Molecular marker used as Tibetan sheep marker assisted selection and related to disease resistance character and application of molecular marker

By detecting SNP molecular markers in Tibetan sheep, the problem of assessing disease resistance traits has been solved, enabling early screening of individuals with superior disease resistance and improving the breeding efficiency of Tibetan sheep.

CN121780718APending Publication Date: 2026-04-03LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610116026.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-28
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

The lack of molecular markers in existing technologies for assessing disease resistance traits in Tibetan sheep leads to low breeding efficiency, and traditional breeding methods cannot quickly screen out individuals with superior disease resistance at the young age.

Method used

This invention provides a Tibetan sheep SNP molecular marker located at 29,402,282 bases on chromosome 10 of the international sheep reference genome Oar_v4.0 version, with a variant type of T/C. By detecting the genotype of this SNP locus, PCR amplification and sequencing are performed using primers to analyze the levels of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 in individual Tibetan sheep, providing a kit for auxiliary selection of disease resistance traits.

Benefits of technology

By detecting the genotype at nucleotide 29,402,282 on chromosome 10 of Tibetan sheep, the immune capacity of individual Tibetan sheep can be determined, providing SNP molecular marker resources for early molecular breeding and improving breeding efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121780718A_ABST
    Figure CN121780718A_ABST
Patent Text Reader

Abstract

The invention provides a molecular marker used for Tibetan sheep marker-assisted selection and related to disease resistance characters and application of the molecular marker, and belongs to the technical field of molecular marker-assisted breeding, the molecular marker is located at the 29402282th basic group on the 10th chromosome of the international sheep reference genome Oarv4.0 version; the variation type is T / C, the molecular marker site has three genotypes of TT, TC and CC, the genotype of the molecular marker site has significant correlation with the content of cytokines in a Tibetan sheep blood sample, and the content of IL-1alpha, IL-1beta, IL-6, TNF-alpha, IL-1Ra and IL-10 of a Tibetan sheep individual can be judged by detecting the genotype of the SNP molecular marker. The SNP molecular marker can be used for non-diagnostic Tibetan sheep immune trait marker-assisted selection, and a new SNP molecular marker resource is provided for early molecular breeding of Tibetan sheep.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker-assisted breeding technology, and particularly relates to a molecular marker for disease resistance traits in Tibetan sheep as a marker-assisted selection and its application. Background Technology

[0002] Tibetan sheep are a core livestock germplasm resource of the Qinghai-Tibet Plateau and adjacent high-altitude areas, with a population exceeding 30 million. They possess unique biological characteristics, including tolerance to roughage and extreme cold, making them a vital source of meat, wool, and other agricultural and livelihood resources for local herders, thus possessing extremely high economic and ecological value. However, the high-altitude environment in which Tibetan sheep live presents multiple challenges, including low air pressure, low oxygen partial pressure, strong ultraviolet radiation, and nutritional stress during the cold season. This makes them highly susceptible to diseases such as foot rot and pneumonia, severely hindering the sustainable development of Tibetan sheep farming. Furthermore, traditional methods of disease control relying on medication not only increase farming costs but also easily lead to drug resistance in pathogens and drug residues in livestock products, posing a potential threat to the ecological environment and food safety.

[0003] An animal's disease resistance is essentially determined by the functional state of its immune system. Cytokines, as core regulatory molecules of the immune system, have expression levels closely related to the intensity of the body's immune response, regulation of inflammation, and pathogen clearance capacity. Interleukin-1α (IL-1α), interleukin-1β (IL-1β), interleukin-6 (IL-6), and tumor necrosis factor-α (TNF-α), as pro-inflammatory cytokines, can initiate and amplify the body's immune response to pathogens. Interleukin-1 receptor antagonists (IL-1Ra) and interleukin-10 (IL-10), on the other hand, are anti-inflammatory cytokines that can effectively inhibit excessive inflammatory responses and maintain immune balance. The blood levels of these cytokines directly reflect the immune regulatory capacity of Tibetan sheep. Abnormal expression of these cytokines is often closely related to the susceptibility or resistance of Tibetan sheep to disease, thus becoming a key physiological indicator for assessing the disease resistance of Tibetan sheep.

[0004] Molecular marker-assisted breeding technology is a core approach to solving the problems of long breeding cycles and low accuracy in traditional breeding. Among them, single nucleotide polymorphism (SNP) molecular markers have become an important tool for disease-resistant breeding in livestock and poultry due to their wide distribution, convenient detection, and rich polymorphism. However, existing research still has significant limitations: First, most of the discovered molecular markers are related to single immune indicators such as immunoglobulins and antigen-presenting proteins, and there are no reports on SNP molecular markers targeting the levels of core cytokines such as IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 in the blood of Tibetan sheep; Second, traditional breeding lacks molecular markers that can be directly used for early selection, making it impossible to quickly screen out individuals with excellent disease resistance in the early stages of Tibetan sheep breeding, resulting in low breeding efficiency. Summary of the Invention

[0005] In view of this, the purpose of the present invention is to provide a molecular marker associated with disease resistance traits as a marker-assisted selection for Tibetan sheep and its application.

[0006] This invention provides a Tibetan sheep SNP molecular marker located at nucleotide 29,402,282 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0. The variant type is T / C, with three genotypes: TT, TC, and CC. Tibetan sheep individuals with the TT genotype at the SNP site have significantly lower levels of IL-1α, IL-6, TNF-α, and IL-1Ra than those with the CC genotype. Tibetan sheep individuals with the TT genotype have significantly lower levels of IL-1β than those with the TC and CC genotypes. Tibetan sheep individuals with the CC genotype have significantly lower levels of IL-10 than those with the TT and TC genotypes.

[0007] This invention provides the application of the reagent for detecting the SNP molecular markers of Tibetan sheep in the preparation of a kit for assisted selection breeding of Tibetan sheep with disease resistance traits.

[0008] Preferably, the reagent comprises primers for amplifying the SNP molecular marker, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.3.

[0009] Preferably, the method of using the reagent kit is as follows: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primer pair to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 432 of the amplification products to determine the genotype of the SNP molecular marker.

[0010] Compared with the prior art, the present invention has the following beneficial effects: The SNP molecular marker provided by this invention is located at position 29,402,282 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0; the variant type is T / C, named g29402282T>C, and there are three genotypes: when position 29,402,282 on chromosome 10 is T, the genotype is TT or TC; when position 29,402,282 on chromosome 10 is C, the genotype is CC; and the marker is used to correlate different genotypes with IL levels in blood samples from Tibetan sheep. Association analysis of the levels of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 revealed that the levels of IL-1α, IL-6, TNF-α, and IL-1Ra in Tibetan sheep with the TT genotype were significantly lower than those in those with the CC genotype (p<0.05), the level of IL-1β in Tibetan sheep with the TT genotype was significantly lower than those in those with the TC and CC genotypes (p<0.05), and the level of IL-10 in Tibetan sheep with the CC genotype was significantly lower than that in those with the TT and TC genotypes (p<0.05). This invention demonstrates that the bases at the g29402282T>C SNP site on Tibetan sheep chromosome 10 are SNP markers related to IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 in Tibetan sheep. By detecting the bases at the 29402282nd nucleotide site on Tibetan sheep chromosome 10, the levels of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 in an individual Tibetan sheep can be determined. This invention provides a new SNP molecular marker resource for the selection of immune trait markers in Tibetan sheep for non-diagnostic purposes. Attached Figure Description

[0011] Figure 1 The results of agarose gel electrophoresis for detecting the amplification products of the g29402282T>C SNP site on chromosome 10 of Tibetan sheep, where M is the Marker and 1-3 are three replicates of the amplification product; Figure 2 The peak diagram and sequence of SNP sites obtained after purification and sequencing of PCR amplification products. Detailed Implementation

[0012] This invention provides a Tibetan sheep SNP molecular marker located at nucleotide 29,402,282 on chromosome 10 of the International Sheep Reference Genome Oar_v4.0. The variant type is T / C, with three genotypes: TT, TC, and CC. Tibetan sheep individuals with the TT genotype at the SNP site have significantly lower levels of IL-1α, IL-6, TNF-α, and IL-1Ra than those with the CC genotype. Tibetan sheep individuals with the TT genotype have significantly lower levels of IL-1β than those with the TC and CC genotypes. Tibetan sheep individuals with the CC genotype have significantly lower levels of IL-10 than those with the TT and TC genotypes.

[0013] This invention also provides the application of the reagent for detecting the SNP molecular markers of Tibetan sheep in the preparation of a kit for assisted selection breeding of Tibetan sheep with disease resistance traits.

[0014] In this invention, the reagent preferably includes primers for amplifying the SNP molecular marker, and the nucleotide sequences of the primers are shown in SEQ ID NO.2 and SEQ ID NO.3, as follows: F: 5'-GTGTCCAATCCAGCTAGCCA-3' (SEQ ID NO. 2); R: 5'-TGTCAGCTCAGAATCCGTC-3' (SEQ ID NO. 3).

[0015] In this invention, the reagents also include PCR reaction reagents. This invention does not specifically limit the type of PCR reaction reagents; commercially available PCR reaction reagents in the art can be used.

[0016] In this invention, the reagent kit is used as follows: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primer pair to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 432 of the amplification products to determine the genotype of the SNP molecular marker.

[0017] In this invention, genomic DNA is extracted from the blood sample to be tested. The method for extracting the blood genomic DNA is not particularly limited in this invention; conventional genomic DNA extraction methods in the art can be used.

[0018] In this invention, the obtained genomic DNA is used as a template, and PCR amplification is performed using the primers in the kit to obtain amplification products. In this invention, the PCR amplification system is in 25 μL units, preferably comprising: 22 μL of gold-labeled mix (green), 1 μL of upstream primer, 1 μL of downstream primer, and 1 μL of template (genomic DNA). The preferred PCR amplification program is as follows: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min. After obtaining the amplification products, the amplification products are sequenced, and the genotype at position 432 of the amplification products is analyzed to determine the genotype of the SNP molecular marker. In this invention, the amplification products are preferably sequenced after passing agarose gel electrophoresis. The sequencing is preferably performed using direct sequencing. The nucleotide sequence of the amplification products is shown in SEQ ID No. 1, and the SNP marker is located at position 432 of the nucleotide sequence shown in SEQ ID No. 1. In this invention, the sequencing results of the amplified products are preferably compared using the bioanalysis software MEGA 6.0, the sequencing peak diagram is analyzed, and genotyping is completed.

[0019] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0020] Example 1

[0021] 1. Sample collection

[0022] The samples were collected from Tibetan sheep populations under natural grazing conditions, including 78 samples from Gannan Tibetan Autonomous Prefecture in Gansu Province, 50 samples from Yushu Tibetan Autonomous Prefecture in Qinghai Province, and 45 samples from Shigatse City in Tibet Autonomous Region. 5 mL of blood samples were collected from 173 fasting Tibetan sheep in clean, anticoagulant vacuum blood collection tubes. The tubes were allowed to stand for 30 min, then centrifuged at 3500 rpm for 15 min. The supernatant was transferred to clean PE tubes, sealed, and stored at -20°C as serum samples for the detection of pro-inflammatory and anti-inflammatory factors. Separately, 5 mL of blood samples were collected in blood collection tubes containing EDTA-K2 anticoagulant. After collection, the samples were quickly mixed, placed in a sampling box with ice packs for temporary storage, and then frozen at -20°C upon return to the laboratory for DNA extraction.

[0023] 2. Main Reagents and Instruments

[0024] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; the blood genomics extraction kit was purchased from Tiangen Biotech (Beijing) Co., Ltd.; the NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL1000 markers, agarose, and nucleic acid dyes were purchased from Beijing Solarbio Science & Technology Co., Ltd.; the gold-labeled mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; the electrophoresis apparatus was purchased from Beijing Liuyi Instrument Factory; and the PCR instrument was purchased from BioRad. The IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.

[0025] 3 Methods

[0026] 3.1 Detection of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10

[0027] The assay was performed using the enzyme-linked immunosorbent assay (ELISA) method according to the test kit from Nanjing Jiancheng Biotechnology Research Institute. The assay steps were as follows: (1) Serial dilution of the standard according to the instructions; (2) Add 100 μL of antibody to each well, coat for 2 hours, discard the liquid and spin dry; (3) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (4) Add 200 μL of blocking buffer to each well, gently shake to mix, let stand at room temperature for 30 minutes, discard the liquid and spin dry; (5) Add 300 μL of diluted washing buffer to each well, shake for 30 seconds, discard the washing buffer and pat dry with absorbent paper, repeat 5 times; (6) Add 25 μL of coating buffer, 25 μL of serum sample and 50 μL of standard to each well, gently shake to mix; (7) Add 100 μL of antibody to each well. (8) Gently shake HRP to mix, let stand at room temperature for 60 min, then discard the liquid and spin dry; (9) Add 300 μL of diluted washing solution to each well, shake for 30 s, then discard the washing solution and pat dry with absorbent paper, repeat 5 times; (10) Add 100 μL of color developing solution to each well, gently shake to mix, and develop color for 15 min; (11) Add 100 μL of stop solution to each well to stop the reaction (at this time, the blue color immediately turns yellow); (12) Zero the blank well and measure the OD value of each well at a wavelength of 450 nm; (13) Make a standard curve using the OD value of the standard and obtain the curve formula, then substitute the OD measured by the sample test tube into the calculation formula to obtain the result.

[0028] 3.2 Extraction of genomic DNA from blood

[0029] Genomic DNA was extracted from blood samples using the blood genome extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The concentration and purity of the extracted DNA were detected by ultraviolet spectrophotometer. A concentration >20 ng / μL and an OD260 / OD280 between 1.7 and 1.9 were sufficient for the experiment. The DNA was stored at -20℃ for later use.

[0030] 3.3 Primer Design

[0031] Based on the gene sequence of chromosome 10 in the Oar_v4.0 version of the international sheep genome (GenBank accession number: NC_019467.2), a pair of specific primers containing the g29402282T>C SNP site was designed using Primer Premier 5.0 software.

[0032] Primer sequences: F: 5'-GTGTCCAATCCAGCTAGCCA-3' (SEQ ID NO. 2); R: 5'-TGTCAGCTCAGAATCCGTC-3' (SEQ ID NO. 3).

[0033] The primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0034] 3.4 PCR amplification and sequencing

[0035] PCR amplification system 25μL: Gold Mix (green) 22μL, upstream primer and downstream primer 1μL each, template (genomic DNA) 1μL.

[0036] PCR amplification program: 98℃ for 2 min; 98℃ for 10 s, 57℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; extension at 72℃ for 2 min.

[0037] PCR products were detected by 1.5% agarose gel electrophoresis. After passing the agarose gel electrophoresis test, the PCR products were sequenced using direct sequencing, which was performed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No. 1, with a fragment length of 528 bp. The SNP marker is located at position 432 of the nucleotide sequence shown in SEQ ID No. 1, as detailed below: GTGTCCAATCAGCTAGCCAGGTGTCCCCCTTTCTGTTCTAGGAAAATTAATATATCTTATGACAATATTTCAGGAAAGGATACATGCAGATGGTGACTACAAACGTTGGTAACCCCATGAAAAAGAACAATTTTGTAGGTATTGTGAAAATTGTGAATTTAAAAAAAAAATCAAAATTAATACTACCATTTATTGCATACTTTTAAAAGTTCACA GTGGGGACCCATTCCTTGGGCTTCCCAGGTGGCACAGTGGTAAAATAATCCACCTGCCAATGCAGGAGACGTAGATTCGATCCCTGGGTTGGCAAGATCCCCTGCAGAATGGAATGGCAACCCACTCCGGTATTCTTGCCTGGGAGATCCCATGGACAGAGGAGCCTGGTGGGCTACAGTCCACAGGGGTCACAGAGTCAGACACGACTGAACGAC C AAGCACACCCTTTCCCTAGCTGAGAAGAGAGCACAGGATCCTGTCTGGATGATCAGGGGGAAAGTCATCATGATAGGGACGGATTCTGAGCTGACA The sequencing results of PCR products were compared using the bioanalysis software MEGA 6.0, and the sequencing peak diagrams were analyzed to complete the typing.

[0038] 4. Statistical Analysis

[0039] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The frequency of the g29402282T>C gene, genotype frequency, effective allele count (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes in Tibetan sheep and IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. Results are expressed as mean ± standard error.

[0040] 5 Results

[0041] 5.1 PCR amplification and sequencing results

[0042] The amplification products of the g29402282T>C SNP site on chromosome 10 of Tibetan sheep were detected using 1.5% agarose gel electrophoresis (see [link to article]). Figure 1 The bands were clear and free of impurities, indicating good specificity. The PCR product fragment size was 528 bp, which is in line with the expected size, and the next step of the experiment can be carried out.

[0043] The peak chromatogram and sequence obtained after purification and sequencing of the PCR product are shown below. Figure 2 .Depend on Figure 2 It can be seen that the TC mutation occurs at the g29402282T>CSNP site, resulting in three genotypes: TT, TC, and CC.

[0044] 5.2 Statistical Analysis Results

[0045] Genotype and allele frequencies of the g29402282T>C SNP locus on chromosome 10 of Tibetan sheep were analyzed from a population genetics perspective. Table 1 shows that the CC genotype had the highest frequency at the g29402282T>C SNP locus, indicating it was the dominant genotype, while the C allele frequency was 76.6%, also indicating it was the dominant allele. The χ² fitness test showed that the SNP locus significantly deviated from Hardy-Weinberg equilibrium (P<0.05) (Table 1). The expected heterozygosity of this locus was 0.359, and the PIC was 0.294, indicating moderate polymorphism.

[0046] Table 1. Polymorphism of SNP site g29402282T>C on chromosome 10 of Tibetan sheep

[0047] 5.3 Association analysis between different genotypes and IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10

[0048] The association between different genotypes of Tibetan sheep and the levels of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 was analyzed using a general linear model in IBM SPSS Statistics 22 software. The results showed that the levels of IL-1α, IL-6, TNF-α, and IL-1Ra in Tibetan sheep with the TT genotype were significantly lower than those with the CC genotype (p<0.05). The IL-1β level in Tibetan sheep with the TT genotype was significantly lower than that in those with the TC and CC genotypes (p<0.05). The IL-10 level in Tibetan sheep with the CC genotype was significantly lower than that in those with the TT and TC genotypes (p<0.05). This indicates that the base at the g29402282T>C SNP site on chromosome 10 of Tibetan sheep is a SNP marker associated with IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10. The results are shown in Table 2.

[0049] Table 2. Correlation analysis between different genotypes and the relative levels (concentrations) of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10.

[0050] Note: Different lowercase letters in the intercalation of data in the same row indicate significant differences (P < 0.05).

[0051] As can be seen from the above embodiments, the genotype of the SNP molecular marker locus described in this invention is significantly correlated with the levels of cytokines IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 in Tibetan sheep blood samples. By detecting the genotype of the 29,402,282nd nucleotide site on chromosome 10 of Tibetan sheep, the levels of IL-1α, IL-1β, IL-6, TNF-α, IL-1Ra, and IL-10 in individual Tibetan sheep can be determined. This can be used for non-diagnostic immunophenotypic marker-assisted selection of Tibetan sheep, providing new SNP molecular marker resources for early molecular breeding of Tibetan sheep.

[0052] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A molecular marker for SNPs in Tibetan sheep, characterized in that, The SNP molecular marker is located at nucleotide 29,402,282 on chromosome 10 of the International Sheep Reference Genome Oar_v4.

0. The variant type is T / C, with three genotypes: TT, TC, and CC. The levels of IL-1α, IL-6, TNF-α, and IL-1Ra in Tibetan sheep individuals with the TT genotype at the SNP site are significantly lower than those with the CC genotype. The IL-1β level in Tibetan sheep individuals with the TT genotype is significantly lower than that in Tibetan sheep individuals with the TC and CC genotypes. The IL-10 level in Tibetan sheep individuals with the CC genotype is significantly lower than that in Tibetan sheep individuals with the TT and TC genotypes.

2. The application of the reagent for detecting the Tibetan sheep SNP molecular markers as described in claim 1 in the preparation of a kit for assisted selection breeding of Tibetan sheep with disease resistance traits.

3. The application according to claim 2, characterized in that, The reagents include primers for amplifying the SNP molecular marker, the nucleotide sequences of which are shown in SEQ ID NO.2 and SEQ ID NO.

3.

4. The application according to claim 2 or 3, characterized in that, The method of using the kit is as follows: 1) Extract genomic DNA from the blood sample to be tested; 2) Using the genomic DNA obtained in step 1) as a template, perform PCR amplification with the primer pair to obtain the amplification product; 3) Sequencing the amplification products and analyzing the genotype at position 432 of the amplification products to determine the genotype of the SNP molecular marker.