XYLT1 gene molecular marker related to oblique length character of pigeon body and application of XYLT1 gene molecular marker

Abstract

The invention relates to an XYLT1 gene molecular marker related to the oblique length character of a pigeon body and application of the XYLT1 gene molecular marker, and belongs to the technical field of biology. According to the XYLT1 gene molecular marker related to the oblique length character of the pigeon body, the nucleotide sequences of SNP primers corresponding to the molecular marker are shown as SEQ ID NO: 1 and SEQ ID NO: 2, the SNP site is located at the 3061562nd basic group of the No.15 chromosome of the pigeon reference genome ClivNAU1.0 version, and the basic group is mutated into C or T. The invention further discloses the application of the XYLT1 gene molecular marker related to the oblique length character of the pigeon body and the application of the XYLT1 gene molecular marker related to the oblique length character of the pigeon body. According to the method, T / T and C / T genotype individuals are eliminated, C / C genotype individuals are reserved, and pigeons with relatively long and uniform oblique lengths of breeding bodies are bred, or C / C and C / T genotype individuals are eliminated, T / T genotype individuals are reserved, and pigeons with relatively short and uniform oblique lengths of breeding bodies are bred. The method can be used for efficiently and quickly identifying the oblique length character of the pigeon body, improving the uniformity of the size character of a pigeon group and providing a scientific basis for early breeding of pigeons.

Description

Technical Field

[0001] The present invention relates to an XYLT1 gene molecular marker related to the body slant length trait of pigeons and its application, belonging to the field of biotechnology. Background Art

[0002] Body weight and body size are key indicators of the growth and development of livestock and poultry. They can not only reflect the health and nutritional status of individuals, but also directly measure production performance. Among them, body weight is an important parameter for evaluating muscle, fat deposition and overall growth and development, while body size can further reflect bone development and body shape structure. Traditional breeding methods are difficult to meet the needs of modern breeding due to long generation intervals and slow effects. Molecular marker-assisted selection technology can significantly shorten the generation interval through early selection and accelerate the breeding process. However, the genetic mechanisms of the main economic traits of pigeons are still unclear at present. Revealing the genetic effects of genes related to body slant length traits has important theoretical and practical significance for promoting pigeon genetic improvement, molecular breeding and germplasm resource protection. Summary of the Invention

[0003] The purpose of the present invention is to propose an XYLT1 gene molecular marker related to the body slant length trait of pigeons and its application to improve the breeding efficiency of pigeons in view of the defects existing in the prior art.

[0004] XYLT1 (Xylosyltransferase I) is a gene in the xylosyltransferase family. The xylosyltransferase family can be divided into 5 distinct independent branches, so they are respectively named 5 subfamilies, namely I, II, III, IV and V. In the human body, xylose is not digested and absorbed, and it can activate Bifidobacterium in the human intestine, with the effect of reducing serum cholesterol; when xylose is ingested simultaneously with calcium, it can improve the human body's ability to absorb calcium. Through retrospective analysis of previous studies, it is summarized and proved that mutations in XYLT1 and XYLT2 will affect the development of bones, cartilage, eyes, ears, heart and skin. And XYLT1 plays an important role in the process of bone development. Mutations in this gene may lead to bone abnormalities, joint laxity and osteoporosis.

[0005] The present invention records the body slant length trait of pigeons, uses whole-genome resequencing technology for SNP genotyping, and screens out the XYLT1 gene molecular marker significantly related to the body slant length trait of pigeons through genome-wide association analysis, providing new gene and molecular marker resources for the breeding of pigeon body slant length traits.

[0006] The present invention solves the technical problems through the following technical solutions: First, a pair of XYLT1 gene molecular marker primers related to the body diagonal length of pigeons is provided. The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO:1 and SEQ ID NO:2. The molecular marker is located at the 3,061,562nd base of chromosome 15 of the pigeon reference genome Cliv_NAU_1.0 version (National Genomics Data Center, https: / / ngdc.cncb.ac.cn / gwh, accession number: GWHFCQQ00000000.1), and the base mutation is C or T. The molecular marker is located at the 161st base shown in SEQ ID NO:3 or SEQ ID NO:4.

[0007] The present invention further provides the application of the above-mentioned molecular marker primers for detecting SNP genotypes related to the body diagonal length trait of pigeons. The detection method includes the following steps: Step 1: Provide a DNA sample of the pigeon to be tested, perform PCR amplification with the molecular marker primer pair to obtain an amplification product. The length of the amplification product is 402bp, containing the 3,061,562nd base of chromosome 15 of the pigeon. Step 2: Perform Sanger sequencing on the PCR product. Step 3: Determine the SNP molecular marker genotype of the 3,061,562nd base of chromosome 15 according to the sequencing peak map.

[0008] The deoxyribonucleotide sequences of the molecular marker primer pair in the first step are as follows: Forward primer: 5’- TGCATTGGTCACCGTAACAG-3’ (SEQ ID NO:1) Reverse primer: 5’- TGCTACTGTGGACAACTGCA-3’ (SEQ ID NO:2) Taking 50 μl as the reaction system, the system is DNA of the pigeon to be tested 50 ng Accurate Taq DNA polymerase 1.25 IU 10X PCR reaction buffer containing Mg2+ 5μl 10mM dNTPs 1μl 10μM forward primer F 1μl 10μM reverse primer R 1μl Sterile water Make up to 50μl.

[0009] The reaction conditions for PCR amplification were pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; storage at 4°C; the nucleotide sequence of the amplification product was as shown in SEQ ID NO:3 or SEQ ID NO:4, the length of the amplification product was 402 bp, and it contained the base at position 3061562 on chromosome 15 of pigeons.

[0010] In the third step described above, the judgment criterion was that the body diagonal length of pigeons with the C / C genotype at the SNP locus was higher than that of individuals with the C / T genotype, and the body diagonal length of individuals with the C / T genotype was higher than that of individuals with the T / T genotype.

[0011] The present invention detected the genotype of the body diagonal length trait of pigeons through the XYLT1 gene molecular marker, and obtained that the body diagonal length of pigeons with the C / C genotype was higher than that of individuals with the C / T genotype and the T / T genotype, and the body diagonal length of pigeons with the C / T genotype was higher than that of individuals with the T / T genotype. By using the genomic DNA of the pigeon to be tested as a template, specific primers were used for PCR amplification, and then the PCR amplification product was subjected to Sanger sequencing and SNP molecular marker genotyping. Based on the genotype of this SNP molecular marker, the selection of the body diagonal length trait of pigeons can be realized. For example, in breeding, if it is necessary to breed a meat pigeon variety with a longer body diagonal length, individuals with the T / T and C / T genotypes can be eliminated, and individuals with the C / C genotype can be retained. The beneficial effect is that early selection of the body diagonal length trait of pigeons can be realized, the accuracy of seed selection can be improved, the breeding progress can be accelerated, the breeding cost can be saved, the breeding efficiency can be improved, and better service can be provided for pigeon breeding. Brief Description of the Drawings

[0012] Figure 1 is the result of the genome-wide association analysis of the body diagonal length trait of pigeons.

[0013] Figure 2 is the Sanger sequencing result of the PCR amplification products of the three genotypes. Detailed Embodiments

[0014] In the following examples, the pigeon breeds used were all commercially available and will not be elaborated.

[0015] Example 1 In this example, the body diagonal lengths of 150-week-old Danish Silver King pigeons, Taishen pigeons, and American Silver King pigeons were measured. Genome-wide SNP genotyping was performed using the second-generation sequencing technology, and the relevant XYLT1 gene molecular markers were screened through genome-wide association analysis. The results were as Figure 1 shown.

[0016] In this example, the following experiments were carried out to identify and apply the XYLT1 gene molecular marker related to the body diagonal length trait of pigeons Phenotypic determination and genotypic detection (1)Experimental materials and determination of body diagonal length phenotype Select 389 pairs of breeding pigeons, including Danish Silver King pigeons, Taishen pigeons, and American Silver King pigeons. The numbers of the three breeds are close. Raise them under the same feeding conditions, with free access to food and water throughout the process. When the breeding pigeons reach 150 weeks of age and finish laying eggs, fast them for 12 hours and then record the body measurements of each pigeon as the phenotypic data of the body diagonal length of the pigeons.

[0017] (2)Genomic DNA extraction Collect blood from the wing veins of the above pigeons, store it in EDTA anticoagulant, and extract genomic DNA using an Omiga brand blood extraction kit.

[0018] (3)PCR amplification Using the extracted genomic DNA as a template, amplify the fragment containing the base site at position 3061562 on chromosome 15.

[0019] Forward primer: 5’- TGCATTGGTCACCGTAACAG-3’ (SEQ ID NO:1) Reverse primer: 5’- TGCTACTGTGGACAACTGCA-3’ (SEQ ID NO:2) The reaction system is as follows DNA of the pigeon to be tested 50 ng Accurate Taq DNA polymerase 1.25 IU 10X PCR reaction buffer (containing Mg2+) 5 μl 10 mM dNTPs 1 μl 10 μM forward primer F 1 μl 10 μM reverse primer R 1 μl Sterile water Make up to 50 μl.

[0020] The reaction conditions for the above PCR amplification are: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, for a total of 27 cycles; extension at 72°C for 5 min; store at 4°C. The amplified product sequence is as shown in SEQ ID NO:3 TGCATTGGTCACCGTAACAGTAAAGAGAAAACGTCTGCATTGCATAGGAGTTTTTTCCCCATTTTCAAAAGGGACCCAGGATGTTCTCTCAGCTACTTTCGATAGAATCAGACAAAGTTCCTTTTCAAAAATGGACCCGTCTAAATCTGCCAGAGTTTACCGGAATTTCTGATTTCTGTTCTGGGAGAAATGTCAATTTGAATGCTTATGTTCAGCCCAAATCGTTTGAAAAGGCTGAAAAATAATGTGTTGGGTTTTGGGGGTTTGTTTGTTTATCCTAACGGAACACACTTTGAAAAATAGGTTTGGAAATAACACTATTTACCATTTGAGCAATTTTTTAAAAAGGAAATTAGTCTTTTAAGTTAGCTCAGTATGCAAATGCAGTTGTCCACAGTAGCA or SEQ ID NO:4 TGCATTGGTCACCGTAACAGTAAAGAGAAAACGTCTGCATTGCATAGGAGTTTTTTCCCCATTTTCAAAAGGGACCCAGGATGTTCTCTCAGCTACTTTCGATAGAATCAGACAAAGTTCCTTTTCAAAAATGGACCCGTCTAAATCTGCCAGAGTTTACTGGAATTTCTGATTTCTGTTCTGGGAGAAATGTCAATTTGAATGCTTATGTTCAGCCCAAATCGTTTGAAAAGGCTGAAAAATAATGTGTTGGGTTTTGGGGGTTTGTTTGTTTATCCTAACGGAACACACTTTGAAAAATAGGTTTGGAAATAACACTATTTACCATTTGAGCAATTTTTTAAAAAGGAAATTAGTCTTTTAAGTTAGCTCAGTATGCAAATGCAGTTGTCCACAGTAGCA as shown

[0021] (4)Sanger sequencing and genotyping The PCR products of each sample were subjected to Sanger sequencing respectively, and the sequencing chromatograms were as Figure 2 shown, and the genotyping data of the SNP molecular marker at position 3,061,562 on chromosome 15 of the pigeon reference genome Cliv_NAU_1.0 version were obtained.

[0022] 2. Correlation Analysis A total of 389 pairs of pigeons with clear phenotypic records of body diagonal length at 150 weeks of age were selected for correlation analysis. The ANOVA test function of GraphPad Prism9 statistical software was used for statistical testing. The average value comparison mode between pairs was selected to statistically analyze the genotypes and body diagonal length traits of the experimental pigeon population. P<0.05 indicates a significant difference. The results showed that there were significant differences in the body diagonal length among the three genotypes of pigeons (P<0.05). The average body diagonal length of pigeons with the C / C genotype was 12.60 cm, which was higher than that of pigeons with the C / T genotype (12.29 cm, P>0.05), and significantly higher than that of pigeons with the T / T genotype (11.89 cm, P<0.05). The body diagonal length of pigeons with the C / T genotype was significantly higher than that of pigeons with the T / T genotype (P<0.05). The results indicated that the locus at the 3061562nd base of chromosome 15 in the Cliv_NAU_1.0 version of the pigeon reference genome was significantly associated with the phenotypic trait of pigeon body diagonal length. According to the actual breeding goal, individuals with the C / C genotype can be selected to breed pigeons with longer body length, improve the overall body diagonal length and uniformity, and improve the breeding efficiency. The data are shown in Table 1 and Table 2.

[0023] Genotype Number of individuals Body diagonal length at 150 weeks of age / cm CV / % T / T 673 <![CDATA[11.89±0.85 a > 6.1 C / T 62 <![CDATA[12.29±0.90 b > 6.3 C / C 43 <![CDATA[12.60±1.03 b > 7.1 Note: In the same column of data, the same letter superscript indicates no significant difference, and different letter superscripts indicate significant difference (P<0.05).

[0024] Genotype Male / each Body diagonal length at 150 weeks of age / cm Female / each Body diagonal length at 150 weeks of age / cm T / T 330 <![CDATA[11.95±0.87 a > 343 <![CDATA[11.83±0.82 a > C / T 44 <![CDATA[12.30±0.85 b > 18 <![CDATA[12.27±1.02 ab > C / C 21 <![CDATA[12.65±1.12 b > 22 <![CDATA[12.56±0.97 b > Note: In the same column of data, the same letter superscript indicates no significant difference, and different letter superscripts indicate significant difference (P<0.05).

[0025] Example 2 Genotype Frequencies of Different Varieties 1. Blood Sample Collection Blood samples of 8 introduced meat pigeon strains (species) with relatively large body diagonal lengths, such as Danish Silver King, American Silver King, Taishen Pigeon, Yellow Carneau Pigeon, and Grey Feather King Pigeon, 2 local strains (species) with medium body diagonal lengths, namely Shiqi Pigeon and Tarim Pigeon, and 5 ornamental pigeon strains (species) with relatively small body diagonal lengths, such as Fantail Pigeon, Angel Pigeon, Furong Pigeon, Taihu Dotted Pigeon, and Lady Pigeon, were collected using the wing vein blood collection method and stored at -20°C for later use.

[0026] 2. Genomic DNA Extraction Taking the tissue samples obtained in the first step, genomic DNA was extracted using the tissue genomic DNA extraction kit of Omega brand. The specific method was referred to the standard operation procedure provided by Omega brand.

[0027] 3. Genotype Detection Using the genomic DNA obtained in the second step as a template, PCR amplification and Sanger sequencing were performed with a primer pair consisting of the F nucleotide sequence (SEQ ID NO: 1) and the R nucleotide sequence (SEQ ID NO: 2) to obtain the C / C genotype, C / T genotype, and T / T genotype of the individual.

[0028] 4. Result Analysis Danish Silver King, American Silver King, Taishen Pigeon, Grey Feather King Pigeon, European Meat Pigeon, etc. are all relatively mainstream meat pigeon breeds in the breeding market of our country. After certain breeding of their body diagonal length traits, the C allele frequency exists in a certain proportion in the population. Tarim Pigeon is a native breed in Xinjiang, China, with a relatively low breeding level, but there is also a certain proportion of the C allele. While for the two ornamental pigeon breeds, Furong Pigeon and Lady Pigeon, which have not been selected for body diagonal length traits at all and have a relatively small body diagonal length, the C allele frequency in the population is significantly lower, as shown in Table 3. These results can all confirm that this SNP locus can be used as a molecular marker for the selection of pigeon body diagonal length traits.

[0029] Variety Frequency of C allele Frequency of T allele Number of individuals Danish Silver King Pigeon 0.11 0.89 50 Taishen Pigeon 0.02 0.98 50 American Silver King Pigeon 0.15 0.85 50 Yellow Carneau Pigeon 0.08 0.92 11 Grey Feather King Pigeon 0.12 0.88 18 European Meat Pigeon 0.90 0.10 9 White Carneau Pigeon 0.95 0.05 9 Deep King Pigeon 0.90 0.10 9 Shiqi Pigeon 0.11 0.89 36 Tarim Pigeon 0.14 0.86 28 Taihu Spotted Pigeon 0.88 0.13 15 Furong Pigeon 0.00 1.00 15 Lady Pigeon 0.00 1.00 16 Fantail Pigeon 0.23 0.77 10 Angel Pigeon 0.05 0.95 18 。

[0030] In addition to the above embodiments, the present invention may also have other embodiments. All technical solutions formed by equivalent replacement or equivalent transformation fall within the protection scope required by the present invention.

Claims

1. An XYLT1 gene molecular marker related to the body slant length trait of pigeons, characterized in that: The nucleotide sequences of the SNP primers corresponding to the molecular marker are shown in SEQ ID NO:1 and SEQ ID NO:

2. The molecular marker locus is located at the 3,061,562nd base of chromosome 15 of the pigeon reference genome Cliv_NAU_1.0 version, and the base mutation is C or T.

2. Use of the XYLT1 gene molecular marker related to the body slant length trait of pigeons according to claim 1, characterized in that: The SNP primers are used for detecting the body diagonal length trait of pigeons. The detection method includes the following steps. First step: PCR amplify the DNA sample of the pigeon to be tested with the SNP primers shown in SEQ ID NO:1-2 to obtain an amplification product. The length of the amplification product is 402bp, containing the 3,061,562nd base of pigeon chromosome 15. Second step: Perform Sanger sequencing on the PCR product. Third step: Judge the SNP molecular marker genotype containing the 3,061,562nd base of pigeon chromosome 15 according to the sequencing result of the second step.

3. Use of the XYLT1 gene molecular marker related to the body slant length trait of pigeons according to claim 2, characterized in that: The reaction system is calculated based on 50 μl, and the system is DNA of pigeon to be tested 50 ng Accurate Taq DNA polymerase 1.25 IU 10X PCR reaction buffer containing Mg2+ 5 μl 10 mM dNTPs 1 μl 10 μM upstream primer F 1 μl 10 μM downstream primer R 1 μl Sterile water Make up to 50 μl.

4. Use of the XYLT1 gene molecular marker related to the oblique body length trait of pigeons according to claim 3, characterized in that: Pre-denature at 94°C for 5 min; denature at 94°C for 30 sec, anneal at 60°C for 30 sec, extend at 72°C for 60 sec, for a total of 30 cycles; extend at 72°C for 5 min; store at 4°C.

5. Use of the XYLT1 gene molecular marker related to the body slant length trait of pigeons according to claim 3, characterized in that: The nucleotide sequence of the amplification product is shown in SEQ ID NO:3 or SEQ ID NO:

4.

6. Use of the XYLT1 gene molecular marker related to the body slant length trait of pigeons according to claim 2, characterized in that: The judgment criterion in the third step is that the body diagonal length of pigeons with the C / C genotype at the SNP locus is higher than that of individuals with the C / T genotype and the T / T genotype, and the body diagonal length of individuals with the C / T genotype is higher than that of individuals with the T / T genotype.

Images