Specific primer for identifying whether tomato peel has green stripes and application thereof
By developing specific primers DGS-F/R and combining them with PCR technology and electrophoresis detection, the problem of rapid identification of green stripes on tomato peel and soluble solids content was solved, thus improving the accuracy and efficiency of the breeding process.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- CHINA AGRI UNIV
- Filing Date
- 2026-04-03
- Publication Date
- 2026-05-19
AI Technical Summary
Existing technologies make it difficult to quickly and accurately identify whether tomato peels have green stripes and/or the soluble solids content of tomato fruits.
Specific primers DGS-F/R were developed to identify whether tomato peel has green stripes and/or the soluble solids content of tomato fruit by PCR. Combined with PCR amplification and agarose gel electrophoresis detection, genotypic analysis of tomato peel was performed using specific primers DGS-F/R.
This method enables rapid and accurate identification of whether tomato skin has green stripes and the content of soluble solids in the fruit, improving the accuracy and efficiency of the breeding process and reducing the impact of environmental factors and human error.
Smart Images
Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of molecular biology and crop breeding technology, specifically, it relates to specific primers for identifying whether tomato peel has green stripes and their applications. Background Technology
[0002] In recent years, with the continuous improvement of people's material living standards, the variety of fruits and vegetables on the market has become increasingly diverse, and people's requirements for the quality of tomatoes have become more and more stringent. They not only pursue "deliciousness" but also "appearance." "Appearance" mainly refers to the color of the tomato surface. Surface color is an important indicator of tomato ripeness and a crucial aspect of the tomato's appearance, directly affecting consumer purchasing choices and the commercial value of horticultural crops. The pigment types on the surface of ripe tomatoes mainly include carotenoids and a small amount of chlorophyll, with some tomato materials accumulating anthocyanins. The accumulation of these pigments in different components and proportions results in a variety of evenly distributed colors on the surface of ripe tomatoes, such as red, pink, yellow, orange, green, white, and purple. In addition, a type of green-striped tomato has been discovered during the survey and collection of wild tomato germplasm resources. Chloroplasts accumulate specifically and regularly in the middle of the pericarp of each ectoderm. Therefore, conducting research on the green-striped trait of wild tomatoes and developing molecular markers closely linked to this trait can significantly shorten the breeding process and improve the accuracy of selection. Summary of the Invention
[0003] The technical problem to be solved by this invention is how to quickly and accurately identify whether the tomato peel has green stripes and / or the soluble solids content of the tomato fruit.
[0004] To address the aforementioned issues, this invention first provides specific primers for identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit. The specific primers are primer pair DGS-F / R, which consists of DGS-F and DGS-R. DGS-F is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 1, and DGS-R is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 2.
[0005] The nucleotide sequence of DGS-F is: 5′-CTCTATTTTATGCTAACCTCTTAAATGCTTAGAAAATGAC-3′;
[0006] The nucleotide sequence of DGS-R is: 5′-GTAGGGTTGATACGAGATGATTGAAATTTTCTTGAAC-3′.
[0007] This invention also provides the application of the specific primers described above in identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit.
[0008] The present invention also provides reagents or kits for identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit, wherein the reagents or kits may include the specific primers described above.
[0009] This invention also provides the application of the reagents or kits described above in identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit.
[0010] This invention also provides the application of the specific primers described above in tomato breeding.
[0011] In this invention, the PCR primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moieties (positive or negative) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).
[0012] The PCR reaction can be performed using a 25 μL PCR amplification system: 1 μL DNA template, 1 μL 10 μM DGS-F, 1 μL 10 μM DGS-FR, 12.5 μL 2×Taq Mix, and 9.5 μL ddH2O.
[0013] The PCR amplification program can be used as follows: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min. The PCR amplification products are detected by 1% agarose gel electrophoresis, with a sample loading volume of 8 μL.
[0014] This invention also provides the application of the reagents or kits described above in tomato breeding.
[0015] The present invention also provides a method for identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit, comprising using the genomic DNA of the tomato to be tested as a template, performing PCR amplification with the specific primers described above to obtain PCR products, and identifying whether the tomato peel to be tested has green stripes and / or the soluble solids content of tomato fruit based on the size and / or sequence of the PCR products.
[0016] This invention also provides a breeding method for tomatoes with green stripes on their peels. The method includes crossing tomato A with tomato L to obtain F1 generation tomato H; continuously backcrossing the F1 generation tomato H with tomato A to obtain BC4F1 generation tomatoes; selecting individual plants with genotype H from the BC4F1 generation tomatoes and self-pollinating them to obtain BC4F2 generation tomatoes; and selecting individual plants with genotype L or H from the BC4F2 generation tomatoes, wherein the individual plants are tomatoes with green stripes on their peels. The method includes crossing tomato A with tomato L to obtain F1 generation tomatoes; continuously backcrossing the F1 generation tomatoes with tomato A to obtain BC4F1 generation tomatoes; selecting a single plant with genotype H from the BC4F1 generation tomatoes for self-pollination to obtain BC4F2 generation tomatoes; and selecting a single plant with genotype L from the BC4F2 generation tomatoes, wherein the single plant is a tomato with green stripes on its skin. The individual plant with genotype A is either A1 or A2 as follows: A1. The single plant with genotype A is used as a template by genomic DNA of the single plant to be tested and PCR is performed using the specific primers described in claim 1. The single plant to be tested whose PCR product is a 374bp DNA fragment but does not contain a 671bp DNA fragment is a single plant with genotype A. A2. The single plant with genotype A is a single plant whose genome contains a DNA molecule with nucleotide sequence SEQ ID NO: 3 but does not contain a DNA molecule with nucleotide sequence SEQ ID NO: 4.
[0017] The individual plants with genotype L are either L1 or L2 as follows: L1. The single plant with genotype L is used as a template for PCR with the specific primers described in claim 1. The single plant to be tested is a single plant with genotype L if the PCR product is a 671bp DNA fragment but does not contain a 374bp DNA fragment. L2. The single plant with genotype L is a single plant whose genome contains a DNA molecule with nucleotide sequence SEQ ID NO: 4 but does not contain a DNA molecule with nucleotide sequence SEQ ID NO: 3.
[0018] The single plant with genotype H is either H1 or H2 as described below: H1. The single plant with genotype H is used as a template by genomic DNA of the single plant to be tested and PCR is performed using the specific primers described in claim 1. The single plant to be tested with genotype H is the single plant with genotype H whose PCR product is a 671bp DNA fragment and a 374bp DNA fragment. H2. The single plant with genotype H is a single plant whose genome contains a DNA molecule with nucleotide sequence SEQ ID NO: 4 and a DNA molecule with nucleotide sequence SEQ ID NO: 3.
[0019] In the above method, the continuous backcrossing may include the following steps: selecting a single plant with genotype H from the BC1F1 generation tomatoes and backcrossing it with the tomato A to obtain the BC2F1 generation tomatoes; selecting a single plant with genotype H from the BC2F1 generation tomatoes and backcrossing it with the tomato A to obtain the BC3F1 generation tomatoes; and selecting a single plant with genotype H from the BC3F1 generation tomatoes and backcrossing it with the tomato A to obtain the BC4F1 generation tomatoes.
[0020] In some embodiments of the present invention, the indicators for tomato breeding include whether the peel has a green stripe trait or / and the soluble solids content of the tomato fruit.
[0021] In some embodiments of the present invention, the tomato breeding is parental hybridization breeding, and the purpose of the tomato breeding includes cultivating tomatoes with green stripes on the peel, wherein the soluble solids content of the tomatoes with green stripes is higher than that of tomatoes without green stripes on the peel.
[0022] The aforementioned parental hybridization breeding refers to a breeding method that involves artificially pollinating and hybridizing the male and female parents to select new varieties that combine the superior traits of both parents from their offspring (hybrids).
[0023] In this application, "parent" refers to two different varieties or strains of plants used for hybridization, such as tomatoes.
[0024] In some embodiments of the present invention, the tomato is a hybrid offspring of tomato A and tomato L. Tomato L is a tomato whose genome contains a DNA molecule with the nucleotide sequence SEQ ID NO: 4 but not a DNA molecule with the nucleotide sequence SEQ ID NO: 3; tomato A is a tomato whose genome contains a DNA molecule with the nucleotide sequence SEQ ID NO: 3 but not a DNA molecule with the nucleotide sequence SEQ ID NO: 4. In some embodiments of the present invention, the hybrid offspring is the F1 generation or a later generation, such as F2, F3, F4, F5, BC1F1, BC2F1, BC3F1, BC3F2, BC4F2, BC3F3, BC3F4, or BC3F5, etc.
[0025] In some specific embodiments of the present invention, the tomato A may be cultivated tomato AC or T843, and the tomato L may be hairy tomato LA0407.
[0026] In some embodiments of the present invention, the method for identifying whether the peel of the tomato to be tested has the trait of green stripes based on the size and / or sequence of the PCR product is as follows: the peel of the tomato to be tested with a DNA fragment of 671 bp PCR product and the tomato to be tested with two bands of 374 bp and 671 bp PCR product has green stripes, and the tomato to be tested with a DNA fragment of 374 bp PCR product does not have green stripes. In some embodiments of the present invention, the size and / or sequence of the PCR product are used to identify whether the tomato peel has green stripes or / or whether the soluble solids content of the tomato fruit is higher than that of tomato A.
[0027] The tomato with green stripes on its peel has a higher soluble solids content than tomato A.
[0028] In some embodiments of the present invention, the green stripes on the peel of the fruit refer to tomato fruits before they are fully ripe.
[0029] The period before full maturity can be from the fruit-setting stage to the maturity stage.
[0030] In some embodiments of the present invention, whether the peel has green stripes refers to whether there are green stripes on the tomato fruit before and / or after the peel turns completely red.
[0031] In one embodiment of the present invention, tomato A is the female parent and tomato L is the male parent.
[0032] Experiments of this invention demonstrate that PCR primers based on the tomato genomic DNA fragment located in the 91.26 kb mapping region of tomato chromosome 10 can accurately genotype related allelic variations such as tomato peel stripes / soluble solids content, predicting whether the tomato peel has green stripes and the soluble solids content in the fruit. Using molecular marker-assisted selection breeding technology can effectively avoid the influence of environmental factors and human errors on phenotypic identification. The specific primers of this invention can provide selection signals, improve the accuracy of identifying tomato peel stripes / soluble solids content, and achieve the goal of molecular marker-assisted selection of superior lines. Attached Figure Description
[0033] Figure 1 : A non-striped cultivated tomato AC (left) and a green-striped hairy tomato material LA0407 (right) in the green-ripe stage, with a scale length of 1cm.
[0034] Figure 2BSA sequencing reveals genes regulating green stripes in tomatoes. DGS It is located on chromosome 10.
[0035] Figure 3 Tomato green stripe gene DGS Precise positioning.
[0036] Figure 4 Molecular markers and the green stripe trait co-segregated in the F2 population.
[0037] Figure 5 Photographs of striped and unstriped fruits of cultivated tomatoes AC (which are red when ripe) and green-striped hairy tomatoes LA0407 (generation BC4F2), along with the results of soluble solids content analysis. The scale bar is 1 cm long.
[0038] Figure 6 Photographs and soluble solids content test results of BC4F2 generation fruits of cultivated tomatoes T843 (coffee-colored when ripe) and green-striped hairy tomatoes LA0407 (with and without stripes). Detailed Implementation
[0039] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0040] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0041] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 was considered satisfactory. () indicates a significant difference, P < 0.01. () indicates a highly significant difference, P < 0.001. () indicates a highly significant difference.
[0042] In the following examples, cultivated tomato AC is the Tomato mentioned in the following literature ( Solanum lycopersicum) cvAilsa Craig: Du M, Zhai Q, Deng L, Li S, Li H, Yan L, Huang Z, Wang B, JiangH, Huang T, Li CB, Wei J, Kang L, Li J, Li C. Closely related NACtranscription factors of tomato differentially regulate stomatal closure andreopening during pathogen attack. Plant Cell. 2014 Jul;26(7):3167-84. doi:10.1105 / tpc.114.128272. Epub 2014 Jul 8. PMID: 25005917; PMCID: PMC4145139; Hairy tomato LA0407 is from the following literature Solanum habrochaites LA1407: Du M, Sun C, Deng L, Zhou M, Li J, Du Y, Ye Z, Huang S, Li T, Yu J, Li CB, Li C. Molecularbreeding of tomato: Advances and challenges. J Integr Plant Biol. 2025 Mar;67(3):669-721. doi: 10.1111 / jipb.13879. Epub 2025 Mar 18. PMID: 40098531; PMCID: PMC11951411; The cultivated tomato T843 (which carries a key green flesh mutation originating from the loss of function of the STAY-GREEN gene, resulting in a brown color at maturity) is disclosed in the following literature, page 181, right column, first paragraph, where it is referred to as... gf mutant: Cornelius S. Barry , Ryan P. McQuinn, Mi-Young Chung, Anna Besuden, and JamesJ. Giovannoni. Amino Acid Substitutions in Homologs of the STAY-GREEN ProteinAre Responsible for the green-flesh and chlorophyll retainer Mutations ofTomato and Pepper. Plant Physiology, May 2008, Vol. 147, pp. 179–187, www.plantphysiol.org / cgi / doi / 10.1104 / pp.108.118430.
[0043] The aforementioned biological materials are available to the public from China Agricultural University. These biological materials are only for repeating the relevant experiments of this invention and may not be used for other purposes.
[0044] Example 1: Localization of Indel sites associated with green stripes on tomatoes and establishment of molecular marker and detection methods. 1. Construction of genetic segregating populations During the survey and collection of wild tomato germplasm resources, a type of tomato material with green stripes on the surface of its fruit was discovered and named... Dark Green Stripes (DGS) Among them, the green stripes on the surface of hairy tomatoes are the most obvious.
[0045] Cultivated tomatoes AC (without green stripes on the skin) Figure 1 (Left) is the mother plant and the hairy tomato LA0407 with green stripes on the fruit skin. Figure 1 (Right) F2 segregating population was constructed by crossing the male parent.
[0046] In 2023, cultivated tomatoes AC and hairy tomatoes LA0407 were planted at the Dongbeiwang Agricultural Base. Tomatoes were sown in a greenhouse with a parent-to-parent ratio of 1:4. The male parent was sown 12 days earlier than the female parent, and the seedlings were about 30 days old. Transplanting was done when the seedlings reached three leaves and one bud. Both male and female parents were planted with a row spacing of 90cm and a plant spacing of 40cm. Pollen was collected from open male parent flowers on the day of pollination. Two days before flowering, female parent flower buds were emasculated and immediately covered with paper. The next day, between 8-10 am, the collected male parent pollen was lightly, evenly, and in sufficient quantity applied to the stigma of the emasculated flower buds for hybridization. Five hybrid flowers were retained per inflorescence, and 15 hybrid flowers were retained per plant. After pollination, all unemasculated flowers and buds of the female parent were removed, along with any excess axillary buds.
[0047] All F1 generation fruits exhibited striped skin, indicating that striped skin is a dominant trait in tomatoes. After self-pollination of the F1 plants, F2 segregating populations were obtained. Genetic analysis of the striped skin phenotype in individual plants of the F2 segregating population revealed that F2 fruits showed only two types: green stripes on the skin and no stripes. Furthermore, among the 208 valid F2 generation plants harvested in 2024, the ratio of green stripes to no stripes on the tomato skin was 159:49, consistent with Mendel's 3:1 inheritance pattern. In conclusion, the green stripe trait in tomato skin is controlled by a dominant single gene.
[0048] 2. Preliminary localization of the green stripe gene in tomatoes Extreme pool sequencing analysis (BSA-seq) was employed. From the F2 segregating population, 25 plants each exhibiting the extreme traits of green stripes on the pericarp and no stripes were selected. DNA was extracted (Chengdu Baifit Technology Co., Ltd., DN32) and mixed in equal volumes to construct two gene pools: one for green stripes and one for no stripes. Illumina HiSeq X-ten was used to sequence the pooled DNA and the parental lines (AC and LA0407). The differences in SNPs between the parental resequencing data and the pooled DNA from the striped and no-stripes pericarp were compared. Figure 2 As shown, a locus associated with green stripes was identified on chromosome 10, named DGS .
[0049] 3. Fine mapping of the green stripe gene in tomatoes Based on the BSA-seq results, DGS Eight pairs of polymorphic molecular markers were designed for the initial localization region. These eight pairs of polymorphic primers were used to genotype F2 single plants, ultimately yielding four key recombinant single plants. For example... Figure 3 As shown, by using polymorphic molecular markers combined with genotype and phenotype, the target gene was precisely located to a 91.26 kb region on chromosome 10.
[0050] 4. Development of candidate region Indel markers The molecular marker DGS-F / R within a finely mapped region was used to identify green-striped and non-striped tomato materials. Genotypic analysis was performed on the parents and F2 individual plants from both green-striped and non-striped sections. Genomic DNA from cultivated tomato AC, hairy tomato LA0407, and the aforementioned F2 segregating populations were used as templates for amplification using primer pair DGS-F / R. Primer pair DGS-F / R consists of a forward primer DGS-F and a reverse primer DGS-R. The forward primer DGS-F is: 5′-CTCTATTTTATGCTAACCTCTTAAATGCTTAGAAAATGAC-3′ (SEQ ID NO: 1), and the reverse primer DGS-R is: 5′-GTAGGGTTGATACGAGATGATTGAAATTTTCTTGAAC-3′ (SEQ ID NO: 2). PCR was performed using a 25 μL PCR amplification system: 1 μL DNA template, 1 μL 10 μM DGS-F, 1 μL 10 μM DGS-FR, 12.5 μL 2×Taq Mix, and 9.5 μL ddH2O. The following PCR amplification program was used: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min. The PCR products were detected by 1% agarose gel electrophoresis, with a loading volume of 8 μL. Figure 4 As shown, the genotypes for the green stripe trait are H or L, and the genotypes for all non-striped traits are consistent with the maternal AC, indicating that the DGS-F / R marker co-segregates with the green stripe trait, and the genotype and phenotype results are consistent.
[0051] The PCR products were recovered and sequenced. Sequencing results showed that the cultivated tomato AC was a homozygous tomato with genotype A, containing a DNA molecule with nucleotide sequence SEQ ID NO: 3 but not a DNA molecule with nucleotide sequence SEQ ID NO: 4 in its genome. The hairy tomato LA0407 was a homozygous tomato with genotype L, containing a DNA molecule with nucleotide sequence SEQ ID NO: 4 but not a DNA molecule with nucleotide sequence SEQ ID NO: 3 in its genome. The F2 segregating population contained DNA molecules with sequences 3 and / or 4.
[0052] The specific sequence of sequence 3 (SEQ ID NO: 3, 374bp) is as follows: 5′-CTCTATTTTATGCTAACCTCTTAAATGCTTAGAAAATGACTCAATAGAGGGTAATTTTGAAACTTTAATTTGAGTTTTTAAGATTCAAGTTTTCATTTAAAAAACAACAATAGCTTATTAACTTTATATACTTTTTTCCCTTTTGTCTCAAATAATATCTACATAAAATACGCATAAACTATATATTATTATTATTATTATTATTATTATTATTTATGGTAGTATAGAAATATACATTCTAAAATGAAAATACAAATATCAATAATAAATAAATTAAAAACATTGAAATTATAGAACCAACCTTTTAAATAGTAAAAAATATACTATATTTTATTTTGTTCAAGAAAATTTCAATCATCTCGTATCAACCCTAC-3′。
[0053] The specific sequence of Sequence 4 (SEQ ID NO: 4, 671 bp) in the sequence list is as follows: 5′--3′.
[0054] Example 2: Method for increasing the soluble solids content of tomato fruit 1. Increase the soluble solids content of fruits in offspring of red-fruited tomato varieties using AC as the female parent. Cultivated tomato AC was used as the female parent and hairy tomato LA0407 as the male parent to cross and obtain the F1 generation. Then, cultivated tomato AC was used as the recurrent parent (as the female parent) and the F1 generation was used as the male parent to cross (backcross) to obtain the BC1F1 generation with genotype H. A single plant of the BC1F1 generation was used as the male parent and cultivated tomato AC was used as the female parent to cross (backcross) to obtain the BC2F1 generation. A single plant of genotype H in the BC2F1 generation was selected as the male parent and cultivated tomato AC was used as the female parent to cross (backcross) to obtain the BC3F1 generation. A single plant of genotype H in the BC3F1 generation was selected as the male parent and cultivated tomato AC was used as the female parent to cross (backcross) to obtain the BC4F1 generation. A single plant of genotype H in the BC4F1 generation was selected for self-pollination to obtain the BC4F2 generation. Single plants with genotype L and genotype A were selected from BC4F2 and cultivated under the same conditions until fruit set. From the fruit set period to the maturity period, the presence of green stripes on the fruit peel was tested, and the soluble solids content of the fruit was tested 55 days after pollination (when the fruit was fully ripe).
[0055] The hybridization and backcrossing methods are as follows: Tomatoes are sown in a greenhouse with a parent-to-parent ratio of 1:4. The male parent is sown 12 days earlier than the female parent, and the seedlings are about 30 days old. Transplanting is done when the seedlings reach 3 leaves and 1 heart. Both parents are transplanted with a row spacing of 90cm and a plant spacing of 40cm. Pollen from the open male parent flowers is collected on the day of pollination for later use. Two days before flowering, the female parent flower buds are emasculated and immediately covered with paper. The next day, between 8-10 am, the collected male parent pollen is lightly, evenly, and in sufficient quantity applied to the stigma of the emasculated flower buds for hybridization. Five hybrid flowers are retained per inflorescence, and 15 hybrid flowers are retained per plant. After pollination, all unemasculated flowers and buds of the female parent are removed, along with any excess axillary buds.
[0056] The method for detecting soluble solids (SSC) in tomatoes was based on NY / T 2637-2014, employing the refractometer method with a PAL-1 digital refractometer as the measuring instrument. First, each whole tomato sample was cut into pieces and blended into a homogenate using a high-speed blender. The homogenate was then filtered through cheesecloth and squeezed into a beaker. Before measurement, the refractometer was calibrated with distilled water to ensure optimal operating conditions. Simultaneously, to avoid residual moisture affecting the measurement results, any residual moisture on the measuring area of the refractometer was carefully blotted dry with a paper towel. When measuring tomato SSC, the tomato juice was first thoroughly shaken and stirred to ensure homogeneity. Then, an appropriate amount of tomato juice was dropped onto the PAL-1 digital refractometer. To ensure the accuracy of the measurement data, the refractometer was recalibrated after every five samples. Furthermore, to further reduce error, ten samples were tested from each plant, and the SSC value of each sample was measured three times.
[0057] Among them, tomatoes with genotype A were PCRed using their genomic DNA as a template and primer pair DGS-F / R. The PCR products were recovered and sequenced, and all were tomatoes with a length of 374 bp. The nucleotide sequence of the PCR product with a length of 374 bp is shown in SEQ ID NO: 3.
[0058] Tomatoes with genotype L were used as templates for PCR with primer pair DGS-F / R. The PCR products were recovered and sequenced, and all were 671 bp tomatoes. The nucleotide sequence of the 671 bp PCR product is shown in SEQ ID NO: 4.
[0059] Tomatoes with genotype H were used with their genomic DNA as a template and the above-mentioned PCR was performed using primer pair DGS-F / R. The PCR products were recovered and sequenced, and their lengths were 374 bp and 671 bp, respectively. The nucleotide sequence of the PCR product with a length of 374 bp is shown in SEQ ID NO: 3, and the nucleotide sequence of the PCR product with a length of 671 bp is shown in SEQ ID NO: 4.
[0060] Plants with all PCR amplification products of 374 bp are classified as genotype A, plants with all PCR amplification products of 671 bp are classified as genotype L, and plants with both 671 bp and 374 bp amplification products are classified as genotype H.
[0061] All PCR reactions used a 25 μL PCR amplification system: 1 μL DNA template, 1 μL 10 μM DGS-F, 1 μL 10 μM DGS-FR, 12.5 μL 2×Taq Mix, and 9.5 μL ddH2O. The following PCR amplification program was used: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 15 s, 55℃ annealing for 15 s, 72℃ extension for 1 min, 35 cycles; 72℃ extension for 5 min. The PCR products were detected by 1% agarose gel electrophoresis, with a loading volume of 8 μL.
[0062] The results showed that 30 BC4F2 individual plants with genotype L (corresponding to Figure 5 The fruit of the species with stripes has green stripes on its peel before it is fully ripe (including the fruit setting period, fruit enlargement period, green ripening period, color change period, and the ripening period before the fruit is fully ripe). During the ripening period, these green stripes turn into yellow stripes (sugar lines). The average soluble solids content (soluble sugar content) is 6.24 ± 1.01%. o Brix, 30 BC4F2 individuals with genotype A (corresponding to...) Figure 5The fruit of the variety without stripes (those exhibiting this characteristic) does not have green stripes on its peel before full ripening (including the fruit setting period, fruit enlargement period, green ripening period, color change period, and the ripening period before full ripening) and during the red ripening period. The average soluble solids content (soluble sugar content) is 5.66 ± 0.62%. o Brix. The soluble solids content (soluble sugar content) of BC4F2 plants with genotype L was significantly higher than that of BC4F2 plants with genotype A.
[0063] Table 1. Amplification results and traits of self-pollinated materials from BC4F2 generation ( Figure 5 )
[0064] like Figure 5 The soluble solids content of the improved cultivated tomato fruit with green stripes (striped) of genotype L, shown in the middle right figure, was significantly higher than that of the control without stripes.
[0065] Table 2 Genotypes and traits of individual plants from the BC4F2 generation ( Figure 5 )
[0066] Note: Different letters indicate that the soluble solids content of tomatoes with genotype A and tomatoes with genotype L is significantly different at the 0.05 level.
[0067] 2. Increase the soluble solids content of offspring fruits of the brown-colored tomato T843 as the female parent. Following the method described in section 1, BC4F2 generation single plants were obtained using tomato T843 as the female parent and hairy tomato LA0407 as the male parent. Genotype and soluble solids content were then analyzed, and the results are shown in Table 3. Figure 6 As shown. The results indicate that 30 BC4F2 individual plants with genotype L (corresponding to Figure 6 The fruit of the species with stripes exhibits green stripes on its peel before full ripening (including the fruit setting period, fruit enlargement period, green ripening period, color change period, and the ripening period before full ripening) and during the red ripening period. The soluble solids content (soluble sugar content) is 6.65 ± 0.87%. o Brix, 30 BC4F2 individuals with genotype A (corresponding to...) Figure 6 The fruit of the variety without stripes (in this case, the peel of which has no green stripes) does not have green stripes before the fruit is fully ripe (including the fruit setting period, expansion period, green ripening period, color changing period, and the ripening period before the fruit is fully ripe) and during the ripening period. The soluble solids content (soluble sugar content) is 6.10±0.99. oBrix. The soluble solids content (soluble sugar content) of BC4F2 plants with genotype L was significantly higher than that of BC4F2 plants with genotype A.
[0068] Table 3. Amplification results and traits of self-pollinated materials from BC4F2 generation ( Figure 6 )
[0069] Table 4 Genotypes and traits of individual plants from the BC4F2 generation ( Figure 6 )
[0070] Note: Different letters indicate that the soluble solids content of tomatoes with genotype A and tomatoes with genotype L is significantly different at the 0.05 level.
[0071] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.
Claims
1. Specific primers for identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit, characterized in that: The specific primers are primer pair DGS-F / R, which consists of DGS-F and DGS-R. DGS-F is a single-stranded DNA with the nucleotide sequence SEQ ID NO: 1, and DGS-R is a single-stranded DNA with the nucleotide sequence SEQ ID NO:
2.
2. A reagent or kit for identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit, characterized in that: The reagent or kit includes the specific primers as described in claim 1.
3. The application of the specific primers described in claim 1 in identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit.
4. The application of the reagent or kit according to claim 2 in identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit.
5. The application of the specific primers described in claim 1 in tomato breeding.
6. The application of the reagent or kit according to claim 2 in tomato breeding.
7. A method for identifying or assisting in the identification of whether tomato peel has green stripes and / or the soluble solids content of tomato fruit, characterized in that: The method includes using the genomic DNA of the tomato to be tested as a template, performing PCR amplification with the specific primers described in claim 1 to obtain PCR products, and identifying whether the tomato peel has green stripes and / or the soluble solids content of the tomato fruit based on the size and / or sequence of the PCR products.
8. A breeding method for tomatoes with green stripes on the peel, characterized by: The method includes hybridizing tomato A with tomato L to obtain F1 generation tomatoes; continuously backcrossing the F1 generation tomatoes with tomato A to obtain BC4F1 generation tomatoes; selecting individual plants with genotype H from the BC4F1 generation tomatoes for self-pollination to obtain BC4F2 generation tomatoes; selecting individual plants with genotype L or H from the BC4F2 generation tomatoes, wherein the individual plant is a tomato with green stripes on its peel; wherein tomato L is a tomato whose genome contains a DNA molecule with nucleotide sequence SEQ ID NO: 4 but does not contain a DNA molecule with nucleotide sequence SEQ ID NO: 3; wherein tomato A is a tomato whose genome contains a DNA molecule with nucleotide sequence SEQ ID NO: 3 but does not contain a DNA molecule with nucleotide sequence SEQ ID NO:
4.
9. The method according to claim 8, characterized in that, The continuous backcrossing includes: selecting a single plant with genotype H from the BC1F1 generation tomatoes and backcrossing it with tomato A to obtain the BC2F1 generation tomatoes; selecting a single plant with genotype H from the BC2F1 generation tomatoes and backcrossing it with tomato A to obtain the BC3F1 generation tomatoes; and selecting a single plant with genotype H from the BC3F1 generation tomatoes and backcrossing it with tomato A to obtain the BC4F1 generation tomatoes.