A molecular marker of the XYLT1 gene associated with the obliquely long trait of pigeons and its application

The XYLT1 gene molecular marker related to the pigeon's oblique body length trait was screened out through whole genome resequencing technology, and the SNP site on pigeon chromosome 15 was detected using PCR and Sanger sequencing. This solved the problem of low efficiency of traditional breeding methods in pigeons' oblique body length trait and achieved early selection and efficient breeding.

CN120272615BActive Publication Date: 2025-09-30NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510781405.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-12
Publication Date
2025-09-30
Estimated Expiration
2045-06-12

AI Technical Summary

Technical Problem

Traditional breeding methods have long generation intervals and slow results in pigeons' obliquely long body traits, which makes it difficult to meet modern breeding needs. In addition, the genetic mechanism of pigeons' main economic traits is unclear, which affects the breeding process and germplasm resource protection.

Method used

The XYLT1 gene molecular marker related to the oblique body length trait of pigeons was screened out through whole genome resequencing technology. Specific primers were used for PCR amplification and Sanger sequencing to detect the genotype of the SNP molecular marker at base 3061562 of chromosome 15 of pigeons, and C/C genotype individuals were provided as breeding objects to improve the oblique body length trait.

Benefits of technology

It realizes early selection and efficient breeding, improves the accuracy and efficiency of breeding, saves breeding costs, and serves the pigeon breeding process.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272615B_ABST
    Figure CN120272615B_ABST
Patent Text Reader

Abstract

The present invention relates to an XYLT1 gene molecular marker associated with the pigeon body plagioclase trait and its application, belonging to the field of biotechnology. The XYLT1 gene molecular marker associated with the pigeon body plagioclase trait comprises a SNP primer whose nucleotide sequences are shown in SEQ ID NO: 1 and SEQ ID NO: 2. The SNP site is located at base 3061562 of chromosome 15 of the pigeon reference genome Cliv_NAU_1.0, and the base mutation is C or T. By eliminating individuals with T / T and C / T genotypes and retaining individuals with C / C genotypes, pigeons with longer and more uniform body plagioclase are selected, or by eliminating individuals with C / C and C / T genotypes and retaining individuals with T / T genotypes, pigeons with shorter and more uniform body plagioclase are selected. The XYLT1 gene molecular marker can efficiently and quickly identify the pigeon body plagioclase trait, improve the uniformity of the pigeon body size trait, and provide a scientific basis for early pigeon breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to an XYLT1 gene molecular marker related to the obliquely long trait of pigeon bodies and application thereof, belonging to the field of biotechnology. Background Art

[0002] Weight and body size are key indicators of livestock and poultry growth and development. They can not only reflect the health and nutritional status of individuals, but also provide an intuitive measure of production performance. Among them, weight is an important parameter for evaluating muscle, fat deposition and overall growth and development, while body size can further reflect bone development and body structure. Traditional breeding methods are difficult to meet modern breeding needs due to their long generation intervals and slow effectiveness. Molecular marker-assisted selection technology can significantly shorten the generation interval through early breeding and accelerate the breeding process. However, the genetic mechanism of the main economic traits of pigeons is still unclear. Revealing the genetic effects of genes related to body oblique length traits has important theoretical and practical significance for promoting pigeon genetic improvement, molecular breeding and germplasm resource protection. Summary of the Invention

[0003] The purpose of the present invention is to address the defects of the existing technology, propose a XYLT1 gene molecular marker related to the pigeon body oblique elongation trait and its application, and improve the pigeon breeding efficiency.

[0004] XYLT1 (Xylosyltransferase I) is a gene in the xylosyltransferase family, which can be divided into five distinct branches, designated as subfamilies I, II, III, IV, and V. Xylose is not digested and absorbed in the human body, but it activates bifidobacteria in the intestine and has the effect of lowering serum cholesterol. Xylose, when taken with calcium, improves calcium absorption. A review of previous studies has demonstrated that mutations in XYLT1 and XYLT2 affect the development of bones, cartilage, eyes, ears, heart, and skin. XYLT1 plays a crucial role in skeletal development, and mutations in this gene may lead to skeletal abnormalities, joint laxity, and osteoporosis.

[0005] The present invention records the body oblique length trait of pigeons, performs SNP genotyping using whole-genome resequencing technology, and obtains the XYLT1 gene molecular marker significantly correlated with the pigeon body oblique length trait through whole-genome association analysis, providing new gene and molecular marker resources for the breeding of pigeons with the body oblique length trait.

[0006] The present invention solves the technical problem through the following technical solution: First, a molecular marker primer for the XYLT1 gene, which is associated with the oblique length of pigeon body, is provided. The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO: 1 and SEQ ID NO: 2. The molecular marker is located at base 3061562 of chromosome 15 of the pigeon reference genome Cliv_NAU_1.0 version (National Genome Science Data Center https: / / ngdc.cncb.ac.cn / gwh, accession number GWHFCQQ00000000.1), and the base is mutated to C or T. The molecular marker is located at base 161 as shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0007] The present invention further provides the use of the above-mentioned molecular marker primers for detecting SNP genotypes related to the plagioclase trait of pigeons. The detection method comprises the following steps:

[0008] The first step is to provide a pigeon DNA sample to be tested, and perform PCR amplification using a molecular marker primer pair to obtain an amplified product. The amplified product is 402 bp in length and contains bases 3061562 of pigeon chromosome 15;

[0009] Step 2: Sanger sequencing of the PCR product;

[0010] The third step is to determine the SNP molecular marker genotype at base 3061562 of chromosome 15 based on the sequencing peak graph.

[0011] The deoxyribonucleotide sequence of the molecular marker primer pair described in the first step is:

[0012] Upstream primer: 5'-TGCATTGGTCACCGTAACAG-3' (SEQ ID NO: 1)

[0013] Downstream primer: 5'-TGCTACTGTGGACAACTGCA-3' (SEQ ID NO: 2)

[0014] The reaction system is based on 50 μl.

[0015] 50 ng of pigeon DNA to be tested

[0016] Accurate Taq DNA Polymerase 1.25 IU

[0017] 5 μl 10X PCR reaction buffer containing Mg2+

[0018] 10mM dNTPs 1μl

[0019] 10 μM upstream primer F 1 μl

[0020] 10μM downstream primer R 1μl

[0021] Make up to 50 μl with sterile water.

[0022] The reaction conditions for the PCR amplification were as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, and extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; and storage at 4°C. The nucleotide sequence of the amplified product was as shown in SEQ ID NO:3 or SEQ ID NO:4. The amplified product was 402 bp in length and contained bases 3061562 of pigeon chromosome 15.

[0023] In the third step, the judgment standard is that the body slant length of pigeons with C / C genotype at the SNP site is longer than that of individuals with C / T genotype, and the body slant length of individuals with C / T genotype is longer than that of individuals with T / T genotype.

[0024] The present invention detects the genotype of pigeon body oblique length trait by XYLT1 gene molecular marker, and draws that the body oblique length of C / C genotype pigeon is higher than that of C / T genotype and T / T genotype individuals, and the body oblique length of C / T genotype pigeon is higher than that of T / T genotype individuals. By taking the genomic DNA of pigeon to be tested as template, adopting specific primers to carry out PCR amplification, then the PCR amplification product is carried out Sanger sequencing and SNP molecular marker genotyping, the genotype based on the SNP molecular marker can realize that pigeon body oblique length trait is selected. For example, in breeding, it is necessary to cultivate meat pigeon varieties with longer body oblique length, and by eliminating T / T and C / T genotype individuals, retaining C / C genotype individual, its beneficial effect is that pigeon body oblique length trait can be carried out early selection, improve the accuracy of seed selection, accelerate breeding progress, save breeding cost, improve breeding efficiency, and better serve the breeding of pigeon. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 This is the result of genome-wide association analysis of the oblique elongation trait in pigeons.

[0026] Figure 2 These are the Sanger sequencing results of the PCR amplification products of the three genotypes. DETAILED DESCRIPTION

[0027] The pigeon breeds used in the following examples are all commercially available and will not be described in detail.

[0028] Example 1

[0029] In this example, the body length of three breeds of Danish Silver King pigeon, Thai Deep pigeon and American Silver King pigeon at 150 weeks of age was measured. Whole-genome SNP genotyping was performed using second-generation sequencing technology. The relevant XYLT1 gene molecular markers were screened through whole-genome association analysis. The results are as follows: Figure 1 shown.

[0030] This example uses the following experiments to identify and apply the XYLT1 gene molecular marker related to the pigeon body oblique elongation trait

[0031] Phenotyping and genotyping

[0032] (1) Experimental materials and determination of body length phenotype

[0033] A total of 389 pairs of breeding pigeons were selected, including Danish Silver King Pigeon, Thai Deep Pigeon and American Silver King Pigeon. The three breeds were similar in number and raised under the same feeding conditions with free access to food and water throughout the whole process. When the breeding pigeons were 150 weeks old, the body size of each pigeon was recorded after fasting for 12 hours after laying eggs, which was used as the phenotypic data of pigeon body oblique length.

[0034] (2) Genomic DNA extraction

[0035] Blood was collected from the subwing vein of the above pigeons and stored in EDTA anticoagulant, and genomic DNA was extracted using an Omiga brand blood extraction kit.

[0036] (3) PCR amplification

[0037] The fragment containing the 3061562nd base site of chromosome 15 was amplified using the genomic DNA extracted as a template.

[0038] Upstream primer: 5'-TGCATTGGTCACCGTAACAG-3' (SEQ ID NO: 1)

[0039] Downstream primer: 5'-TGCTACTGTGGACAACTGCA-3' (SEQ ID NO: 2)

[0040] The system is as follows

[0041] 50 ng of pigeon DNA to be tested

[0042] Accurate Taq DNA Polymerase 1.25 IU

[0043] 10X PCR reaction buffer (containing Mg2+) 5μl

[0044] 10mM dNTPs 1μl

[0045] 10 μM upstream primer F 1 μl

[0046] 10μM downstream primer R 1μl

[0047] Make up to 50 μl with sterile water.

[0048] The reaction conditions for the PCR amplification are: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 60 sec, for a total of 27 cycles; 72°C extension for 5 min; and storage at 4°C. The sequence of the amplified product is shown in SEQ ID NO: 3

[0049] TGCATTGGTCACCGTAACAGTAAAGAGAAAACGTCTGCATTGCATAGGAGTTTTTCCCCATTTTCAAAAGGGACCCAGGATGTTCTCAGCTACTTTCGATAGAATCAGACAAAGTTCCTTTTCAAAAATGGACCCGTCTAAATCTGCCAGAGTTTACCGGAATTTCTGATTTCTGTTCTGGGAGAAATGTCAATTTGAAT GCTTATGTTCAGCCCAAATCGTTTGAAAAGGCTGAAAAATAATGTGTTGGGTTTTGGGGGTTTGTTTGTTTATCCTAACGGAACACACTTTGAAAAATAGGTTTGGAAATAACACTATTTACCATTTGAGCAATTTTTTAAAAAGGAAATTAGTCTTTTAAGTTAGCTCAGTATGCAAATGCAGTTGTCCACAGTAGCA or SEQ ID NO:4

[0050] TGCATTGGTCACCGTAACAGTAAAGAGAAAACGTCTGCATTGCATAGGAGTTTTTCCCCATTTTCAAAAGGGACCCAGGATGTTCTCAGCTACTTTCGATAGAATCAGACAAAGTTCCTTTTCAAAAATGGACCCGTCTAAATCTGCCAGAGTTTACTGGAATTTCTGATTTCTGTTCTGGGAGAAATGTCAATTTGA ATGCTTATGTTCAGCCCAAATCGTTTGAAAAGGCTGAAAAATAATGTGTTGGGTTTTGGGGGTTTGTTTGTTTATCCTAACGGAACACACTTTGAAAAATAGGTTTGGAAATAACACTATTTACCATTTGAGCAATTTTTTAAAAAGGAAATTAGTCTTTTAAGTTAGCTCAGTATGCAAATGCAGTTGTCCACAGTAGCA

[0051] shown.

[0052] (4) Sanger sequencing and genotyping

[0053] The PCR products of each sample were subjected to Sanger sequencing, and the sequencing peak diagram was as follows: Figure 2 As shown, the genotyping data of the SNP molecular marker at base position 3061562 of chromosome 15 of the pigeon reference genome Cliv_NAU_1.0 version were obtained.

[0054] 2. Correlation Analysis

[0055] Correlation analysis was conducted on 389 pairs of 150-week-old pigeons with clear body skew length phenotypes. Statistical analysis was performed using the ANOVA function in GraphPad Prism 9 statistical software, using a pairwise mean comparison model to analyze the genotypes and body skew length traits of the experimental pigeon population. P < 0.05 indicated significant differences. The results showed significant differences in body skew length among the three genotypes (P < 0.05). The average body skew length of pigeons with the C / C genotype was 12.60 cm, higher than that of the C / T genotype (12.29 cm) (P > 0.05) and significantly higher than that of the T / T genotype (11.89 cm) (P < 0.05). Pigeons with the C / T genotype had significantly higher body skew length than those with the T / T genotype (P < 0.05). The results showed that the locus at base 3061562 on chromosome 15 of the pigeon reference genome, Cliv_NAU_1.0, was significantly associated with the pigeon body length phenotype. Based on actual breeding goals, individuals with the C / C genotype can be selected to breed pigeons with longer body lengths, thereby improving overall body length and uniformity, and enhancing breeding efficiency. The data are shown in Tables 1 and 2.

[0056] genotype Number of individuals Body oblique length at 150 weeks of age / cm CV / % T / T 673 <![CDATA[11.89±0.85 a ]]> 6.1 C / T 62 <![CDATA[12.29±0.90 b ]]> 6.3 C / C 43 <![CDATA[12.60±1.03 b ]]> 7.1 Note: Data in the same column with the same letters indicate no significant difference, while data with different letters indicate significant difference (P<0.05).

[0057] genotype Male / only Body oblique length at 150 weeks of age / cm Female Body oblique length at 150 weeks of age / cm T / T 330 <![CDATA[11.95±0.87 a ]]> 343 <![CDATA[11.83±0.82 a ]]> C / T 44 <![CDATA[12.30±0.85 b ]]> 18 <![CDATA[12.27±1.02 ab ]]> C / C 21 <![CDATA[12.65±1.12 b ]]> 22 <![CDATA[12.56±0.97 b ]]> Note: Data in the same column with the same letters indicate no significant difference, while data with different letters indicate significant difference (P<0.05).

[0058] Example 2

[0059] Genotype frequencies of different varieties

[0060] 1. Blood Sample Collection

[0061] Blood samples were collected using the subwing vein blood collection method from eight introduced meat pigeon strains (species) with larger body oblique length, including Danish Silver King, American Silver King, Thai Deep Pigeon, Yellow Cardinal Pigeon, and Gray Feather King Pigeon; two local strains (species) with medium body oblique length, Shiqi Pigeon and Tarim Pigeon; and five ornamental pigeon strains (species) with smaller body oblique length, including Fantail Pigeon, Angel Pigeon, Hibiscus Pigeon, Taihu Dove Pigeon, and Lady Pigeon. The samples were then stored at -20℃ for future use.

[0062] 2. Extraction of Genomic DNA

[0063] Take the tissue sample obtained in step 1 and use the Omega brand tissue genomic DNA extraction kit to extract genomic DNA. The specific method refers to the standard operating procedure provided by the Omega brand.

[0064] 3. Genotype detection

[0065] Using the genomic DNA obtained in step 2 as a template, PCR amplification and Sanger sequencing were performed using a primer pair consisting of the F nucleotide sequence (SEQ ID NO: 1) and the R nucleotide sequence (SEQ ID NO: 2) to obtain the individual's C / C genotype, C / T genotype, and T / T genotype.

[0066] 4. Results Analysis

[0067] The Danish Silver King, American Silver King, Thai Deep, Gray King, and European meat pigeons are all popular meat pigeon breeds in my country. After undergoing selective breeding for the body skewness trait, the C allele frequency is present in a certain proportion of their populations. The Tarim pigeon, a native breed of Xinjiang, my country, has undergone relatively low levels of selective breeding, but it also harbors a certain proportion of the C allele. However, the Furong and Lady pigeons, two ornamental pigeon breeds, have not undergone any selective breeding for body skewness and are relatively small in length, and thus have a significantly lower C allele frequency in their populations (see Table 3). These results confirm that this SNP locus can serve as a molecular marker for selective breeding for body skewness in pigeons.

[0068] variety C allele frequency T allele frequency Number of individuals Danish Silver King Pigeon 0.11 0.89 50 Thai Deep Pigeon 0.02 0.98 50 American Silver King Pigeon 0.15 0.85 50 Yellow Cardinal Pigeon 0.08 0.92 11 Gray King Pigeon 0.12 0.88 18 European pigeon 0.90 0.10 9 White Canu pigeon 0.95 0.05 9 Deep King Pigeon 0.90 0.10 9 Shiqi Pigeon 0.11 0.89 36 Tarim pigeon 0.14 0.86 28 Taihu Point Pigeon 0.88 0.13 15 Hibiscus Pigeon 0.00 1.00 15 Lady Pigeon 0.00 1.00 16 fantail pigeon 0.23 0.77 10 Angel Pigeon 0.05 0.95 18

[0069] In addition to the above embodiments, the present invention may also have other implementations. Any technical solution formed by equivalent replacement or equivalent transformation falls within the scope of protection required by the present invention.

Claims

1. A SNP primer for the XYLT1 gene molecular marker associated with the oblique elongation trait of pigeons, characterized by: The nucleotide sequences of the SNP primers are shown in SEQ ID NO: 1 and SEQ ID NO:

2. The molecular marker site is located at base 3061562 of chromosome 15 of the pigeon reference genome Cliv_NAU_1.0 version, and the base mutation is C or T.

2. The use of SNP primers for the XYLT1 gene molecular marker associated with the pigeon body oblique elongation trait according to claim 1, characterized in that: The SNP primers are used to detect the body lengthening trait of 150-week-old pigeons. The detection method comprises the following steps: The first step is to perform PCR amplification on the pigeon DNA sample to be tested using the SNP primers shown in SEQ ID NO: 1-2 to obtain an amplified product. The amplified product is 402 bp in length and contains bases 3061562 of pigeon chromosome 15; Step 2: Sanger sequencing of the PCR product; The third step is to determine the genotype of the SNP molecular marker at base 3061562 of chromosome 15 of pigeon based on the sequencing results of the second step.

3. The use of SNP primers for the XYLT1 gene molecular marker associated with the pigeon body oblique elongation trait according to claim 2, characterized in that: The reaction system is 50 μl. 50 ng of pigeon DNA to be tested Accurate Taq DNA Polymerase 1.25 IU 5 μl 10X PCR reaction buffer containing Mg2+ 10mM dNTPs 1μl 10 μM upstream primer F 1 μl 10μM downstream primer R 1μl Make up to 50 μl with sterile water.

4. The use of SNP primers for the XYLT1 gene molecular marker associated with the pigeon body oblique elongation trait according to claim 3, characterized in that: Pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 60 sec, for a total of 30 cycles; extension at 72°C for 5 min; storage at 4°C.

5. The use of SNP primers of the XYLT1 gene molecular marker associated with the pigeon body oblique elongation trait according to claim 3, characterized in that: The nucleotide sequence of the amplified product is shown in SEQ ID NO: 3 or SEQ ID NO:

4.

6. The use of SNP primers for the XYLT1 gene molecular marker associated with the pigeon body oblique elongation trait according to claim 2, characterized in that: The judgment criterion of the third step is that the body slant length of pigeons with the C / C genotype at the SNP site is longer than that of individuals with the C / T genotype and T / T genotype, and the body slant length of individuals with the C / T genotype is longer than that of individuals with the T / T genotype.