Primer group for targeted simultaneous detection of multiple bacterial pathogens based on multiple amplicons and application of primer group

By designing the primer set for multiple amplicon-targeted detection and the MGI sequencing platform MGISEQ-200, the accurate detection problem of mixed infections of multiple bacterial pathogens in herbivores is solved, and rapid, efficient and specific pathogen detection is achieved.

CN120272623AActive Publication Date: 2025-07-08CHINA AGRI UNIV

Patent Information

Application Number
CN202510453338.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-11
Publication Date
2025-07-08
Estimated Expiration
2045-04-11

AI Technical Summary

Technical Problem

The existing pathogen detection methods have mixed infections with small flux and difficulty in accurately distinguishing and identifying multiple bacterial pathogens in herbivores, which are prone to missed detection and missed detection, resulting in delays in treatment.

Method used

A primer set based on multiple amplicon targeted detection was designed, multiple target genes and multiple pairs of primers were designed for 59 common bacterial pathogens in herbivorous animals. Combined with the MGI sequencing platform MGISEQ-200 for detection, and through multiple PCR and sequencing analysis, the rapid, efficient and specific detection of multiple pathogens was achieved.

Benefits of technology

It realizes rapid detection of a variety of herbivorous bacterial pathogens, improves the accuracy and reliability of detection, reduces missed and missed detection in mixed infections, and is suitable for complex samples and low-concentration pathogens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120272623A_ABST
    Figure CN120272623A_ABST
Patent Text Reader

Abstract

The invention provides a primer group for targeted simultaneous detection of multiple bacterial pathogens based on multiple amplicons and application of the primer group, and belongs to the technical field of biological detection of pathogenic bacteria. The primer group for targeted simultaneous detection of multiple bacterial pathogens based on multiple amplicons provided by the invention consists of 196 pairs of primers, and the nucleotide sequences of the primers are shown as SEQ ID NO: 1-392. By using the primer group provided by the invention, multiple pathogens can be rapidly and efficiently detected at the same time, and the primer group has the technical advantages of high targeting, strong specificity and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of pathogenic bacteria biological detection, and particularly relates to a primer set for simultaneously detecting multiple bacterial pathogens based on multiplex amplicons and its application. Background Art

[0002] The bacterial pathogens causing common symptoms such as mastitis, respiratory tract and digestive tract in herbivores are complex and numerous, and most are mixed or secondary infections of multiple pathogens. Current pathogen detection methods in the veterinary field include etiological and serological detection methods such as PCR, qPCR, ELISA, LFIA, etc. These methods have a relatively low operation threshold, but in practical applications, they have the shortcoming of low throughput. Moreover, due to the certain similarity of these pathogens in gene sequences and biological characteristics, it is difficult to accurately distinguish and identify them using traditional detection methods. For example, pathogens of the genus Bacillus such as Bacillus cereus, Bacillus thuringiensis, and Bacillus licheniformis in the genus Bacillus are similar in morphology and some biochemical characteristics, but their pathogenicity and the types of diseases caused are different. Similarly, Pseudomonas aeruginosa, Pseudomonas fragi, and Pseudomonas fluorescens in the genus Pseudomonas have a certain degree of conservation in gene sequences, but their pathogenic mechanisms and infection sites are different. Therefore, traditional detection methods have obvious limitations in the case of mixed infections of multiple pathogens, and it is easy to have misdetection and missed detection of some pathogens, delaying the best treatment opportunity and causing economic losses.

[0003] Multiplex amplicon technology is an efficient and accurate gene detection technology. This technology designs multiple pairs of specific primers for the conserved sequence regions in genes through specific primer amplification, and through multiplex PCR technology, amplifies the target region and sequences and analyzes the amplification products to deeply study the genetic information characteristics of the specific region. Compared with the metagenomic high-throughput sequencing method, this method currently has extensive applications in human medical clinical diagnosis, treatment guidance, and prognosis evaluation. Its general idea is to perform next-generation sequencing (NGS) on the target region captured by targeting, and obtain the genetic information of the target region through detailed analysis of the sequencing results. In addition, there are also a few studies applying amplicon sequencing to the pathogen detection of animal diseases, but there is still no perfect method for detecting common bacterial pathogens in herbivores. The patent with the application number 202411533424.4 discloses a primer set, kit and its application for high-throughput targeted detection of ruminant pathogens and drug resistance genes. Although its method can also detect multiple related pathogens in one experiment and improve the detection efficiency, its detection sensitivity is relatively low and its practical applicability is poor.

[0004] Therefore, a multiplex amplicon-targeted sequencing panel for common bacterial pathogens of herbivores is provided and applied based on the MGI sequencing platform MGISEQ-200. It can directly analyze various types of samples such as milk samples, nasal swabs, and throat swabs of diseased animals without relying on the culture conditions of pathogens. Targeted sequencing of the target genes of specific pathogens is performed on the total microbial DNA extracted from the samples, thereby achieving simultaneous and rapid detection of multiple pathogens in diseased cattle, and ensuring high sensitivity and specificity. It is suitable for complex samples and low-concentration pathogens, etc., and better meets the market demand. Summary of the Invention

[0005] The object of the present invention is to provide a primer set for simultaneous detection of multiple bacterial pathogens based on multiplex amplicon targeting, which can achieve rapid and efficient detection of multiple pathogens simultaneously, and has technical advantages such as high targeting and strong specificity.

[0006] In order to achieve the above-mentioned invention object, the present invention provides the following technical solutions:

[0007] The present invention provides a primer set for simultaneous detection of multiple bacterial pathogens based on multiplex amplicon targeting. The primer set consists of 196 pairs of primers, and their nucleotide sequences are shown in SEQ ID NO: 1-392.

[0008] The present invention also provides a primer pool constructed based on the primer set described in claim 1. The primer pool is generated by adding specific adapters to 196 pairs of primers.

[0009] Preferably, the adding of specific adapters to 196 pairs of primers specifically means: adding a specific adapter sequence GACATGGCTACGATCCGACTT, with the sequence number SEQ ID NO: 393, to the 5' end of the upstream primer, and adding a specific adapter sequence CGCTTGGCCTCCGACTTGC, with the sequence number SEQ ID NO: 394, to the 5' end of the downstream primer.

[0010] The present invention also provides the application of the primer set or the primer pool in the preparation of a detection kit for detecting 59 kinds of bacterial pathogens.

[0011] Preferably, the 59 bacterial pathogens are: Streptococcus uberis, Streptococcus parauberis, Streptococcus agalactiae, Streptococcus dysgalactiae, Lactococcus lactis, Lactococcus garvieae, Pseudomonas aeruginosa, Pseudomonas fragi, Pseudomonas fluorescens, Pseudomonas spp., Candida albicans, Staphylococcus aureus, Staphylococcus chromogenes, Staphylococcus simulans, Staphylococcus xylosus, Staphylococcus sciuri, Staphylococcus equorum, Staphylococcus haemolyticus, Mycobacterium bovis, Corynebacterium xerosis, Corynebacterium bovis, Mannheimia haemolytica, Haemophilus somnus, Enterococcus faecalis, Enterococcus faecium, Bacillus cereus, Bacillus coagulans, Bacillus licheniformis, Bacillus thuringiensis, Bacillus subtilis, Bacillus pumilus, Bacillus circulans, Arcanobacterium pyogenes, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella spp., Staphylococcus epidermidis, Acinetobacter baumannii, Acinetobacter gyllenbergii, Acinetobacter lwoffii, Chryseobacterium indologenes, Acinetobacter johnsonii, Enterococcus casseliflavus, Escherichia coli, Enterohemorrhagic Escherichia coli, Enterotoxigenic Escherichia coli, Enteropathogenic Escherichia coli, Enteroinvasive Escherichia coli, Enteroaggregative Escherichia coli, Bordetella bronchiseptica, Clostridium difficile, Clostridium perfringens, Pasteurella multocida, Pasteurella multocida type A, Pasteurella multocida type F, Mycoplasma bovis, Serratia liquefaciens, Serratia marcescens, and Brucella abortus.

[0012] The primer set for detecting multiple bacterial pathogens based on multiplex amplicons provided by the present invention designs multiple target genes and multiple pairs of primers for important pathogens to ensure comprehensive detection of pathogens, reduce the probability of missed and misdetected cases in mixed infections, and improve the accuracy and reliability of detection. Using the method of the present application can simultaneously achieve rapid and efficient detection of multiple pathogens, and has technical advantages such as high targeting and strong specificity. Brief Description of the Drawings

[0013] Figure 1 It is a simple flow chart of multiplex amplicon targeted sequencing;

[0014] Figure 2 It is a schematic diagram of the construction of the amplicon sequencing library in Example 2;

[0015] Figure 3 It is the pathogens, their target genes and the number of primers included in the amplicon sequencing panel in Example 4;

[0016] Figure 4 It is the distribution of the detected target genes in Example 4;

[0017] Figure 5 It is the pathogen detection situation in Example 4. Detailed Embodiments

[0018] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0019] The main reagents and instruments are shown in Table 1

[0020] Table 1 Main reagents and instruments

[0021]

[0022]

[0023] Example 1 Design primers for target genes of common bacterial pathogens in herbivores and generate primer pools

[0024] Determine candidate pathogens: Based on domestic literature on common bacterial diseases in herbivores and combined with the long-term accumulated research data in the laboratory, 59 pathogens that can cause mastitis, digestive tract and respiratory symptoms in herbivores and are highly harmful were screened out through statistical analysis

[0025] Screen target genes: Two methods were used to screen the target genes of pathogens. 1. Consult the literature of existing target pathogens and screen the experimentally verified pathogen target genes from the literature, and download the complete gene sequences on NCBI (https: / / www.ncbi.nlm.nih.gov / ) according to the target gene names; 2. Download the genomic information of the target pathogens from NCBI, and based on bioinformatics methods, use software such as Blastn and Prokka and customized scripts to screen target genes with better specificity. The specificity of the target genes screened by the two methods was further determined by the Blastn software in NCBI Blast, and finally the sequences of the pathogen target genes were obtained. A total of 114 target genes of 59 pathogens were screened, and the gene numbers and intervals of each target gene are shown in Table 2 below (the entire gene is indicated if the interval is not marked):

[0026] Table 2 Gene numbers and intervals of 114 target genes

[0027]

[0028]

[0029]

[0030]

[0031] Primer set design: Multiple publicly available primer design software were used for primer design, such as ATOPlex (https: / / atoplex.mgi-tech.com / ) and PrimalScheme (https: / / primalscheme.com / ). Primer design was carried out for the pathogen target gene sequences, with multiple parameter adjustments and comprehensive comparisons. Finally, the amplicon length range was set to 100 - 200 bp, and the primer design results were verified for primer specificity using the Primer Blast online software on the NCBI website. Combining the primer specificity verification results and information such as GC content, multiple rounds of primer design and analysis screening were carried out. Finally, a total of 196 primer pairs were designed for 59 target pathogens. The sequences of the primer pairs are shown in Table 3 below:

[0032] Table 3 Sequences of 196 primer pairs

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044] The designed primers were applied on the BGI sequencing instrument platform MGISEQ-200. To ensure that the samples could be correctly ligated with barcodes and correctly recognized by the instrument, 196 pairs of primers needed to add specific adapters to generate a specific primer pool. The specific operations were as follows: Add the specific adapter sequence "GACATGGCTACGATCCGACTT" with the sequence number SEQID NO: 393 to the 5' end of the upstream primer, and add the specific adapter sequence "CGCTTGGCCTCCGACTTGC" with the sequence number SEQID NO: 394 to the 5' end of the downstream primer. Finally, a specific primer pool for common bacterial pathogens of herbivores required for constructing an amplicon sequencing library was generated, abbreviated as "primer pool".

[0045] Example 2 Sample Treatment and Construction of Amplicon Sequencing Library

[0046] 1 Sample Treatment

[0047] In this example, a total of 10 samples were set, and the sample type was a mixed sample of strain genomic DNA, covering 29 kinds of bacteria in total. After extracting the bacterial genomes of the strains of 29 kinds of bacteria, use Qubit TM 4 Fluorometer to detect the concentration of ds DNA, and control the concentration of each strain at 10 ng / μL. The strain mixing information in each sample is shown in Table 4.

[0048] Take the total microbial DNA of each sample as a template for subsequent PCR amplification.

[0049] Table 4 Strain Mixing Information in 10 Samples

[0050]

[0051]

[0052] 2 Construction of ds DNA Library

[0053] 2.1 First-round PCR Amplification and Purification of the Target Fragment of the Pathogen Target Gene

[0054] Using the 10 samples in step 1 as templates, use the "primer pool" constructed in Example 1 above to amplify the target fragment of the target region in each sample. The reaction system is as follows: PCR Enzyme Mix is 12.5 μL, PCR CleanEnzyme is 0.5 μL, primer pool is 2 μL, ds DNA is 10 μL, and the total input of the system is 25 μL. Mix the first-round PCR reaction solution, use a vortex mixer to shake it 3 times, each time for 3 s, and then use a centrifuge for instantaneous centrifugation to make the liquid sediment at the bottom of the tube.

[0055] Perform the first round of PCR amplification program as follows: Heated lid at 105°C; 37°C for 5 min → 95°C for 10 min, 1 cycle; 95°C for 20 s → 64°C for 1 min → 60°C for 1 min → 72°C for 30 s, repeat 13 cycles; 12°C Hold. After the amplification reaction is completed, perform instantaneous centrifugation again to deposit the reaction solution at the bottom of the tube.

[0056] Purify the PCR products using the MGIEasy DNA Purification Magnetic Bead Kit. The specific purification process is shown in Table 5.

[0057] Table 5 Purification Process of the First Round of PCR Products of ds DNA Library

[0058]

[0059]

[0060] 2.2 Second Round of PCR Amplification and Product Purification

[0061] Using the purified product of each sample obtained in step 2.2.1 of this example as the DNA template, perform the second round of PCR amplification. Add Custom Panel PCR Block and PCR Barcode Primer Mix (01 - 96) to the reaction system to add custom adapters and specific tags to each sample. The reaction system is as follows: PCR Enzyme Mix is 12.5 μL, PCR CleanEnzyme is 0.5 μL, PCR Additive is 0.5 μL, Custom Panel PCR Block is 1 μL, PCR Barcode Primer Mix is 4 μL, DNA template is 6.5 μL, and the total input volume of the system is 25 μL.

[0062] Mix the second-round PCR reaction solution, use a vortex mixer to perform 3 oscillations, each lasting 3 s, and then use a centrifuge for instantaneous centrifugation to deposit the liquid at the bottom of the tube. Then perform the second-round PCR amplification program. The PCR reaction program is detailed in the PCR reaction program in Example 2.2.1 (note: repeat 13 cycles becomes 27 cycles). After the amplification reaction is completed, perform instantaneous centrifugation again to deposit the reaction solution at the bottom of the tube.

[0063] Use the MGIEasy DNA Purification Magnetic Bead Kit to perform the second product purification on the PCR products. The specific purification process is shown in Table 6.

[0064] After purification, 10 dsDNA libraries with the same number as the samples are obtained for subsequent construction of ssDNA libraries.

[0065] Table 6 Purification Process of the Second-round PCR Products of ds DNA Library

[0066]

[0067] 3 Construction of Amplicon ss DNA Library

[0068] 3.1 Quality Inspection of ds DNA Library

[0069] Quantify a single ds DNA library using QubitTM 4 Fluorometer to ensure that the final PCR product yield is ≧ 5 ng / μL. All 10 samples meet the quality requirements after quantitative detection. Mix the samples to be sequenced equally according to the barcode number. The total amount of the mixed library is 400 ng, and the total volume does not exceed 48 μL, while ensuring that the sampling volume of each library is at least 1 μL. For convenient sampling, the sampling amount of a single library is increased by 10 times during the sampling process, and finally 10 ds DNA libraries are mixed into an amplicon ds DNA mixed library.

[0070] 3.2 Denaturation of ds DNA Mixed Library

[0071] To prepare the ss DNA initial library, take 400 ng of the ds DNA mixed library prepared above and place it in a PCR tube. Use TE buffer to supplement the solution in the PCR tube to a total volume of 48 μL. Subsequently, perform a denaturation reaction on the PCR tube. The reaction conditions are: Heated lid 105°C; 95°C for 3 min → 95°C Hold. After the reaction is completed, immediately place the PCR tube in an ice bath. After 2 min of ice bath, perform a transient centrifugation, and the ds DNA mixed library is denatured into an ss DNA initial library.

[0072] 3.3 Circularization of ssDNA Library and Enzymatic Digestion of Circularized Library

[0073] Use the MGIEasy circularization kit to circularize the ss DNA library. The reaction system is as follows: add 11.5 μL of SplintBuffer 1, 0.5 μL of DNA Rapid Ligase, and 48 μL of ss DNA. The total input volume of the system is 60 μL. Vortex the reaction system 3 times, 3 s each time, and perform a transient centrifugation to collect the reaction solution at the bottom of the tube. Then perform a PCR reaction. The reaction program is: Heated lid 105°C, 37°C for 30 min → 4°C Hold. After the reaction is completed, centrifuge the PCR tube transiently and immediately place it on ice for enzymatic digestion of the circularized DNA library.

[0074] Using the circularized ssDNA library as a template, digestion was performed using the circularization module of the MGIEasy kit. The reaction system was as follows: 1.4 μL of Digestion Buffer, 2.6 μL of Digestion Enzyme, and 60 μL of ssDNA, with a total input volume of 64 μL. The reaction system was vortexed 3 times for 3 s each time, and then centrifuged briefly to collect the reaction solution at the bottom of the tube. PCR reaction was carried out, and the reaction program was the same as that for ssDNA circular amplification reaction. Then, 7.5 μL of Digestion Stop Buffer was immediately added to the PCR tube, vortexed 3 times for 3 s each time, and centrifuged briefly to collect the reaction solution at the bottom of the tube. All the reaction solution was aspirated and transferred to a new 1.5 mL centrifuge tube.

[0075] 3.4 Purification of the Digested Product of the ssDNA Library and Library Quality Inspection

[0076] The digested product of the ssDNA library was purified using the MGIEasy DNA Purification Magnetic Bead Kit. The specific purification process is shown in Table 7.

[0077] Table 7 Purification Process of the Digested Product

[0078]

[0079]

[0080] After the purification steps were completed, the amplicon ssDNA library was constructed. The ssDNA library was quality-tested using the QubitTM 4 Fluorometer / Qubit ssDNA Assay kit. The concentration of the ssDNA library was not less than 0.4 ng / μL, meeting the quality inspection requirements.

[0081] After three steps of sample treatment, dsDNA library construction, and ssDNA library construction, the amplicon sequencing library was constructed.

[0082] Example 3 Preparation of DNB

[0083] 1. Equal Proportion Mixing of the ssDNA Library and the Balanced Library

[0084] The ssDNA library and the balanced library (from the standard library kit) were mixed in a 1:1 ratio as the library template for DNB preparation. The total input volume of the mixed library template was 40 fmol. The concentration conversion formula is: C (fmol / μL) = 3030 * C (ng / μL) / N.

[0085] The following four formulas were used to calculate the specific input amounts:

[0086] (1) Concentration of ssDNA library F1 (fmol / μL) = 3030 * C1 (ng / μL) / N, (C1: Concentration of ssDNA; N: Total length of primer pool amplicons).

[0087] (2) Concentration of balanced library F2 (fmol / μL) = 3030 * C2 (ng / μL) / N', (C2: Concentration of balanced library; N': Length of standard product).

[0088] (3) Input volume of ssDNA library V1 (μL) = 40 fmol * 50% / F1, where F1 is the concentration of ssDNA library.

[0089] (4) Input volume of balanced library V2 (μL) = 40 fmol * 50% / F2, where F2 is the concentration of balanced library.

[0090] 2. Construction of amplicon DNB library

[0091] Using the mixed library from Step 1 as a template, DNB preparation is carried out using the MGISEQ - 200RS high - throughput sequencing kit (FCL PE100), with a total of two rounds of reactions:

[0092] 2.1. First - round primer hybridization reaction

[0093] Prepare a 40 μL reaction system: mixed library V μL (V = V1 + V2), TE buffer (20 - V) μL, DNB preparation buffer 20 μL.

[0094] After vortex - mixing and centrifuging for 5 seconds, place it in a PCR instrument for primer hybridization. The reaction conditions are: Heated lid 105℃, 95℃ 1 min → 65℃ 1 min → 40℃ 1 min → 4℃ Hold.

[0095] Immediately after the reaction ends, enter the second - round reaction - DNB rolling - circle amplification reaction. Take out the PCR reaction tube, centrifuge for 5 s, and immediately place it on ice to prepare DNB mixed reaction solution 2 required for the second - round reaction. The second - round reaction system is: input volume of DNB mixed reaction solution 1 is 40 μL, input volume of DNB polymerase mixed solution is 40 μL, input volume of DNB polymerase mixed solution II (LC) is 4 μL, and the total input volume of the reaction system is 84 μL.

[0096] Vortex - mix the prepared DNB mixed reaction solution 2, centrifuge for 5 s, and immediately place it in a PCR instrument for DNB rolling - circle amplification. The reaction conditions are: Heated lid 35℃; 30℃ 25 min → 4℃ Hold. Immediately after the reaction ends, add 20 μL of DNB termination buffer, and slowly pipette and mix 5 - 8 times with a wide - mouth pipette tip, without shaking or vigorously pipetting.

[0097] After the DNB preparation is completed, 2 μL is taken for use. ssDNA Assay Kit and a Fluorometer instrument are used for concentration detection. The concentration of the amplified DNB is 0.849 ng / μL, meeting the quality control requirements. The DNB is stored at 4°C for future use and preparation for on-machine sequencing.

[0098] Example 4 On-machine Sequencing and Sequencing Data Analysis

[0099] Using the MGISEQ-200RS high-throughput rapid sequencing reagent kit (FCLPE100), according to the requirements of the corresponding sequencing reagent kit instruction manual, the DNB prepared in Example 3 is sequenced on the machine.

[0100] After the sequencing is completed, the sequencing sample quality inspection report and the original sequencing data of all samples (paired-end fastq format files) are copied for analysis, detection result statistics, and result visualization processing.

[0101] First, view the sample quality inspection report file. The report shows that the sequencing quality is high, and the data results with ≥Q30 are above 90%. The Barcode can be normally recognized, and all samples can be accurately distinguished.

[0102] Bioinformatics analysis is performed on the original sequencing data using software such as fq2fa, blast, and customized scripts, including data normalization, calculation of target gene abundance, statistics of pathogen detection results, etc. The detection results of these 10 samples this time indicate that most of the target genes of the present invention are detected ( Figure 4 ).

[0103] To test the detection ability of this method for pathogen co-infection, different strain combinations are set for each sample. The results indicate that the detection accuracy rate of strains in complex infection situations is still as high as 98.13% ( Figure 5 ), proving that this method can fully cope with complex infection situations.

[0104] Through practical implementation, it is found that multiple pathogen target genes in the panel are detected in the above 10 samples, and the pathogen infection situation is judged based on the detection results of the pathogen target genes. The implementation results prove that the sequencing results are accurate and reliable. When applied to complex infection situations, the designed amplification primers still have the advantages of high efficiency and good specificity, thus proving that the present invention has successfully achieved rapid, accurate, and simultaneous diagnosis of 59 common bovine bacterial pathogens. Therefore, it shows that a method for simultaneously detecting 59 common bovine bacterial pathogens based on multiplex amplicon target enrichment provided by the present invention has been successfully established.

[0105] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A primer set for simultaneously detecting multiple bacterial pathogens based on multiplex amplicons, characterized in that, The primer set consists of 196 pairs of primers, and their nucleotide sequences are shown as SEQ ID NO: 1-392.

2. A primer pool constructed based on the primer set described in claim 1, characterized in that, The primer pool is generated by adding specific adapters to 196 pairs of primers.

3. The primer pool according to claim 2, wherein The specific operation of adding specific adapters to 196 pairs of primers is as follows: adding a specific adapter sequence GACATGGCTACGATCCGACTT, with the serial number SEQ ID NO: 393, to the 5' end of the upstream primer, and adding a specific adapter sequence CGCTTGGCCTCCGACTTGC, with the serial number SEQ ID NO: 394, to the 5' end of the downstream primer.

4. Use of the primer set according to claim 1 or the primer pool according to claim 2 or 3 in the preparation of a detection kit for detecting 59 bacterial pathogens.

5. The application according to claim 4, characterized in that The 59 bacterial pathogens are: Streptococcus uberis, Streptococcus parauberis, Streptococcus agalactiae, Streptococcus dysgalactiae, Lactococcus lactis, Lactococcus garvieae, Pseudomonas aeruginosa, Pseudomonas fragi, Pseudomonas fluorescens, Pseudomonas spp., Candida albicans, Staphylococcus aureus, Staphylococcus chromogenes, Staphylococcus simulans, Staphylococcus xylosus, Staphylococcus sciuri, Staphylococcus equorum, Staphylococcus haemolyticus, Mycobacterium bovis, Corynebacterium xerosis, Corynebacterium bovis, Mannheimia haemolytica, Haemophilus somnus, Enterococcus faecalis, Enterococcus faecium, Bacillus cereus, Bacillus coagulans, Bacillus licheniformis, Bacillus thuringiensis, Bacillus subtilis, Bacillus pumilus, Bacillus circulans, Arcanobacterium pyogenes, Klebsiella pneumoniae, Klebsiella oxytoca, Salmonella spp., Staphylococcus epidermidis, Acinetobacter baumannii, Acinetobacter gyllenbergii, Acinetobacter lwoffii, Chryseobacterium indologenes, Acinetobacter johnsonii, Enterococcus casseliflavus, Escherichia coli, Enterohemorrhagic Escherichia coli, Enterotoxigenic Escherichia coli, Enteropathogenic Escherichia coli, Enteroinvasive Escherichia coli, Enteroaggregative Escherichia coli, Bordetella bronchiseptica, Clostridium difficile, Clostridium perfringens, Pasteurella multocida, Pasteurella multocida type A, Pasteurella multocida type F, Mycoplasma bovis, Serratia liquefaciens, Serratia marcescens, and Brucella abortus.

Citation Information

Patent Citations

  • Chloride-inducible prokaryotic expression system

    CN113785067A

  • Primer group for simultaneously detecting 15 pig pathogens through high-throughput targeted sequencing and application

    CN115976281A

  • Respiratory pathogen detection kit based on targeted amplicon sequencing

    CN116287357A

  • Preparation method of kit for detecting lower respiratory tract infection, kit and application

    CN116445633A

  • Kit and method for simultaneously detecting multiple pathogenic microorganisms tNGS

    CN117757962A

Cited By

  • Primer group for simultaneously detecting 34 pathogenic microorganisms and 39 drug-resistant genes in aquaculture and application of primer group

    CN120624691A

  • A primer set for simultaneously detecting 34 pathogenic microorganisms and 39 drug resistance genes in aquaculture and application thereof

    CN120624691B

  • Primer group for detecting common pneumonia pathogenic bacteria of forest musk deer and application of primer group

    CN121737324A

  • Primer group for detecting common pathogenic bacteria of pneumonia of moschus berezovkii and application thereof

    CN121737324B