SNP (Single Nucleotide Polymorphism) molecular marker closely linked with main effect QTL (Quantitative Trait Loci) of malic
By developing SNP molecular markers closely linked to the major QTL of malic acid in winter melon pulp and using KASP technology for SNP genotyping, the problem of early identification of malic acid content in winter melon pulp was solved, enabling rapid and accurate trait identification and supporting marker-assisted selection breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-01-30
- Publication Date
- 2026-03-17
AI Technical Summary
Existing technologies make it difficult to efficiently and accurately identify the malic acid content in the pulp of winter melon in the early stages of breeding, resulting in a slow breeding process and high costs.
We developed SNP molecular markers closely linked to the major QTL for malic acid in winter melon pulp, used KASP technology for SNP genotyping, and designed specific KASP primer pairs to achieve rapid and accurate identification of malic acid traits in the pulp.
It enables early, non-destructive, low-cost, and high-throughput identification of malic acidity in winter melon flesh, supports molecular marker-assisted selection breeding, and significantly accelerates the process of improving the flavor and taste quality of winter melon.
Smart Images

Figure CN121674618A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of plant molecular genetic breeding technology, and particularly relates to a SNP molecular marker closely linked to a main-effect QTL of winter melon pulp malic acid and application thereof. BACKGROUND
[0002] Winter melon (Benincasa hispida) is an important Cucurbitaceae vegetable crop in China, which has multiple utilization values such as fresh food, processing and medicinal and edible. The fruit has high water content, low energy and light taste, and has a unique advantage in summer fresh food and cool processing products. However, compared with horticultural crops such as tomato and citrus, the overall flavor intensity of winter melon is weak, and the sensory differences between different varieties and uses are often subtle, which to some extent restricts the screening of high-quality varieties and the directional breeding of processing special varieties. Therefore, it is of great significance to analyze the key metabolic factors affecting the formation of winter melon flavor to improve the quality of fresh products and the added value of processing industry.
[0003] Organic acids are one of the core components that determine the flavor structure and sweet-sour balance of fruits and vegetables. In winter melon fruit, malic acid is usually the highest in content and the most contributed, and is an important material basis for acid perception and overall flavor coordination. Moderate malic acid content can form a good sweet-sour balance with low-level soluble sugar, giving winter melon the sensory characteristics of “refreshing, sweet and not greasy”. Low malic acid content is easy to lead to weak flavor and watery taste, and high malic acid content may produce astringency or irritation, reducing the acceptance of fresh food. Therefore, malic acid level is considered as one of the important chemical indicators for distinguishing the flavor of fresh-type winter melon. In terms of processing utilization, malic acid also plays an irreplaceable role. Winter melon is widely used in winter melon tea, syrup, candied fruit and functional beverage processing products, and its flavor stability and acidity structure directly affect product quality and market acceptance. Compared with exogenous acid flavoring agents such as citric acid, malic acid has a soft acid taste and good heat resistance, and is not easy to produce sharp and irritating side tastes in the process of heat processing and concentration, and can also improve the microbial safety and flavor level of the product by adjusting the pH of the system. Therefore, winter melon varieties with high and stable natural malic acid content in fruit are more suitable for the needs of deep processing industry. Therefore, genetic improvement research around winter melon pulp malic acid content is an important basis for improving the utilization value of winter melon for fresh food and processing.
[0004] Currently, in winter melon breeding practices, the evaluation of malic acid content in the pulp mainly relies on physicochemical detection methods, which suffer from problems such as long detection cycles, high costs, and difficulty in conducting large-scale screening in the early stages of breeding. With the development of molecular marker-assisted breeding technology, molecular markers based on single nucleotide polymorphisms (SNPs) have been applied to the improvement of various crop quality traits due to their high genetic stability and high detection throughput. Genome-wide association study (GWAS), as a genetic analysis method based on natural populations, can identify genetic loci significantly associated with target traits across the entire genome, providing important evidence for the development of molecular markers.
[0005] However, to date, there are few reports on the genetic regulatory loci, related candidate genes, and their SNP molecular markers related to malic acid content in winter melon pulp. Systematic mining results based on GWAS are also lacking, and existing technologies are insufficient to provide effective support for marker-assisted selection and targeted breeding of malic acid content in winter melon. Therefore, it is necessary to further explore the mining of malic acid-related genetic loci and conduct molecular marker research in winter melon pulp to meet the practical needs of winter melon quality improvement and industrial development. Summary of the Invention
[0006] The purpose of this invention is to provide SNP molecular markers tightly linked to the major QTL for malic acid in winter melon pulp and their applications, overcoming the lack of efficient and accurate molecular tools for identifying malic acid traits in winter melon pulp in existing technologies. The SNP molecular markers provided by this invention have a significant and tight linkage relationship with malic acid traits in winter melon pulp. Based on KASP technology, SNP genotyping can achieve rapid, accurate, and high-throughput identification of malic acid traits in winter melon pulp, and can be used for marker-assisted selection breeding of winter melon, thereby accelerating the process of breeding for improved flavor and taste quality of winter melon.
[0007] To achieve the above objectives, the present invention provides the following solution:
[0008] This invention provides an SNP molecular marker that is closely linked to the major QTL of malic acid in winter melon pulp. The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.4, and there is a G / A mutation at the 26th base of the sequence.
[0009] The present invention provides a KASP primer pair for amplifying the above-mentioned SNP molecular markers, wherein the KASP primer pair comprises F1 with a nucleotide sequence as shown in SEQ ID NO.1, F2 with a nucleotide sequence as shown in SEQ ID NO.2, and R with a nucleotide sequence as shown in SEQ ID NO.3.
[0010] This invention provides the application of the above-mentioned KASP primer pair in the preparation of products for identifying the malic acid content of winter melon pulp.
[0011] Optionally, the product includes reagents, reagent kits, and chips.
[0012] This invention provides a product for identifying the malic acid content of winter melon pulp, the product comprising the aforementioned KASP primer pair.
[0013] Optionally, the product includes reagents, reagent kits, and chips.
[0014] This invention provides the application of the above-mentioned KASP primer pair or the above-mentioned product in identifying the malic acid content of winter melon pulp.
[0015] This invention provides a method for identifying the malic acid content in winter melon pulp, the method comprising the following steps:
[0016] Using the genomic DNA of the winter melon to be tested as a template, KASP PCR amplification was performed on the template using the above-mentioned KASP primer pair, and genotyping was performed using the amplification results.
[0017] Optionally, if the genotyping result is GG, the winter melon to be tested is a winter melon variety with low malic acid content; if the genotyping result is AA, the winter melon to be tested is a winter melon with high malic acid content; if the genotyping result is GA, the winter melon to be tested is a winter melon with medium malic acid content.
[0018] Optionally, the sample of the winter melon to be tested may include tissues or organs obtained at any stage of the growth of the winter melon.
[0019] This invention provides the application of the above-described KASP primer pairs or the above-described products in any of the following:
[0020] (1) Screening winter melon varieties or strains with low, medium or high malic acid content;
[0021] (2) Regulating the malic acidity of winter melon pulp;
[0022] (3) Improve winter melon germplasm resources;
[0023] (4) Molecular breeding of winter melon.
[0024] Alternatively, the application may also include screening different types of winter melon varieties or strains based on the specific requirements of malic acid for fresh consumption and processing of winter melon.
[0025] The present invention discloses the following technical effects:
[0026] This invention uses 303 collected winter melon germplasm resources to form a natural population material, employs whole-genome resequencing technology to obtain its genotype data, and performs malic acid content phenotypic determination on the corresponding natural population; by combining genotype data and phenotypic data, a genome-wide association analysis is conducted, within a set -log 10 At a significance threshold of P ≥ 5, a specific segment on chromosome 3 of the winter melon was identified as significantly associated with the malic acid trait. Among these, the MA_SNP1 locus on chromosome 3 showed the most significant association with malic acid content, with a -log 10 The p-value was 6.57. This SNP molecular marker is located at 45,713,266 bp on chromosome 3 of *Melon spp.*, with an allelic variation of G / A. Materials carrying the G allele exhibit low malic acid content, while materials carrying the A allele exhibit high malic acid content. Therefore, this invention developed an SNP molecular marker based on this SNP site, the nucleotide sequence of which is shown in SEQ ID NO.4, containing a G / A mutation at base position 26.
[0027] In existing technologies, the identification of malic acid phenotype in winter melon pulp typically requires destructive sampling and biochemical detection methods such as HPLC-PDA during the commercial ripening stage of the fruit. This method is costly, complex, and highly dependent on instrument platforms, making it difficult to apply in laboratories lacking chromatographic analysis capabilities. In contrast, the molecular markers provided by this invention can complete phenotype identification at the seed stage or early seedling stage when true leaves have emerged, enabling early and non-destructive prediction of traits. Furthermore, for commercially viable fruits, the malic acid phenotype can be determined without cutting and sampling. This invention, based on KASP technology, developed KASP primer pairs targeting this SNP molecular marker. SNP genotyping and detection are achieved through specific matching of primer terminal bases. Results from specific embodiments of this invention show that the KASP molecular marker provided by this invention can be used to identify the malic acid content in the pulp of winter melon seeds or early seedlings with true leaves. This method has the advantages of high accuracy, simple operation, low cost, and short detection cycle, making it suitable for marker-assisted selection breeding of winter melon, thereby significantly accelerating the process of improving the flavor and taste quality of winter melon. Attached Figure Description
[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0029] Figure 1 Images showing the appearance of some fruits from a GWAS winter melon population;
[0030] Figure 2 This is a genome-wide association diagram (GWAD) of the malic acid trait in winter melon; where A is the Manhattan plot of malic acid, and B is the genome-wide P-value (based on the F-test) ordered by chromosomal physical location. The x-axis represents the genome coordinates, and the y-axis represents -log 10 P, the smaller the P value, the stronger the correlation, which is represented by a larger vertical axis; B is the Quantile-Quantile plot of the correlation analysis of malic acid;
[0031] Figure 3 The graph shows the statistical distribution of malate at the MA_SNP1 locus in 193 natural populations with malate differences (A) and the KASP marker genotyping graph (B). Detailed Implementation
[0032] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.
[0033] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0034] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.
[0035] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.
[0036] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.
[0037] Example 1: Obtaining SNP molecular markers tightly linked to the major QTL of malic acid in winter melon pulp
[0038] 1. GWAS Germplasm Resource Information
[0039] 1.1 Materials and Reagents
[0040] The 303 natural populations of winter melon used in this invention are resources collected and purified over many years by the winter melon team of the Guangdong Academy of Agricultural Sciences. These include high-generation self-pollinated materials and phenotypic homozygous local varieties, originating from three countries: China, Thailand, and India. Domestic resource collection sites mainly include Guangdong, Guangxi, Yunnan, Hunan, Jilin, Shandong, Hebei, Jiangsu, Anhui, and Gansu, with Guangdong Province collecting the most resources. The applicant has committed to distributing the aforementioned materials for 20 years from the date of application.
[0041] Primers were synthesized by Shanghai Sangon Biotech and were all PAGE-grade purified.
[0042] 1.2 Analysis of the range of variation of malic acid in the GWAS population
[0043] After collection, winter melon samples were immediately sliced and rapidly frozen in liquid nitrogen, then freeze-dried and ground into a uniform powder. Malic acid content analysis was performed using an HPLC-PDA system (Alliance e2695 HPLC system, Waters, Milford, MA, USA, equipped with a Waters 2998 photodiode array detector). Detection conditions were as follows: detection wavelength 214 nm; chromatographic column: Waters Atlantis T3 C2C2. 18 (4.6×250mm, 5μm), column temperature set at 25℃; sample extract was sterile water, mobile phase was (NH4)2HPO4 / methanol (97:3, v / v), isocratic elution. Malic acid content was quantitatively determined using chromatographic grade standards.
[0044] The malic acid content of winter melon resources collected from domestic and foreign sources, which exhibits extremely high polymorphism, was tested. The results showed that the malic acid content varied greatly among the populations, ranging from a minimum of 1.66 mg / g DW to a maximum of 55.14 mg / g DW, with a coefficient of variation of 34.81%. Figure 1 The appearance of some fruits from the GWAS winter melon population is shown.
[0045] 2. Genome-wide association analysis of malic acidity trait in winter melon pulp
[0046] 2.1 Extraction of Gene DNA
[0047] Genomic DNA was extracted from natural populations of winter melon using a modified cetyltrimethylammonium bromide (CTAB) method. The extracted samples were leaves. The quality and concentration of the extracted DNA were assessed by 2% agarose gel electrophoresis and then diluted to 50-100 ng / μL for later use.
[0048] 2.2 Analysis of resequencing data
[0049] We commissioned BioMed Biotechnology Co., Ltd. to complete library construction and resequencing of 303 winter melon accessions. Using the Illumina Hi-Seq next-generation sequencing platform, after DNA quality control, library construction, sequencing, and filtering, we obtained 6763.20 Gb of clean reads, with a Q30 of 93.12%. The average alignment rate between the samples and the reference genome was 99.72%, with an average coverage depth of 23X and a genome coverage of 97.23% (at least one base covered). SNP calling was performed using GATK software, and after filtering, 9,363,051 high-quality SNP loci were obtained.
[0050] 2.3 Malate genome-wide association analysis
[0051] Genome-wide association analysis (GWAS) is a method used to reveal associations between genetic variation and traits across the entire genome. This invention, based on EMMAX software, employs a mixed linear model to perform association analysis on the genotype and malic acid phenotype of a natural population of winter melon. Potential candidate SNPs are screened using p-value significance. In the Manhattan plot, -log 10 (P)≥5 was set as the threshold for closely associated SNPs. The results showed that the malic trait was significantly associated in a specific segment of chromosome 3 (refer to the genome: http: / / cucurbitgenomics.org / v2 / ftp / genome / WaxGourd / ). Among them, one SNP site located in this segment was most significantly associated with malic esters, named MA_SNP1, and its −log 10 The (P) value is 6.57 (see Figure 2 The SNP is located on chromosome 3 of the winter melon at 45,713,266 bp and exhibits a G / A polymorphism. The G allele (i.e., genotype GG) corresponds to low malic acid content (average malic acid content of 20.69 mg / g DW), while the A allele (i.e., genotype AA) corresponds to high malic acid content (average malic acid content of 30.84 mg / g DW).
[0052] Example 2: KASP technology used for genotyping of malic acid in winter melon pulp
[0053] This invention designs specific primer pairs for amplifying the MA_SNP1 site, including two forward primers with different terminal bases and one reverse primer. The two forward primers have different detection adapter sequences attached to their 5' ends. The nucleotide sequences of this specific primer pair (KASP primer pair) are shown in SEQ ID NO. 1-3:
[0054] Forward primer F1 (underlined part is the FAM tag sequence):
[0055] 5'- GAAGGTGACCAAGTTCATGCT TTATTTGAGTTGTTCGATCGACTG-3' (SEQ ID NO. 1);
[0056] Forward primer F2 (underlined part is the HEX tag sequence):
[0057] 5'- GAAGGTCGGAGTCAACGGATT TATTATTTGAGTTGTTCGATCGACTA-3' (SEQ ID NO. 2);
[0058] Reverse primer R: 5'-TTTTCTAAGGAGAGGATGTGCAA-3' (SEQ ID NO.3).
[0059] The two forward primers have different terminal bases, and the difference is an SNP site.
[0060] The total reaction volume of the KASP genotyping detection system used in this invention is 10 μL, including DNA (10-10 ng), 2×PARMS Master Mix 5 μL, primer mixture 0.7 μL (0.15 μL each of forward primers F1 and F2, 0.4 μL of reverse primer R, with a final concentration of 150 nM for the forward primers and 400 nM for the reverse primers), and the remaining volume is made up with H2O.
[0061] The reaction program consisted of pre-denaturation at 94°C for 15 minutes, followed by 10 cycles of grounding amplification, with each cycle consisting of denaturation at 94°C for 20 seconds and annealing / extension at 65–57°C for 60 seconds, wherein the annealing temperature decreased by 0.8°C per cycle. This was followed by 32 cycles of conventional amplification, with each cycle consisting of denaturation at 94°C for 20 seconds and annealing / extension at 57°C for 60 seconds.
[0062] In the PCR amplification process, the template DNA first binds to the matching primers in the Primer Mix and anneals, and the extended sequence is then combined with the detection adapter sequence. Subsequently, complementary strand synthesis is completed based on the allele-specific terminal sequence to achieve allele-specific amplification. Finally, the detection sequence corresponding to the specific sequence generates a fluorescent signal as the PCR exponentially amplifies.
[0063] After amplification, fluorescence signals were read using a TECAN Infinite M1000 microplate reader, and the data was analyzed using the online software SNPdecoder (http: / / www.snpway.com / snpdecoder / ) to generate an intuitive genotyping map. Each data point in the map represents an independent DNA sample. Samples with the same genotype clustered together are shown in the same color. The blue dots (FAM) near the X-axis correspond to the low-malic homozygous genotype (GG), the green dots (HEX) near the Y-axis correspond to the high-malic homozygous genotype (AA), and the red dots (FAMHEX) in the middle of the diagonal correspond to the heterozygous genotype (GA), i.e., medium malicity. This method enables high-throughput, accurate, and visualized SNP genotyping of winter melon seeds or early seedling samples, providing a reliable means for the early identification of malicity traits.
[0064] The nucleotide sequence of the PCR product is shown in SEQ ID NO.4, as follows:
[0065] TATTATTTGAGTTGTTCGATCGACT[M]AAATTTGACTTTAAAAGTATTCGAATCAATCAACTTAAAAAGAATATTGCAATAGGTATGCAGAATTCTATTGCACATCCTCTCCTTAGAAAA.
[0066] Note: The [M] base position in this sequence is an SNP site, and the polymorphism at this position is G / A.
[0067] Example 3
[0068] To verify the detection accuracy of the SNP molecular markers screened in this invention, 193 samples with significantly different malic acid content were selected from the 303 natural winter melon populations in Example 1. Genotyping analysis was performed on this population using the KASP primer pairs (SEQ ID NO. 1-3) used to amplify the SNP molecular markers in Example 2. The genotyping analysis process was the same as in Example 2, and the results are as follows: Figure 3 As shown in the figure. The results showed that there were significant differences in malic acid content among different genotypes. The median malic acid content of the GG genotype (FAM, blue dot) samples was 20.03 mg / g DW, the median for the GA genotype (FAMHEX, red dot) was 22.30 mg / g DW, and the median for the AA genotype (HEX, green dot) was 28.87 mg / g DW. This indicates that the malic acid content of the GG genotype was significantly lower than that of the AA genotype, while the GA genotype was at an intermediate level, fully demonstrating the significant association between this SNP molecular marker and the malic acid trait.
[0069] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.
Claims
1. A SNP molecular marker closely linked to the major-effect QTL of malic acid in fruit flesh of Benincasa cerifera, characterized in that, The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 4, and a G / A mutation exists at the 26th base of the sequence.
2. A KASP primer pair for amplifying the SNP molecular marker of claim 1, characterized in that, The KASP primer pair comprises F1 with the nucleotide sequence shown as SEQ ID NO. 1, F2 with the nucleotide sequence shown as SEQ ID NO. 2, and R with the nucleotide sequence shown as SEQ ID NO.
3.
3. Use of the KASP primer pair of claim 2 in the preparation of a product for identifying the high or low malic acid content of the fruit pulp of a wax gourd.
4. Use according to claim 3, characterized in that, The product comprises reagents, kits and chips.
5. A product for identifying the high or low malic acid content of the fruit pulp of a wax gourd, characterized by, The product comprises the KASP primer pair of claim 2.
6. The product of claim 5, wherein, The product comprises reagents, kits and chips.
7. Use of the KASP primer pair of claim 2 or the product of claim 5 or 6 in identifying the high or low malic acid content of the fruit pulp of a wax gourd.
8. A method for identifying the high or low malic acid content of the fruit pulp of a wax gourd, characterized by, The method comprises the following steps: Using the genomic DNA of the wax gourd to be tested as a template, performing KASP PCR amplification on the template by using the KASP primer pair of claim 2, and performing genotyping by using the amplification results.
9. The method of claim 8, wherein, If the genotyping result is GG, the wax gourd to be tested is a wax gourd variety with low malic acid content; if the genotyping result is AA, the wax gourd to be tested is a wax gourd with high malic acid content; and if the genotyping result is GA, the wax gourd to be tested is a wax gourd with medium malic acid content.
10. Use of the KASP primer pair of claim 2 or the product of claim 5 or 6 in any one of the following, (1) screening of a wax gourd variety or strain with low, medium or high malic acid content; (2) regulation of the malic acid trait of the fruit pulp of a wax gourd; (3) improvement of the germplasm of a wax gourd; (4) molecular breeding of a wax gourd.
Citation Information
Patent Citations
SNP (Single Nucleotide Polymorphism) molecular marker linked with major QTL (Quantitative Trait Loci) of winter melon and fruit
CN115852025A
SNP molecular marker linked with white gourd pulp thickness major QTL and application of SNP molecular marker
CN119753223A
Melon plants with melon yellowing associated virus (MYAV) resistance
WO2014090968A1