73936270 and its application in breeding
[0061] (1) Establishment of a molecular marker method
[0062] Primer design
[0063] According to the DNA sequence of chicken chromosome 1 provided by the Ensemble website (version 7.0), a pair of specific primers containing the amplification of chr1:73936270 was designed using the NCBI primer design software, and the primers were synthesized by Beijing Genomics Institute. The DNA sequences of the primers are as follows:
[0064] Forward primer F: AACACAAATAACTCAACAAC (SEQ ID NO.1)
[0065] Reverse primer R: TCCATCAGTAAGCCAAATGTC (SEQ ID NO.2)
[0066] Optimization of PCR Reaction Program
[0067] The reaction program is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 60°C for 34 s, extension at 72°C for 40 s, for 30 cycles; extension at 72°C for 10 min. The PCR reaction system is 20 μl in total: 1 μl of blood DNA, 10 μl of 2×TaqMasterMix, 1 μl of each upstream and downstream primer, and 7 μl of ddH2O. DNA sequence identification is performed by direct sequencing method by Beijing Genomics Institute. Forward sequencing is carried out for each PCR amplified fragment. The sequence of the PCR product obtained is aligned with the NCBI genomic sequence to confirm the authenticity of the amplified sequence; meanwhile, the mutation at the corresponding SNP locus is confirmed. The sequencing results of the PCR amplification products show different alleles at the locus chr1:73936270 as Figure 3 shown.
[0068] (2) Breeding method for improving abdominal fat weight of chickens by using the SNP molecular marker of the present invention for marker-assisted selection
[0069] Select Qibainong chickens as the breeding object, and randomly select 1000 individuals as the test population, with a male-female ratio of 1:1. Denote it as the F0 generation.
[0070] Blood samples are collected from the wing veins of all individuals at about 30 days of age, added with ACD anticoagulant, and stored at -20°C for later use. Genomic DNA is extracted by the conventional phenol-chloroform method, dissolved in ddH2O, and the purity and concentration of DNA are detected by both agarose gel electrophoresis and ultraviolet spectrophotometry, and then diluted to a concentration of 50 ng / μl.
[0071] Perform PCR amplification reaction using the specific primers of the above 1 SNP; perform genotyping of the genotype at the locus chr1:73936270 by direct sequencing method; select healthy male and female chickens with the AA genotype at the locus chr1:73936270 according to the genotyping results. The number of selected roosters is not less than 60, and the male-female ratio is not less than 1:3 for breeding. Record the number of each chicken to establish a pedigree, and form a pure line of AA genotype individuals according to the method of half-sib roosters and full-sib hens at the peak laying period, denoted as the F1 generation. For the pure line of AA genotype individuals, at least 1 female offspring individual is randomly selected from each family, and a total of 50 pure line chickens are slaughtered, denoted as the F2 generation. All selected individuals are slaughtered at 180 days of age, abdominal fat is collected, abdominal fat weight is measured, and the abdominal fat weight of the AA genotype at the locus chr1:73936270 after breeding is statistically analyzed. Experiments have confirmed that using this molecular marker for marker-assisted selection can save production costs and accelerate genetic progress.
[0072] The present invention provides a new molecular marker for molecular marker-assisted selection and genome-wide selection of chicken abdominal fat synthesis through methods such as GWAS analysis of chicken chr1:73936270, detection of mutation sites, and application in high-quality chicken breeding.
[0073] The embodiments described above only describe the technical solutions of the present invention and do not limit the protection scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. Use of an SNP molecular marker in the preparation of a detection reagent related to chicken abdominal fat weight, characterized in that, The SNP molecular marker sequence is CGCGCTCCGCAGCAACGTCTGTCAAAAAACACGTAATGCGA, which is located at the 73,936,270 locus on chromosome 1 of the Gallus_gallus-7.0 version of the chicken international reference genome. The base at this locus exhibits G / A polymorphism, and the genotypes are GA and AA. Among them, individuals carrying the AA genotype have a significantly lower abdominal fat weight level than those with the GA genotype. The chicken is the Qibainong chicken.
2. A specific primer set for detecting the SNP molecular marker described in claim 1, comprising: Forward primer F: AACACAAATAACTCAACAAC; Reverse primer R: TCCATCAGTAAGCCAAATGTC.
3. The application of the primer described in claim 2 in detecting the abdominal fat weight trait of chickens or preparing a kit for detecting the abdominal fat trait of chickens, characterized by including the primer in claim 2.
4. A method for detecting the abdominal fat weight trait of chickens, characterized in that Including: (1) Extract the genomic DNA of the individual to be tested; (2) Perform PCR amplification using the primer set described in claim 2; (3) Sequence and analyze the amplification product; (4) Identify the genotype at the chr1:73936270 locus. (5) Based on the genotype of the SNP locus, conduct early selection for the abdominal fat weight trait of chickens. The abdominal fat weight of AA genotype chickens is lower than that of GA genotype chickens, and it is a favorable genotype.
5. The method according to claim 3, characterized in that In step (1), the extraction of genomic DNA includes: collecting anticoagulated blood samples through the wing vein of the chicken, purifying them by the phenol-chloroform method after lysis and protease digestion, and finally dissolving the DNA in double-distilled water.
6. Use of the SNP molecular marker according to claim 1 in chicken breeding screening, characterized in that Select individuals with low abdominal fat weight by identifying the genotype of the locus.
7. A chicken genetic breeding method based on the SNP molecular marker described in claim 1, specifically including: (1) Detect the genotype distribution of the chr1:73936270 locus in the population; (2) Screen individuals carrying the AA genotype as breeding materials for the low abdominal fat weight trait; (3) Establish a breeding population with an excellent abdominal fat weight phenotype.
8. A chicken molecular marker-assisted selection system that integrates a detection module containing the SNP locus described in claim 1 and the primer set described in claim 2, and is used to achieve precise breeding for the low abdominal fat weight trait of chickens.