Biosensors that bind to interleukin-2 and uses thereof

The screening and construction of nucleic acid aptamer molecular beacons through Protein-SELEX technology solves the high cost and cumbersome steps of the existing IL-2 detection methods, and achieves efficient and rapid IL-2 detection in complex samples, which is suitable for IL-2 targeted diagnosis and treatment.

CN120275639APending Publication Date: 2025-07-08SHANGHAI CHILDRENS MEDICAL CENT AFFILIATED TO SHANGHAI JIAOTONG UNIV SCHOOL OF MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510240402.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-28
Publication Date
2025-07-08

AI Technical Summary

Technical Problem

In the prior art, the IL-2 detection method has problems such as high cost, ease of inactivation and cumbersome detection steps, and the development of specific nucleic acid aptamer beacons for IL-2 has not been reported, especially in complex samples such as high concentration serum.

Method used

Protein-SELEX technology was used to screen out nucleic acid aptamers with strong specificity and high affinity, and construct nucleic acid aptamer molecular beacons for preparing biosensors to achieve rapid detection of IL-2.

Benefits of technology

It realizes rapid detection of IL-2 at the in situ and live cell level, can maintain good detection performance in high-concentration serum environments, and provides tools for targeted diagnosis and treatment of IL-2.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120275639A_ABST
    Figure CN120275639A_ABST
Patent Text Reader

Abstract

The invention discloses a biosensor combined with interleukin-2 (IL-2) and application of the biosensor in preparation of a product for detecting the IL-2 level in a sample (for example, blood such as serum, immune cells such as T cells, cell culture fluid or living cell secretion microenvironment).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention pertains to the field of biotechnology, and relates to a biosensor (e.g., a membrane-anchored biosensor) that binds interleukin-2 (IL-2) and its application in the preparation of products for detecting the level of IL-2 in a test sample (e.g., blood, such as serum, immune cells like T cells, etc., cell culture medium or the microenvironment secreted by living cells), providing a simple and rapid alternative tool for IL-2 detection. Background Art

[0002] Interleukin-2 (IL-2) is a pleiotropic cytokine secreted by activated T cells, which maintains immune homeostasis by regulating the proliferation and function of T cells and NK cells. Abnormal levels of IL-2 are closely related to pathological conditions such as tumors, infectious diseases, and immune deficiencies. The amount of IL-2 secretion is also used as a marker of T cell activation. Therefore, its detection is of great significance for evaluating the immune status and treatment effect. A variety of analytical methods, such as ELISA (enzyme-linked immunosorbent assay) or FCM (flow cytometry), have been developed to monitor the level of IL-2 in bulk culture media and cells. These methods are mainly based on antibody-antigen reactions. However, antibodies have defects such as high cost, easy inactivation, and cumbersome detection steps. Antibodies have defects such as high cost, easy inactivation, and cumbersome detection steps.

[0003] Nucleic acid aptamers can serve as effective alternatives to antibodies and can be used as recognition components in the development of detection probes. Nucleic acid aptamers can bind to targets with high affinity and selectivity, usually obtained through the Systematic Evolution of Ligands by Exponential Enrichment (SELEX) system. Nucleic acid aptamers have the advantages of high affinity, low cost, easy chemical modification, and non-immunogenicity. In addition, nucleic acid aptamers can also be used in the development of novel tumor immunotherapy systems, providing alternative solutions to problems such as limited targets, high immunogenicity, difficulty in entering tumor tissues, and difficulty in modification and transformation in therapies such as bispecific antibodies and CAR-T. The molecular aptamer beacon (MAB) is one of the most representative applications of nucleic acid aptamers. It is a fluorescence detection probe (fluorescently labeled oligonucleotide probe) constructed by combining the molecular recognition characteristics of nucleic acid aptamers with molecular beacon technology. It combines the specific targeting of nucleic acid aptamers and the rapid response of beacons, and has the advantages of high sensitivity, good specificity, low background signal, and wide application range. It is a research hotspot in the field of biosensors. The nucleic acid aptamer beacon has the characteristics of easy design and synthesis, simple operation, high sensitivity and specificity, and rapid response, making it an attractive tool in biosensing, bioimaging, and biochemical analysis. In addition, by taking advantage of the convenience of reshaping and modification, the nucleic acid aptamer beacon can also be equipped with a membrane anchoring function to achieve cell-level detection with precise spatio-temporal resolution. Several strategies have been developed to design sensors onto the cell surface, including covalent coupling, hydrophobic interaction, enzyme ligation, etc. These cell surface sensors are powerful tools for monitoring cell functions and cell-cell communication in the cell microenvironment.

[0004] Currently, the research on aptamers against IL-2 still has limitations. For example, Mohsen Momeni et al. [1] reported a G-quadruplex nucleic acid aptamer that binds murine IL-2 (Kd≈91 nM), but its binding ability to human IL-2 has not been verified. At the same time, the anti-interference ability of such technologies in complex samples such as high-concentration serum still needs to be improved, and the development of specific aptamer beacons against IL-2 has not been reported.

[0005] Developing new detection and treatment tools based on nucleic acid aptamers is of great significance for breaking through the bottlenecks of existing antibody-based methods. As a novel recognition molecule, nucleic acid aptamers show broad development and application prospects in the biomedical field. However, there are still a large number of targets for which specific and high-affinity nucleic acid aptamers have not been screened. Therefore, there is an urgent need in this field to develop a highly efficient, stable, and specific nucleic acid aptamer suitable for detecting IL-2 in biological samples and living cells, and based on this nucleic acid aptamer, explore its feasibility in substance detection and immunotherapy by modifying the nucleic acid aptamer. Summary of the Invention

[0006] This disclosure is based on the classical Protein-SELEX technology and uses the recombinant protein hIL-2-Fc-His to screen for ssDNA nucleic acid aptamers. Since this protein contains specific epitopes, it is theoretically possible to obtain specific aptamers against IL-2. We bound the purified protein to the solid-phase carrier Protein A agarose purification resin through the Fc fragment, then incubated it with a random ssDNA library, and innovatively obtained nucleic acid aptamers that specifically bind to IL-2 with high affinity by setting different controls and screening conditions. Subsequently, the inventors modified the nucleic acid aptamers to further construct molecular beacons with high specificity and affinity. Finally, the inventors explored the feasibility of applying these nucleic acid aptamers and / or molecular beacons to substance detection, IL-2 targeted diagnosis, immunotherapy (e.g., IL-2 targeted therapy), etc. For example, the inventors developed a detection technology capable of detecting different concentrations of IL-2 and achieved rapid detection of IL-2 at the in-situ and live cell levels (such as detecting the IL-2 secretion level of T cell activation in tumor immunotherapy).

[0007] In one aspect, a biosensor is provided that includes two nucleotide strands, wherein the first nucleotide strand is a nucleic acid aptamer or molecular beacon that binds to IL-2, the 3'-end of which includes a linker and the 5'-end of which includes at least one terminal modification; the second nucleotide strand is a complementary sequence that is base complementary to the linker, and the 5'-end and 3'-end of which each include at least one terminal modification.

[0008] In some embodiments, the nucleic acid aptamer or molecular beacon includes a nucleotide sequence selected from the group consisting of or a nucleotide sequence having at least 80% homology to any one of the nucleotide sequences selected from the group consisting of: Apt81 (SEQ ID NO: 16); Apt82 / Apt8-core (SEQ ID N0: 17); Apt241 (SEQ ID N0: 18); Apt242 (SEQ ID NO: 19); Apt35 (SEQ ID NO: 20); Apt24-core (SEQ ID NO: 22); and / or Apt35-core (SEQ ID N0: 23).

[0009] In some embodiments, the two nucleotide strands form a secondary structure through base complementary pairing, and the secondary structure includes, but is not limited to, hairpin structure, stem-loop structure, pseudoknot, G-quadruplex, etc. In a certain embodiment, the two nucleotide strands further form a stem-loop structure through base complementary pairing. In some embodiments, the at least one terminal modification includes, but is not limited to, a terminal modified with a poly-T sequence (T-strand), a PEG-modified terminal, a fluorescent group-modified terminal, a quenching group-modified terminal, an affinity tag (such as biotin, digoxin, etc.)-modified terminal, a phosphorylated terminal, a hydrophobic group-modified terminal, an amino-modified terminal, a linker-modified terminal, a Spacer (such as C3 Spacer, Spacer 18)-modified terminal, an inserted sequence-modified terminal, a functionalized terminal, or a combination thereof. In certain embodiments, the fluorescent group includes one or more fluorescent groups selected from the group consisting of: small molecule fluorescein, nanomaterials, quantum dots, macromolecular fluorescent groups, and / or combinations thereof; for example, the small molecule fluorescein includes, but is not limited to, 6-carboxyfluorescein (6FAM), tetramethylrhodamine, 5-carboxytetramethylrhodamine (5-TAMRA), tetramethylrhodamine isothiocyanate (TRITC), coumarin, fluorescein isothiocyanate (FITC), cyanine dyes (such as Cy2, Cy3, Cy5, PE-Cy5.5), lanthanide chelates (such as europium Eu 3+) ROX, JOE, APC\VIC, hexachlorofluorescein; for example, the macromolecular fluorophore includes but is not limited to fluorescent proteins (such as phycoerythrin (PE)), intercalating dyes: ethidium bromide (EB), SYBR Green, ATT0647, ATT0565, Alexa Fluor488. In certain embodiments, the quenching group includes one or more quenching groups selected from the group consisting of small molecule quenchers, nanomaterial quenchers, and / or combinations thereof; for example, the small molecule quenchers include but are not limited to Black Hole Quencher (BHQ), Black Hole Quencher 1 (BHQ1), Black Hole Quencher 2 (BHQ2), Black Hole Quencher 3 (BHQ3), Black Hole Quencher 650 (BHQ650), 4-(4-dimethylaminophenylazo)-benzoic acid (DABCYL), TAMRA, Eclipse, MGB, BHQ1; for example, the nanomaterials include but are not limited to nanocarbon materials (such as carbon nanotubes, graphene, etc.), metal nanoparticles (e.g., gold nanoparticles AuNP). In certain embodiments, the inserted sequence includes a nucleotide sequence of any length that does not change the property of the nucleic acid aptamer or molecular beacon binding to IL-2, for example, a nucleotide sequence of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases in length. In certain embodiments, the linker includes a nucleotide sequence of any length, for example, a linker of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases in length; preferably a linker of 20 bases in length, for example, AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto. In certain embodiments, the Spacer includes one or more selected from the group consisting of hydrophobic Spacer C3, C6, C12, hydrophilic Spacer9, Spacer 18 or dSpacer, PC linker, and / or combinations thereof. In certain embodiments, the functionalized terminus includes one or more selected from the group consisting of hydroxyl, carboxyl, amino, or thiol modifications and / or combinations thereof. In certain embodiments, for example, the hydrophobic group includes one or more selected from the group consisting of dialkyl lipids, cholesterol,, thiophosphate esters, hydrophobic Spacer C3, C6, C12, and / or combinations thereof.

[0010] In some embodiments, the nucleic acid aptamer or molecular beacon is a modified nucleic acid aptamer or molecular beacon, and the modification includes one or more modifications selected from the group consisting of: at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide, at least one terminal modification, at least one spacer modification, and combinations thereof. In certain embodiments, the at least one modified sugar moiety includes, but is not limited to, a 2'-O-methoxyethyl (2'-OH) modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, a bicyclic sugar moiety, a 2'-OH modified sugar moiety, a fluorine-substituted modified sugar moiety, and combinations thereof. In certain embodiments, the at least one modified internucleoside bond includes, but is not limited to, phosphorothioate, phosphonate alkyl ester, dithiophosphate, alkylthiophosphonate, aminophosphate, carbamate, carbonate, phosphotriester, acetamide ester, carboxymethyl ester, and combinations thereof. In certain embodiments, the at least one modified nucleotide includes, but is not limited to, peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinonucleic acid, derivatives of peptide nucleic acid (PNA), derivatives of locked nucleic acid (LNA), derivatives of arabinonucleic acid, and combinations thereof. In certain embodiments, the at least one terminal modification includes, but is not limited to, a poly-T sequence (T-strand) modified terminal, a PEG modified terminal, a fluorophore modified terminal, a quencher modified terminal, an affinity tag (e.g., biotin, digoxin, etc.) modified terminal, a phosphorylation modified terminal, a hydrophobic group (e.g., dialkyl lipid, cholesterol, etc.) modified terminal, an amino modified terminal, a linker modified terminal, a Spacer (e.g., C3 Spacer, Spacer 18) modified terminal, an insert sequence modified terminal, a functionalized terminal, or combinations thereof. In certain embodiments, the at least one spacer modification includes, but is not limited to, a fluorophore modified non-terminal region, a quencher modified non-terminal region, an affinity tag (e.g., biotin, digoxin, etc.) modified non-terminal region, a hydrophobic group (e.g., dialkyl lipid, cholesterol, etc.) modified non-terminal region, a complementary sequence modified non-terminal region (e.g., a complementary sequence (C strand) modified stem), a Spacer (e.g., C3 Spacer, Spacer 18) modified non-terminal region, or combinations thereof.

[0011] In some embodiments, the biosensor includes one or more parts selected from the group consisting of: a fluorophore, a quencher, an insert sequence, a linker, a Spacer, a functionalized terminal, and / or combinations thereof. In certain embodiments, the fluorophore is located at the 5'-end, 3'-end or non-terminal region of the nucleic acid aptamer or molecular beacon, at the 5'-end, 3'-end or non-terminal region of other parts, and / or between the nucleic acid aptamer or molecular beacon and other parts;

[0012] For example, the quenching group is located at the 5'-end, 3'-end or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end or non-terminal region of other parts, and / or between the aptamer or molecular beacon and other parts. In certain embodiments, the insertion sequence is located at the 5'-end, 3'-end or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end or non-terminal region of other parts, and / or between the aptamer or molecular beacon and other parts. In certain embodiments, the linker is located at the 5'-end, 3'-end or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end or non-terminal region of other parts, and / or between the aptamer or molecular beacon and other parts. In certain embodiments, the Spacer is located at the 5' -end, 3'-end or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end or non-terminal region of other parts, and / or between the aptamer or molecular beacon and other parts.

[0013] In some embodiments, the linker is a nucleotide sequence of any length, for example, a linker having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases; preferably a linker having a length of 20 bases; and / or the complementary sequence is a nucleotide sequence of any length and base-complementary to the linker, for example, a complementary sequence having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases.

[0014] In some embodiments, the 3'-end of the first nucleotide chain includes a linker with a length of 20 bases and the 5'-end includes a terminus modified with a fluorophore. The 5'-end of the second nucleotide chain includes a terminus modified with a hydrophobic group and the 3'-end includes a terminus modified with a quencher. In certain embodiments, the 3'-end of the first nucleotide chain includes a linker composed of a nucleotide sequence of AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto, and the 5'-end includes a terminus modified with 6-carboxyfluorescein (6FAM). In certain embodiments, the 5'-end of the second nucleotide chain includes a terminus modified with cholesterol and the 3'-end includes a terminus modified with Black Hole Quencher 1 (BHQ1). In one embodiment, the second nucleotide chain includes GATTAGTACAGTTGATGTTT (SEQ ID NO: 44), TTTTTGATTAGTACAGTTGATGTTT (SEQ ID NO: 45) or a nucleotide sequence having at least 80% homology thereto. In yet another embodiment, the 3'-end of the first nucleotide chain includes SEQ ID NO: 39 and the second nucleotide chain includes SEQ ID NO: 41.

[0015] On the other hand, a preparation is provided, which comprises the biosensor according to any one of the foregoing embodiments. In some embodiments, the preparation is for magnetic beads or gel resins for IL-2 detection and / or purification, for reagents and / or kits for detecting IL-2 levels, for pharmaceutical compositions for IL-2 targeted therapy, etc. In some embodiments, the preparation is non-diagnostic / therapeutic.

[0016] On the other hand, an application of the biosensor and / or the preparation according to any one of the foregoing embodiments in preparing a product for IL-2 targeted diagnosis, IL-2 targeted therapy or detecting the IL-2 level in a sample is provided. In some embodiments, the sample is blood, such as serum, immune cells such as T cells, etc., cell culture medium or the microenvironment secreted by living cells. In some embodiments, the subject is a mammal, such as a human, a non-human primate (such as an orangutan, an ape), a rodent (such as a rat, a mouse, a guinea pig), a pet (such as a cat, a dog), a livestock (such as a horse, a cow, a sheep, a pig, a rabbit). In some embodiments, the product is magnetic beads or gel resins for IL-2 detection and / or purification, reagents and / or kits for detecting IL-2 levels, pharmaceutical compositions for IL-2 targeted therapy, etc. In a certain embodiment, the product is a kit, which comprises other compositions or components and / or instructions. In some embodiments, the product is a non-diagnostic / therapeutic product.

[0017] In another aspect, a method for detecting IL-2 is provided, including: a) mixing the biosensor and / or product described in any of the foregoing embodiments with a sample to be tested; b) measuring the level of IL-2 in the sample. In some embodiments, the sample is blood, such as serum, immune cells like T cells, etc., cell culture medium or the microenvironment secreted by living cells. In some embodiments, the detection method is not directly aimed at obtaining a diagnostic result or health condition, and is a non-diagnostic / therapeutic method.

[0018] In another aspect, a system is provided, which includes: a module for obtaining the level of IL-2 in a sample of an object; a module for analyzing the level of IL-2 in the sample obtained from the object (for example, a module for comparing the level of IL-2 in the sample obtained from the object with a reference level); and a module for evaluating IL-2 of the object; a module for outputting and / or storing the analysis result. In some embodiments, the system may optionally further include one or more modules selected from the following group: a module for collecting or receiving a sample of the object; a module for detecting the level of IL-2 in the sample; a module for inputting, comparing, storing and / or outputting the level of IL-2; a local, remote or cloud data storage, reading and / or analysis module.

[0019] Those skilled in the art can make any combination of the technical solutions and technical features described herein without departing from the inventive concept and protection scope of the present invention. Other aspects of the present invention will be apparent to those skilled in the art due to the disclosure herein. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention involved in this application can be better understood by referring to the exemplary embodiments and the drawings described in detail below. A brief description of the drawings is as follows.

[0021] Figure 1 : Monitoring of library enrichment process. Figure 1 A: Detection of the binding of IL-2 and other proteins by ELoNA for the ssDNA library after the 2nd, 4th, 5th, and 6th rounds of enrichment; Figure 1 B: Detection of the binding of IL-2 and other proteins by LONA for the 5th, 6th, 7th, and 8th round libraries; Figure 1 C: Optimization of the number of cycles by agarose gel electrophoresis for the 5th, 6th, 7th, and 8th rounds.

[0022] Figure 2 : Detection of the binding ability of 10 enriched sequences to IL-2 and other proteins.

[0023] Figure 3 : Prediction of the secondary structure of the truncated and optimized sequences of Apt8, Apt24, and Apt35.

[0024] Figure 4 : SDS-Page electrophoresis diagrams of IL-2-6H, IL-2-catch-6H, and IL-15-catch-6H proteins after purification.

[0025] Figure 5 : Detection of the binding specificity and affinity of each sequence. Figure 5 A: Detection of the binding of 5 truncated and optimized sequences to IL-2, IL-2-Fc-His, IgG1-Fc-His, and BSA by ELONA; Figure 5 B: Detection of the binding of different concentrations of Apt8-2, 24-2, and 35 to IL-2 by ELONA and calculation of the affinity dissociation constant.

[0026] Figure 6 : Detection of the specificity of three nucleic acid aptamers for IL-2 and IL-15 by EL0NA.

[0027] Figure 7 : Detection of proteins such as IL-26H in solution by Apt24-MB and Apt35-MB. Figure 7 A: Detection of proteins IL-2-6H and IL-2-Fc-His in solution by Apt24-MB and Apt35-MB, with IgG1-Fc-His, IgG1-Fc, BSA, and PBS as controls; Figure 7 B: Detection of proteins such as IL-2-catch-6H and IL-15-catch-6H in solution by Apt24-MB and Apt35-MB, and detection of the specificity of the two probes for IL-2 and IL-15; Figure 7 C: Detection of different concentrations of IL-2-6H solution by Apt24-MB and Apt35-MB and plotting of the standard curve (E x = 485 nm, E m = 528 nm).

[0028] Figure 8 : Detection of human cytokines by Apt24-MB and Apt35-MB.

[0029] Figure 9 : Detection ability of Apt24-MB and Apt35-MB in solutions with different FBS contents.

[0030] Figure 10 : Schematic diagram of the working principle of the membrane-anchored IL-2 probe chol-Apt35.

[0031] Figure 11 : Proficiency testing for the detection of IL-2 in solution by split probes.

[0032] Figure 12: Detect the binding of cholesterol-modified fluorescent probes to cells at different concentrations and different times. Figure 12 A: Incubate Jurkat cells with cholesterol-modified fluorescent probe solutions at different concentrations (0 - 2 μM) at room temperature for 20 min, and detect cell fluorescence by flow cytometry; Figure 12 B: Detect the cell viability after incubation with different concentrations of the probe by the DAPI method, and calculate the relative viability based on the group without the probe; Figure 12 C: Incubate 200 nM cholesterol-modified probe with Jurkat cells at room temperature for different times (0 - 120 min), and detect the surface fluorescence by flow cytometry; Figure 12 D: The relative viability of cells after incubation with the probe for different times; Figure 12 E: Image the probe-labeled cells using a confocal microscope.

[0033] Figure 13 : After Jurkat cells are incubated with 200 nM probe at room temperature for 20 min, remove the supernatant, resuspend the cells with PBS (upper) or 5 U / mL DNase I solution (lower) respectively, let them stand at 37 °C for 10 min and then image using a confocal microscope.

[0034] Figure 14 : Investigation of the stability of cholesterol-modified probe on the cell membrane. Incubate Jurkat cells with 200 nM probe at room temperature for 20 min, remove the supernatant and resuspend the cells with PBS, let them stand at room temperature for 1 h, then transfer them to 37 °C and continue to place for 1 h, and image using a confocal microscope at the time points of 0, 30, 60, 90, and 120 min respectively.

[0035] Figure 15 : Detect IL-2 in the surrounding solution after the cell membrane is modified with chol-Apt35 probe. Figure 15 A: After T cells (upper) or Jurkat cells (lower) bind to chol-Apt35, resuspend them with different concentrations of IL-2 solutions respectively, incubate at 37 °C for 30 min, remove the supernatant, and detect the cell surface fluorescence by flow cytometry; Figure 15 B: After T cells bind to chol-Apt35, resuspend the cells with a solution containing (lower) or without (upper) IL-2, continue to incubate for 30 min and then image under a confocal microscope.

[0036] Figure 16 : Detect the secretion of IL-2 after T cell activation by Chol-Apt35 probe or flow cytometry antibody. Figure 16 A: Culture T cells or Nalm6 cells under the conditions of CD3 / CD28 antibody or PBS for 48 h, and detect the IL-2 expression level using chol-Apt35 probe (left) or flow cytometry antibody (right) respectively; Figure 16B and C: T cells were stimulated with CD3 / CD28 for 0, 6, 12, 24, and 48 h, and cell IL-2 secretion was detected using chol-Apt35 (B) or flow antibodies (C).

[0037] Figure 17 : Confocal microscopy was used to detect IL-2 secretion in CAR-Jurkat cells after stimulation with target cells. Scale bar: 25 μM ( Figure 17 A) or 2.5 μM ( Figure 17 B).

[0038] Figure 18 : Flow cytometry was used to detect IL-2 secretion in CAR-T cells after stimulation with target cells. Figure 18 A: Detection of CD19-CAR expression on the surface of CAR-T cells. T cells of the same batch not infected with the virus were used as negative controls. Figure 18 B: Detection of IL-2 secretion in co-cultured CAR-T cells with different ET ratios using chol-Apt35; Figure 18 C: Verification using flow antibodies.

[0039] Figure 19 : Detection of IL-2 secretion in CAR-T cells that bound and did not bind to target cells in the co-culture system using chol-Apt35 probes. Figure 19 A: CD19-CAR-T cells were labeled with cpd dye, and Nalm6 was labeled with CD10 antibody. The two types of cells were co-cultured at a ratio of 1:1, and single CAR-T cells were used as a control without target antigen stimulation. After 2 h, a chol-Apt35 probe with a final concentration of 50 nM was added, and the cells were further cultured for 2 h for flow cytometry analysis. The CD10+cpd+ double-positive cell population represents CAR-T cells that recognized and bound to Nalm6, and the cpd single-positive cells represent those that did not bind to Nalm6. The fluorescence intensities of these two cell populations and native CAR-T cells in the FITC channel were compared; Figure 19 B: Column chart of the average fluorescence intensity of FAM on the surface of the three cell populations, with three replicates in each group. Detailed implementation methods

[0040] Before describing the present invention, it should be understood that the present invention is not limited to the specific embodiments described, and thus may of course vary. It should also be understood that the terms used herein are for the purpose of describing specific embodiments only and are not intended to be limiting, as the scope of the present invention is defined only by the appended claims.

[0041] Although various embodiments of the present invention have been shown and described herein, it will be apparent to those skilled in the art that these embodiments are provided by way of example only. Without departing from the present invention, many variations, changes, and substitutions can be envisioned by those skilled in the art. It should be understood that various alternatives to the embodiments of the present invention described herein may be employed.

[0042] All numerical ranges provided herein are intended to clearly include all numerical values falling between the range endpoints and the numerical ranges therebetween. The features mentioned in the present invention or the features mentioned in the embodiments can be combined. All features disclosed in this specification can be used in combination with any composition form, and each feature disclosed in the specification can be replaced by any alternative feature that provides the same, equivalent or similar purpose. Therefore, unless otherwise specified, the disclosed features are only general examples of equivalent or similar features.

[0043] As used herein, "comprising", "having" or "including" include "containing", "consisting essentially of", "consisting substantially of", and "consisting of"; "consisting essentially of", "consisting substantially of" and "consisting of" are subordinate concepts of "comprising", "having" or "including".

[0044] The numerical ranges herein include their endpoints as well as each specific numerical point and sub-range within the numerical range. For example, 1 to 3 includes the endpoints 1 and 3, the specific integer numerical point 2 and non-integer numerical points therebetween (such as but not limited to: 1.2, 1.5, 1.8, 2.1, 2.3, 2.4, 2.8, etc.), and its sub-ranges (such as but not limited to: 1 to 2, 2 to 3, 1 to 1.2, 1.5 to 1.8, etc.).

[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although exemplary methods and materials are described currently, any methods and materials similar or equivalent to those described herein can be used in the practice and testing of this invention. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials related to the cited publications. It should be understood that in case of conflict, the content of this disclosure supersedes any disclosure of the incorporated publications.

[0046] As used herein, "Interleukin-2 (IL-2)" refers to a pleiotropic cytokine secreted by activated T cells, which maintains immune homeostasis by regulating the proliferation and function of T cells and NK cells. Abnormal levels of IL-2 are closely related to pathological conditions such as tumors, infectious diseases, and immune deficiencies. It is known that IL-2 belongs to the members of the Y c receptor cytokine family, with a structure containing four tightly stacked α-helices, 133 amino acid residues in the protein sequence, and a molecular weight of approximately 15.5 kDa. At rest, IL-2 is mainly secreted at a low level by CD4+ helper T cells. After activation, the secretion amount increases significantly. CD8+ T cells, NK cells, and dendritic cells can also produce a small amount of IL-2, which binds to the IL-2 receptor (IL-2R) on the cell surface in an autocrine or paracrine manner to exert its function, regulating the activity and homeostasis of the immune system. IL-2 can not only stimulate immunity, promote the proliferation and activation of T cells and NK cells, enhance killing activity and cytokine secretion, and promote B cell proliferation and antibody secretion, but also participate in immune tolerance, help the development and maintenance of Treg cells, mediate activation-induced cell death (AICD), and is also related to the exhaustion of CD8+ T cells in the tumor microenvironment. In this article, the IL-2 mentioned refers to IL-2 from mammals, such as humans, non-human primates (such as orangutans, apes), rodents (such as rats, mice, guinea pigs), pets (such as cats, dogs), and livestock (such as horses, cows, sheep, pigs, rabbits).

[0047] As used herein, the term "nucleic acid aptamer" is used interchangeably with terms such as "aptamer (apt)", "nucleic acid aptamer", "aptamer", etc. and has the same meaning, referring to a single-stranded DNA or RNA sequence approximately 15 - 90 bases in length (e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 or each intermediate value between the upper and lower limits of the range), typically with a size of 10 - 15 kD, capable of specifically recognizing a target. In some embodiments, the nucleic acid aptamer can form a secondary structure through base complementary pairing, such as a hairpin structure, pseudoknot, G-quadruplex, etc., and then fold under intermolecular forces such as electrostatic interaction, hydrophobic interaction, hydrogen bond, van der Waals force, etc. to form a thermodynamically stable three-dimensional spatial structure, achieving specific and efficient recognition of the target through intermolecular forces and structural embedding. In the field of biomedicine, the application scenarios of nucleic acid aptamers involve many aspects such as biomarker discovery, disease diagnosis, molecular imaging, and disease treatment. In some embodiments, a nucleic acid aptamer that binds interleukin-2 (IL-2) is provided, wherein the nucleic acid aptamer comprises a nucleotide sequence selected from the group consisting of or a nucleotide sequence having at least 80% homology with any nucleotide sequence selected from the group consisting of: Apt8-1 (SEQ ID NO: 16); Apt8-2 / Apt8-core (SEQ ID NO: 17); Apt24-1 (SEQ ID NO: 18); Apt24-2 (SEQ ID NO: 19); Apt35 (SEQ ID NO: 20); Apt24-core (SEQ ID NO: 22); and / or Apt35-core (SEQ ID NO: 23).

[0048] As used herein, the term "molecular beacon (MB)" refers to an oligonucleotide fluorescent probe having a loop-stem structure. The MB structure generally consists of a loop portion, a stem portion, and a fluorescent and a quenching group. Usually, the loop portion is a nucleic acid or polypeptide sequence capable of specifically recognizing a target molecule, the stem portion is a 5-8 base complementary sequence, and the fluorescent group and the quenching group are covalently linked to the 5' end and the 3' end of the molecular beacon, respectively. As used herein, "molecular aptamer beacon (MAB)" refers to a novel probe that combines an aptamer with a molecular beacon. By utilizing the recognition and binding ability of the aptamer to the target, MBs are designed through certain sequence trimming, extension or combination for the detection of non-nucleic acid targets such as proteins and small molecules. MAB can not only detect the content of substances such as proteins, metal ions, toxins, etc. in solution, but also directly detect cells, bacteria, viruses, etc. Unless otherwise specified, "molecular beacon" and "molecular aptamer beacon (MAB)" in this article can be used interchangeably. In some embodiments, the "molecular beacon for detecting IL-2" described herein includes any of the aforementioned aptamers. In some embodiments, the aptamer or molecular beacon further includes a fluorescent group and a quenching group. Preferably, the 5' end of the aptamer or molecular beacon includes a fluorescent group and the 3' end includes a quenching group or the 3' end includes a fluorescent group and the 5' end includes a quenching group; more preferably, the 5' end of the aptamer or molecular beacon includes 6-carboxyfluorescein (6-FAM) and the 3' end includes Black Hole Quencher 1 (BHQ1). In one embodiment, the sequence of the molecular beacon nucleotides is SEQ ID NO: 37 or SEQ ID NO: 38.

[0049] As used herein, the terms "biosensor" and "probe" are used interchangeably and refer to a detection system that combines a biorecognition element (e.g., an enzyme, an antibody, a nucleic acid (DNA / RNA / cDNA), a microorganism, or a cell, etc.) with a signal transducer (e.g., a fluorophore, biotin, digoxin, or a radioisotope), capable of converting a specific interaction between biomolecules into a measurable physical or chemical signal. In some embodiments, the biosensor comprises two nucleotide strands, wherein the first nucleotide strand is a nucleic acid aptamer or molecular beacon that binds to IL-2, its 3'-end includes a linker and its 5'-end includes at least one terminal modification; the second nucleotide strand is a complementary sequence that base-pairs with the linker, and its 5'- and 3'-ends respectively include at least one terminal modification. In some embodiments, the two nucleotide strands form a secondary structure through base complementary pairing, and the secondary structure includes but is not limited to a hairpin structure, a stem-loop structure, a pseudoknot, a G-quadruplex, etc.; preferably, the two nucleotide strands further form a stem-loop structure through base complementary pairing. In some embodiments, the at least one terminal modification includes but is not limited to a terminal modified with a poly-T sequence (T-strand), a PEG-modified terminal, a fluorophore-modified terminal, a quencher-modified terminal, an affinity tag (e.g., biotin, digoxin, etc.)-modified terminal, a phosphorylation-modified terminal, a hydrophobic group (e.g., a diacyl lipid, cholesterol, etc.)-modified terminal, an amino-modified terminal, a linker-modified terminal, a Spacer (e.g., C3 Spacer, Spacer 18)-modified terminal, an insert sequence-modified terminal, a functionalized terminal, or a combination thereof. In some embodiments, the linker is a nucleotide sequence of any length, e.g., a linker having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases; preferably a linker having a length of 20 bases; and / or the complementary sequence is a nucleotide sequence of any length that base-pairs with the linker, e.g., a complementary sequence having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases. In some embodiments, the 3'-end of the first nucleotide strand includes a linker having a length of 20 bases and the 5'-end includes a fluorophore-modified terminal, the 5'-end of the second nucleotide strand includes a hydrophobic group-modified terminal and the 3'-end includes a quencher-modified terminal; preferably, the 3'-end of the first nucleotide strand includes a nucleotide sequence of An adaptor consisting of AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto, and the 5'-end includes a 6-carboxyfluorescein (6-FAM)-modified end; the 5'-end of the second nucleotide strand includes a cholesterol-modified end and the 3'-end includes a black hole quencher 1 (BHQ1)-modified end; more preferably, the second nucleotide strand includes GATTAGTACAGTTGATGTTT (SEQ ID NO: 44), TTTTTGATTAGTACAGTTGATGTTT (SEQ ID NO: 45) or a nucleotide sequence having at least 80% homology thereto. In a preferred embodiment, the 3'-end of the first nucleotide strand includes SEQ ID NO: 39 and the second nucleotide strand includes SEQ ID NO: 41.

[0050] As used herein, the terms "nucleic acid", "nucleotide", "nucleotide sequence", "oligonucleotide" or "oligonucleotide agent" are used interchangeably and refer to a polymer of nucleotides, and include but are not limited to single-stranded or double-stranded nucleic acid molecules of DNA, RNA or DNA / RNA hybrids, oligonucleotide chains containing regularly and irregularly alternating deoxyribose moieties and ribose moieties, and modified and natural or non-natural frameworks of such oligonucleotides.

[0051] As used herein, the terms "identity" and "homology" are used interchangeably and mean that there is at least 70% similarity between the nucleotide sequences. It should be understood that the specific sequences shown in the specification and claims of this application are exemplary sequences, and any sequence having more than 70% (such as 75%, 80%, 85%, 90%, 95%, 98%, 99%, more than 99.5%, or any numerical value or numerical range therebetween) homology, similarity and / or identity and capable of constructing constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors that bind interleukin-2 (IL-2) are within the scope of the nucleotide sequences described in this application.

[0052] All nucleotides of the nucleotide sequences that form constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors, etc. described herein can be natural nucleotides, i.e., unmodified nucleotides, or at least one nucleotide can be a modified nucleotide. The modifications include one or more modifications selected from the group consisting of: at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide, at least one terminal modification, at least one spacer modification, and combinations thereof. As used herein, "spacer modification" includes inserting a non-nucleotide chemical group (such as an alkyl chain, a PEG chain, etc.) at a specific position in an oligonucleotide chain as a "spacer arm" or "cleavage point" for 1) attaching functional groups (such as fluorescent labels, biotin, etc.) to reduce steric hindrance; 2) modulating the nucleic acid structure (such as adjusting double-stranded stability and avoiding interference of functional groups with hybridization); 3) introducing restriction enzyme cleavage sites or cleavage sites (such as abasic spacers).

[0053] In some embodiments, the at least one modified sugar moiety includes, but is not limited to, a 2'-O-methoxyethyl (2'-OH) modified sugar moiety, a 2'-methoxy modified sugar moiety, a 2'-O-alkyl modified sugar moiety, a bicyclic sugar moiety, a 2'-OH modified sugar moiety, a fluorine-substituted modified sugar moiety, and combinations thereof. In some embodiments, the at least one modified internucleoside linkage includes, but is not limited to, phosphorothioate, alkyl phosphonate, dithiophosphonate, alkylthiophosphonate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamidate, carboxymethyl ester, and combinations thereof. In some embodiments, the at least one modified nucleotide includes, but is not limited to, peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinonucleic acid, derivatives of peptide nucleic acid (PNA), derivatives of locked nucleic acid (LNA), derivatives of arabinonucleic acid, and combinations thereof. In some embodiments, the at least one terminal modification includes, but is not limited to, a T-strand modified terminus, a PEG modified terminus, a fluorescent group modified terminus, a quencher group modified terminus, an affinity tag (e.g., biotin, digoxin, etc.) modified terminus, a phosphorylation modified terminus, a hydrophobic group (e.g., dialkyl lipid, cholesterol, etc.) modified terminus, an amino modified terminus, a linker modified terminus, a Spacer (e.g., C3 Spacer, Spacer 18) modified terminus, an insert sequence modified terminus, a functionalized terminus, or combinations thereof. In some embodiments, the at least one spacer modification includes, but is not limited to, a fluorescent group modified non-terminal region, a quencher group modified non-terminal region, an affinity tag (e.g., biotin, digoxin, etc.) modified non-terminal region, a hydrophobic group (e.g., dialkyl lipid, cholesterol, etc.) modified non-terminal region, a complementary sequence modified non-terminal region (e.g., a complementary sequence (C strand) modified neck), a Spacer (e.g., C3 Spacer, Spacer 18) modified non-terminal region, an insert sequence modified non-terminal region, or combinations thereof.

[0054] In this text, constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors, etc. include one or more moieties selected from the group consisting of: fluorophores, quenching groups, intercalating sequences, linkers, spacers, functionalized termini, and / or combinations thereof. In some embodiments, the fluorophore is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the quenching group is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the intercalating sequence is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the linker is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties. In some embodiments, the spacer is located at the 5'-end, 3'-end, or non-terminal region of the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct, at the 5'-end, 3'-end, or non-terminal region of other moieties, and / or between the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. construct and other moieties.

[0055] As used herein, the term "fluorophore" includes one or more fluorophores selected from the group consisting of: small molecule fluorophores, nanomaterials, quantum dots, macromolecular fluorophores, and / or combinations thereof; for example, the small molecule fluorophores include, but are not limited to, 6-carboxyfluorescein (6-FAM), tetramethylrhodamine, 5-carboxytetramethylrhodamine (5-TAMRA), tetramethylrhodamine isothiocyanate (TRITC), coumarin, fluorescein isothiocyanate (FITC), cyanine dyes (such as Cy2, Cy3, Cy5, PE-Cy5.5), lanthanide chelates (such as europium Eu 3+) ROX, JOE, APC\VIC, hexachlorofluorescein; for example, the macromolecular fluorophore includes but is not limited to fluorescent proteins (such as phycoerythrin (PE)), intercalating dyes: ethidium bromide (EB), SYBR Green, ATT0647, ATT0565, Alexa Fluor488. As used herein, the term "quenching group" includes one or more quenching groups selected from the group consisting of small molecule quenchers, nanomaterial quenchers, and / or combinations thereof; for example, the small molecule quenchers include but are not limited to black hole quenchers (BHQ), black hole quencher 1 (BHQ1), black hole quencher 2 (BHQ2), black hole quencher 3 (BHQ3), black hole quencher 650 (BHQ650), 4-(4-dimethylaminophenylazo)benzoic acid (DABCYL), TAMRA, Eclipse, MGB, BHQ1; for example, the nanomaterials include but are not limited to nanocarbon materials (such as carbon nanotubes, graphene, etc.), metal nanoparticles (e.g., gold nanoparticles AuNP). As used herein, the term "insertion sequence" includes nucleotide sequences of any length that do not change the binding properties (such as IL-2) of constructs such as nucleic acid aptamers, molecular beacons, probes, biosensors, etc., for example, nucleotide sequences of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases in length. In some embodiments, the linker includes nucleotide sequences of any length, for example, linkers of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70, or more bases in length. In some preferred embodiments, a linker of 20 bases in length is preferred, for example, AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto. In the text, the terms "Spacer", "carbon chain spacer", "Spacer modification", or "spacer arm modification" can be used interchangeably. In some embodiments, the Spacer includes one or more selected from the group consisting of hydrophobic Spacer C3, C6, C12, hydrophilic Spacer9, Spacer 18, or dSpacer, Pc linker, and / or combinations thereof. In some embodiments, the functionalized terminus includes one or more selected from the group consisting of hydroxyl, carboxyl, amino, or thiol modifications and / or combinations thereof. As used herein, the term "hydrophobic group" includes one or more selected from the group consisting of dilauroyl lipid, cholesterol,, thiophosphate, hydrophobic Spacer C3, C6, C12, and / or combinations thereof.

[0056] As used herein, the terms "sample", "specimen", "biological sample", or "sample to be tested" are used interchangeably and refer to any tissue, cell, fluid, or other material from an object. In some embodiments, the sample is blood, such as serum, immune cells such as T cells, cell culture medium, or the secretory microenvironment of living cells. In some embodiments, the object is a mammal, such as a human, a non-human primate (e.g., orangutan, ape), a rodent (e.g., rat, mouse, guinea pig), a pet (e.g., cat, dog), a livestock (e.g., horse, cow, sheep, pig, rabbit).

[0057] In this text, constructs such as the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. can be used in the preparation of products for IL-2 targeted diagnosis, IL-2 targeted therapy, or detecting the level of IL-2 in a sample. In some embodiments, the product is a magnetic bead or gel resin for IL-2 detection and / or purification, a reagent and / or kit for detecting the level of IL-2, a pharmaceutical composition for IL-2 targeted therapy, etc.; preferably, the product is a kit, which contains a buffer and instructions. As used herein, a "kit" is generally defined as a package, assembly, or container (such as an insulated container) that includes one or more of the components or embodiments of the present application and / or other components related to the present application. Any agent or component of the kit can be provided in liquid form (e.g., solution) or in solid form (e.g., dry powder, frozen, etc.). In some cases, the kit includes one or more components, and the one or more components can be in the same container or in two or more containers, and / or in any combination thereof. The container is capable of holding liquid, and non-limiting examples include bottles, vials, cans, tubes, flasks, beakers, etc. In some cases, the container is spill-proof (when closed, the liquid cannot flow out of the container regardless of the orientation of the container). Examples of other compositions or components related to the constructs such as the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. described herein include, but are not limited to: diluents, salts, buffers, chelating agents, preservatives, desiccants, antimicrobial agents, needles, syringes, packaging materials, tubes, bottles, flasks, beakers, etc., for example, for using, modifying, assembling, storing, packaging, preparing, mixing, diluting, and / or preserving the components for a specific use. In embodiments where any component is in liquid form, the liquid form can be concentrated or ready-to-use. In other embodiments, the kit can include instructions in any form provided by the kit or from a website or other source for using the kit related to the constructs such as the nucleic acid aptamer, molecular beacon, probe, biosensor, etc. described herein. For example, the instructions can include instructions for the use, modification, mixing, dilution, preservation, assembly, storage, packaging, and / or preparation of the components related to the kit and / or other components. In some cases, the instructions can also include instructions for the delivery of the components (e.g., transportation or storage at room temperature, sub-zero temperature, cryogenic temperature, etc.). The instructions can be provided in any form available to the user of the kit (such as written or oral (e.g., by phone), digital, optical, visual (e.g., videotape, DVD, etc.), and / or electronic communication (including Internet or web-based communication)) in any manner. Example

[0058] The present application will be further described below in conjunction with specific embodiments and the accompanying drawings. It should be understood that these embodiments are only used to illustrate the present application and not to limit the scope of the present application. Those skilled in the art can make appropriate modifications and changes to the present invention, and these modifications and changes are within the scope of the present invention.

[0059] For the experimental methods without specific conditions indicated in the following examples, they are generally carried out under conventional conditions such as those described in Molecular Cloning: A Laboratory Manual, Fourth Edition, by Michael R. Green et al., New York, Cold Spring Harbor Laboratory Press (New York: Cold Spring Harbor Laboratory Press, 2017), or under conventional conditions, or under the conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight.

[0060] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described can be applied to the present application. The preferred implementation methods and materials described herein are for illustrative purposes only. Example 1: Screening of IL-2 nucleic acid aptamers 1. Library construction and primer design

[0061] An ssDNA library was used for the screening of IL-2 nucleic acid aptamers. Among them, the ssDNA library for screening and the PCR primers were both custom-synthesized by Sangon Biotech (Shanghai) Co., Ltd. (hereinafter referred to as "Sangon"). The library consists of single-stranded DNA with a length of 74 bases, with a 30-base random sequence in the middle and fixed primer sequences at both ends. The library and primer sequences used for screening are as follows: Table 1. ssDNA library for screening 5B indicates that the 5'-end is modified with a Biotin group. 0217-F and 0217-R-5B are used for each round of symmetric PCR to amplify and enrich the sequences and obtain the secondary library, and 0217-F-5B is used for asymmetric PCR to generate ssDNA. Unmodified F and R are used for amplifying dsDNA and ligating with the T vector. 2. Connection of protein to Protein A solid-phase carrier

[0062] The recombinant proteins IL-2-Fc-His and IgG1-Fc-His with His tags were expressed using the 293T eukaryotic expression system. The plasmid for expressing IL-2-Fc-His was constructed for this experiment, and other plasmids were stored in the laboratory before. [2&3]。The vector used is the pSB plasmid independently constructed in the laboratory. This plasmid utilizes the principle of the transposon system to insert the target DNA sequence into the genome of the host cell to achieve stable transfection. Since it contains both the transposase and the transposon sequence, the operation is more convenient and the transfection efficiency is higher. The nucleic acid sequence expressing IL-2-Fc-His is shown in SEQ ID NO: 4; the corresponding amino acid sequence is shown in SEQ ID NO: 5.

[0063] To connect the protein to the Protein A solid-phase carrier, 1 mg of IL-2-Fc-His and IgG1-Fc-His were respectively mixed with 200 μL of Protein A agarose resin after removing the supernatant, and rotated overnight at 4°C. The next day, the supernatant protein concentration was detected by centrifugation to determine whether the protein was bound to the carrier. The supernatant was removed, and the precipitate was washed twice with 200 μL of Binding buffer, and finally resuspended with 500 μL of Binding buffer, aliquoted, and stored in a refrigerator at 4°C. Binding buffer was prepared by adding MgCl2 with a final concentration of 1 mM to D-PBS. 3. Systematic Evolution of Ligands by Exponential Enrichment (SELEX)

[0064] A 5 nmole random ssDNA library was used as the starting library. Before each round of screening, the library was incubated in a metal bath at 95°C for 5 min and then rapidly cooled on ice for 5 min before incubation with the target. In the first and second rounds, only IL-2-Fc-His was used for positive screening, aiming to retain the diversity of the library as much as possible and amplify the single-copy sequences that could bind. After centrifuging the immobilized target to be bound, the supernatant was discarded, and it was incubated with the library at 37°C for a certain time. After centrifugation, the precipitate was washed three times with Binding buffer, and subsequent PCR and single-strandization steps were carried out. From the third round, a blank vector was added for negative screening. First, the Protein A agarose resin without bound protein was incubated with the library to remove the sequences that non-specifically adsorbed to the carrier. The supernatant after that was then incubated with IL-2-Fc-His. From the fifth round, IgG1-Fc-His was used for counter-screening to remove the sequences that bound to the Fc fragment and 6His. All incubations were carried out at 37°C. In each round, the screening pressure was increased by changing the protein dosage, incubation time, washing times, and intensity, so that the sequences specifically binding to IL-2 were enriched.

[0065] The screening conditions set for each round are shown in Table 2 below. Table 2. Screening conditions set for each round 4. Monitoring the progress of library screening by ELONA method

[0066] Asymmetric PCR amplification was performed on the 2nd, 4th, 5th, 6th, 7th, and 8th rounds of dsDNA using a forward primer modified with Biotin, and ELONA was performed to monitor the enrichment of the library.

[0067] After generating dsDNA by symmetric PCR, a 200 μL asymmetric PCR system was prepared. Table 3. Asymmetric PCR amplification

[0068] The reaction program was pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s, with 30 cycles of amplification; finally, extension at 72°C for 30 s and maintained at 4°C. The product after the reaction was purified by ethanol-sodium acetate precipitation for ELONA.

[0069] One day in advance, 96-well enzyme-linked immunosorbent assay (ELISA) plates were coated with recombinant human IL-2 for injection (Beijing SL, hereinafter referred to as "commercial IL-2" to distinguish it from IL-2 expressed in the laboratory), IL-2-Fc-His, IgG1-Fc-His, IgG1-Fc, and BSA. 2500 IU of commercial IL-2 was added to each well, and 2 μg of other proteins was added to each well, and left to stand overnight at 4°C. The next day, the plates were washed five times with PBST solution containing 0.5% Tween 20 and 1 mM MgCl2. 100 μL of 1.5% BSA was added and blocked at 37°C for 1 h, and then washed 5 times. Then, 100 μL of 200 nM nucleic acid solution was incubated at 37°C for 1 h, followed by the addition of HRP-conjugated streptavidin secondary antibody, and bound at 37°C for 30 min. TMB was used for color development and the absorbance at 650 nm was detected. 5. Cloning, sequencing, and verification of the enriched library

[0070] The screening libraries obtained in the sixth and seventh rounds were used to amplify dsDNA with unmodified primers, ligated to the T vector, and sent to the company for sequencing. Homology analysis was performed on the sequencing results. The enriched sequences were synthesized by the company into ssDNA modified with Biotin, and the binding to IL-2 was detected by ELONA. The specifically binding sequences were further truncated, optimized, and synthesized for verification.

[0071] Discussion and analysis

[0072] Screening of IL-2 nucleic acid aptamers using an ssDNA library, with IL-2-Fc-His as the positive selection and protein A vector or IgG1-Fc-His as the negative selection, for a total of 8 rounds of screening. At the 6th round, the screening process was monitored. IL-2-Fc-His, IgG1-Fc-His, IgG1-Fc, BSA, and commercially available IL-2 were coated on the bottom of a 96-well ELISA plate. Asymmetric PCR was used to obtain the ssDNA libraries of the 2nd, 4th, 5th, and 6th rounds and ELONA was performed. The results showed that the binding of the library to IL-2 and IL-2-Fc-His began to increase from the fifth round ( Figure 1 A). Two more rounds of screening were continued. The ELONA results showed that the binding of the library to IL-2 remained basically unchanged, but the binding to IgG1-Fc-His gradually increased ( Figure 1 B). The agarose gel electrophoresis images of the library cycle numbers optimized for rounds 5 - 8 are shown in Figure 1 C, and it can be seen that non-target miscellaneous bands began to show obvious amplification from the seventh round.

[0073] The libraries of the 6th and 7th rounds were selected for the next step of cloning and sequencing. After the library was ligated to the T vector, it was transformed and plated, and the bacterial plates were sent to the company for sequencing. 40 clones were selected from each of the two rounds and submitted to the supplier for sequencing. Multiple sequence alignment and homology analysis were performed on the results, and 10 enriched sequences were obtained and truncated and optimized as follows: Table 4. Enriched sequences

[0074] The binding ability of the above 10 sequences was detected by ELONA, and the results are shown in Figure 2 . Except for sequences 4 and 38, all can bind to IL-2 and IL-2-Fc-His. Among them, 1 is a miscellaneous band, and among the other sequences, 8, 24, and 35 have relatively high specificity. Therefore, these three sequences were selected for the next step of truncation optimization and verification.

[0075] We used the DNA Secondary Structure Predictor tool on the website of Yunzhou Biosciences to predict the secondary structures of the three sequences, and based on this, truncated and optimized them, minimizing the number of bases as much as possible while maintaining a specific conformation to reduce production costs. The truncated sequences are shown in the following table, and the secondary structure predictions of each sequence before and after truncation are shown in Figure 3 . Table 5. Truncated sequences

[0076] Further analysis of the core sequences after sequence truncation, based on the existing experience in the laboratory, determined that the core sequences of the truncated sequences are respectively:

[0077] Apt8-core (TCGTTCGGGACTGCTCGGGATTGCGGATA: SEQ ID NO: 21);

[0078] Apt24-core (CGTCACTCTGCTTTGGAAGTGCTGGTTGTGTGATG: SEQ ID NO: 22);

[0079] Apt35-core (CCACTAGAGGGCCTGCTCTGGATTGCGTAACGGGTAGTGG: SEQ ID NO: 23). Example 2: Prokaryotic System Protein Expression and Purification

[0080] Considering that a large amount of IL-2 is required for subsequent experiments, and the purchased IL-2 contains other components such as human serum albumin, this project reconstructed the plasmid expressing IL-2 and produced recombinant IL-2 with only His-tag without other fragments using the prokaryotic expression system. The core sequence of protein expression is shown in SEQ ID NO: 24; the corresponding amino acid sequence is shown in SEQ ID NO: 25.

[0081] Since both IL-2 and IL-15 are members of the γc receptor cytokine family, have common receptor subunits IL-2 / 15Rβ (CD122) and IL-2Rγ (CD132), and are structurally similar, it is necessary to investigate the specificity of the nucleic acid aptamer binding to the two.

[0082] Transfer the recombinant plasmid IL-2-6H (the core sequence for protein expression is SEQ ID NO: 26, and the corresponding amino acid sequence is SEQ ID NO: 27), as well as IL-2-catch-6H (the core sequence for protein expression is SEQ ID NO: 28, and the corresponding amino acid sequence is SEQ ID NO: 29) and IL-15-catch-6H (the core sequence for protein expression is SEQ ID NO: 30, and the corresponding amino acid sequence is SEQ ID NO: 31) plasmids stored in the laboratory, into BL21 Escherichia coli for expression. Pick monoclonal colonies and inoculate them into 6 mL of kanamycin-resistant LB medium, and shake the bacteria overnight at 37°C and 220 rpm. The next day, expand the culture at a ratio of 1:100 and continue to shake the bacteria for 3 - 6 h until the OD600 value is about 0.6. Add IPTG with a final concentration of 0.5 mM and induce overnight at 16°C and 200 rpm. The next day, transfer the bacterial solution to a 50 mL centrifuge tube, centrifuge at 3500 rpm for 7 min, discard the supernatant, add an appropriate amount of PBS to wash the bacterial cells, centrifuge again and discard the supernatant, and resuspend with 20 mL of PBS solution containing 6 M urea. Then use an ultrasonic crusher to lyse the bacterial cells at low temperature: insert the centrifuge tube into an ice-water mixture during ultrasonic treatment, adjust the power to 30%, break for 5 s, pause for 3 s, and ultrasonic for 20 min. At this time, the solution can be seen to become clear. After all the bacteria are completely lysed, add an imidazole solution with a final concentration of 20 mM, centrifuge at 4°C and 4000 rpm for 7 min to precipitate the bacterial cell debris. Use nickel agarose purification resin to purify the protein. Use different concentrations of imidazole solution for gradient elution, and perform SDS-Page gel electrophoresis and Coomassie brilliant blue staining on the eluted liquid to determine the concentration of the concentrate. The molecular weight of IL-2-6H is about 17 kDa, and a 3 kDa protein concentrator is used for concentration. The molecular weights of IL-2-catch-6H and IL-15-catch-6H are about 35 kDa, and a 10 kDa protein concentrator is used for concentration. The purified protein is electrophoresed using a 15% SDS-Page gel to verify the protein size and purity, and the results are as Figure 4 shown. Example 3: Protein Quantification by BCA Method

[0083] The concentration of the obtained IL-2-6H was detected using the BCA method. According to the number of samples, the required BCA working solution was prepared at 50 volumes of reagent A: 1 volume of reagent B, and stored at room temperature after sufficient mixing. The protein standard 0.5 mg / mL was added to a 96-well plate at a volume of 0, 1, 2, 4, 8, 12, 16, and 20 μL, and PBS was added to 20 μL, with the final concentrations corresponding to 0, 0.025, 0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mg / mL, respectively. Take 20 μL of the protein to be tested and add it to a 96-well plate, add 200 μL of BCA working solution to each well, react at 37°C for 30 minutes, and read the absorbance at 562 nm with an enzyme reader. Draw a standard curve based on the absorbance of the standard, and calculate the concentration of the sample to be tested. Example 4: Analysis of specificity and affinity of nucleic acid aptamers binding to IL-2

[0084] We ordered synthetic aptamers with biotin modification and truncated optimization from Sangon, and used ELONA to detect the specificity of each sequence to IL-2. The sequence information is shown in the table below. Table 6. Modified and optimized nucleic acid aptamers

[0085] Commercial IL-2 was used, 2500 IU per well was coated, and different concentrations of nucleic acid aptamers were combined to detect the absorbance at 650 nm to calculate the equilibrium dissociation constant.

[0086] The optimized sequences Apt8-1, 8-2, 24-1, 24-2, and 35 were specifically characterized to detect affinity. 2500 IU of commercial IL-2, 2 μg of IL-2-Fc-His, IgG1-Fc-His, and BSA were coated on a 96-well ELISA plate, and 100 μL of 200 nM biotin-modified aptamers were added for detection. The results showed that 8-2, 24-2, and 35 had better specificity, while 8-1 and 24-1 also had a certain binding to IgG1-Fc-His ( Figure 5 A). The affinity of the three sequences was tested using commercial IL-2. Apt35 had the highest affinity, followed by 24-2 ( Figure 5 B). Example 5: Specificity of nucleic acid aptamers for IL-2 and IL-15

[0087] As mentioned above, IL-2 and IL-15 are both members of the γc receptor cytokine family, and have common receptor subunits IL-2 / 15Rβ (CD122) and IL-2Rγ (CD132), which are structurally similar. Therefore, it is necessary to examine the specificity of nucleic acid aptamers binding to the two.

[0088] As described in the above embodiments, ELONA was used to detect the binding of Apt8-2, 24-2, 35 to three proteins. The results showed that Apt24-2 and Apt35 could specifically bind to IL-2 but not to IL-15, while Apt8-2 had a slight binding to IL-15( Figure 6 ), and subsequent experiments were continued using Apt24-2 (abbreviated as Apt24) and Apt35. Example 6: Detection of IL-2 Concentration in Solution by Nucleic Acid Aptamer Molecular Probe

[0089] Apt24 and Apt35 were modified to construct nucleic acid aptamer molecular beacons for rapid detection of IL-2 concentration in solution. 6-FAM and BHQ1 were respectively modified at the 5' end and 3' end of the sequence. The above nucleic acid aptamer molecular beacons were synthesized by Shanghai Saiheng Biotechnology Co., Ltd. (abbreviated as "Saiheng"), and the sequences are shown in the following table. Table 7. Nucleic Acid Aptamer Molecular Beacons Constructed by Modification

[0090] The synthesized probe dry powder was first centrifuged at 12,000 rpm for 1 min, and an appropriate amount of Binding buffer was added to dissolve it into 10 μM. Before use, it was placed in a metal bath at 95 °C for 5 min and immediately cooled on ice for 5 min. For the detection of recombinant protein samples, 50 μL of a 40 μg / mL recombinant protein solution was added to a 96-well plate, and then 50 μL of the probe solution was added to make the final concentration of the probe 50 nM. After incubating in the dark at room temperature for 10 min, the fluorescence intensity at 485 / 528 nm was detected by an enzyme-labeled instrument. For the detection of recombinant cytokines, 1 μg of cytokine was added to each well of a 96-well plate, the final concentration of the probe was 50 nM, the reaction system was 100 μL, and after incubating in the dark at room temperature for 10 min, it was detected by an enzyme-labeled instrument.

[0091] The data were expressed as mean ± standard deviation, with three replicates set for each group, and GraphPad Prism 9.0 software was used for analysis and graphing. Unpaired t-test was used for comparison between two groups, and One-way ANOVA test was used for comparison of three groups and above. p < 0.05 indicated that the data had statistical differences.

[0092] When IL-2 was present in the solution, the binding of the nucleic acid aptamer to IL-2 caused a conformational change, and fluorescence could be detected. The detection ability of the probe was verified using each produced recombinant protein, and the results showed that it could better distinguish the protein with IL-2 and the control protein( Figure 7 A and B). The fluorescence value increased with the increase of protein concentration when detecting different concentrations of IL-2-6H, and it was linear within a certain range, so the IL-2 concentration could be quantified accordingly( Figure 7 C).

[0093] In addition, we detected a variety of recombinant human cytokines (TGF-β, IL-6, IGF-1, VCAM-1) stored in the laboratory. We used Apt24-MB and Apt35-MB to detect IL-2 and other human cytokines. The final concentration of the factors was 10 μg / mL, and the relative fluorescence intensity (%) was calculated as follows: (fluorescence intensity of each well - background fluorescence intensity) / [(average fluorescence intensity of (IL-2 fluorescence intensity - background fluorescence intensity))] × 100. The results showed that the probe also had a high resolution ability for IL-2 ( Figure 8 ).

[0094] Since IL-2 exerts its effects through paracrine or autocrine pathways, the inflammatory state of the body or the impact of treatment factors on the immune system can be judged by detecting the level of IL-2 in samples such as peripheral blood in clinical or scientific research. We also verified the detection ability of the two probes for cytokines in serum with different contents of FBS solution. IL-2-6H, BSA, and PBS were diluted with Bindingbuffer solution containing different proportions of FBS, and molecular beacon probes were added for detection, so that the final concentration of FBS was 0%, 10%, 20%, and 50%. F0 represents the average fluorescence intensity of the PBS group at this ratio. The results showed that even in an environment of 50% FBS, the two MABs still maintained the detection ability for IL-2 ( Figure 9 ).

[0095] In summary, the inventors screened two ssDNA aptamers with high specificity and affinity for human IL-2: Apt24 and Apt35, among which the binding Kd value of Apt35 was about 66 nM. Transforming the two sequences into nucleic acid aptamer molecular beacons can be used for the rapid detection of IL-2 in solution. Although there is a non-specific increase in fluorescence for some unrelated proteins, it can be distinguished from the IL-2 group, and the two probes still maintain good performance in an environment of high-concentration serum, providing a tool for IL-2 targeted diagnosis, IL-2 targeted therapy, or detecting the level of IL-2 in samples (such as blood, such as serum, immune cells such as T cells, cell culture medium, or the microenvironment secreted by living cells). Example 7: Construction and application of a membrane-anchored IL-2 detection probe 1. Reagents and consumables

[0096] The used Jurkat cells (human T lymphocyte leukemia cell line) and CAR-Jurkat cells were preserved in the laboratory. All sequences were ordered from Saiheng. Among them, the complementary strand 20L-3B with BHQ1 was used to investigate the ability of the probe to detect IL-2, the cholesterol-modified 20L-5T-5C was used to verify the ability of the probe to modify cells, and the 20L-5T-5C3B with cholesterol and BHQ1 was used to construct a membrane-bound nucleic acid probe. Subsequently, the IL-2 probe with both detection and membrane-binding abilities was referred to as chol-Apt35. The nucleic acid sequences used in this example are shown in the following table. Table 8. Nucleic acid sequences used in the examples 2. Construction of the probe and verification of the probe's ability to detect IL-2

[0097] Using Apt35, a split nucleic acid aptamer molecular beacon was designed and synthesized, which consists of two parts: one is a FAM-modified nucleic acid aptamer Apt35 with an added linker (for example, a linker with a length of at least 20 bases, such as AAACATCAACTGTACTAATC (SEQ ID NO: 43)), and the other is a complementary sequence of the linker region with BHQ1 (for example, a complementary sequence with a length of at least 20 bases, such as GATTAGTACAGTTGATGTTT (SEQ ID NO: 44) or TTTTTGATTAGTACAGTTGATGTTT (SEQ ID NO: 45)). After dissolving them in Binding buffer to a concentration of 10 μM, they were mixed in a volume ratio of 1:1, and incubated in a metal bath at 95 °C for 5 min, then slowly cooled to room temperature. The probe with a final concentration of 50 nM was used to detect IL-2-6H and the control, with the final protein concentration of 20 μg / mL, and the fluorescence intensity at 485 / 528 nm was detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0098] The experimental results are as Figure 11 shown. The fluorescence intensity of the IL-2-6H group was significantly enhanced compared with each control, while there was no difference between other proteins and the PBS group, indicating that this probe can be used for the specific detection of IL-2. 3. Detection of the ability of the membrane-anchored nucleic acid probe to modify cells

[0099] To verify whether the cholesterol-modified nucleic acid probe chol-Apt35 has the ability to insert into the cell membrane, Apt35-20L-5F was mixed with cholesterol-modified 20L-5T-5C at a ratio of 1:1, and incubated in a metal bath at 95 °C for 5 min, then slowly cooled to room temperature in the dark. Jurkat cells were centrifuged to discard the culture medium and washed once with PBS buffer. Cells were incubated with the probe at a density of 5×105 cells per tube, and the fluorescence intensity of the cells was detected at different concentrations or for different time periods. For the detection of probe concentration, cells were incubated with the probe at final concentrations of 10, 50, 100, 200, 500 nM, 1 μM, and 2 μM, and left standing at room temperature for 20 min. For the detection of incubation time, the final concentration of the probe was set at 200 nM, and the cells were incubated at room temperature for 5, 10, 20, 30, 60, and 120 min. After incubation, the cells were washed twice with PBS, and the fluorescence intensity on the cell surface was detected using a flow cytometer. In the confocal fluorescence imaging experiment, Jurkat cells were first labeled with Hoechst33342, incubated at room temperature at a ratio of 1:2000 for 20 min, and then washed with PBS. Then, the cells were incubated with the probe at a final concentration of 200 nM at room temperature for 20 min, washed twice with PBS, resuspended in 100 μL of Binding buffer, dropped onto a 35 mnm glass-bottom dish, and observed using a high-resolution confocal microscope.

[0100] As Figure 12 shown, when cells were incubated with probes at different concentrations, it was visible that at the same time, as the probe concentration increased, the fluorescence intensity on the cell surface increased, indicating that more probes inserted into the membrane ( Figure 12 A). The fluorescence increase gradually slowed down above 200 nM, and it had a greater impact on cell viability ( Figure 12 B). When the probe concentration was fixed at 200 nM and incubated at room temperature for different lengths of time, the results showed that the probes on the cell surface could reach a basic saturation in only 10 min ( Figure 12 C), while extending the incubation time had no obvious effect on cell viability ( Figure 12 D). Using confocal microscopy for imaging, it was visible that the probes were evenly distributed on the cell membrane ( Figure 12 E). 4. Characterization of the directivity and stability of the membrane-anchored nucleic acid probe

[0101] Since the probe is essentially ssDNA, the orientation of probe modification can be determined by using DNase I digestion to reduce fluorescence. After labeling Jurkat cells with Hoechst33342, they were incubated with 200 nM probe at room temperature for 20 min. The unbound probe was washed away, then 200 μL of 5 U / mL DNase I was added and digested at 37 °C for 10 min. The digestion was terminated by washing once with PBS, and then observations were made under a confocal microscope. To explore the stability of probe modification on the cell surface, after incubating Jurkat cells and washing away the excess probe, the cells were resuspended with Binding buffer and left standing at room temperature for 1 h, and then placed in an environment at 37 °C for 1 h. Confocal imaging was performed at the time points of 30, 60, 90, and 120 min respectively.

[0102] It is known that DNase I is an endonuclease that can digest single-stranded or double-stranded DNA. If the probe is modified on the outer side of the cell membrane, fluorescence will be lost due to enzyme degradation. As Figure 13 shown, after adding 1 U DNase I to the cells and treating them at 37 °C for 10 min, the surrounding green fluorescence disappeared significantly, proving that the probe was modified on the outer side of the cells.

[0103] Due to the fluidity of the cell membrane, the ability of the probe to stably exist on the membrane is also an important factor affecting its performance. We performed confocal imaging at 30, 60, 90, and 120 min after modifying the cells with the probe, and the results showed that the surface fluorescence hardly changed ( Figure 14 ). The above results prove that this probe can be simply and efficiently modified on the outer side of the cell membrane and has good stability. 5. Detection of IL-2 in the surrounding solution of cells by membrane-anchored nucleic acid probes

[0104] Next, we further verified whether the probe still had the ability to detect IL-2 after being modified on the cell surface. Jurkat cells or T cells were respectively combined with chol-Apt35 and incubated at a final concentration of 100 nM at room temperature for 20 min. After washing twice with PBS to remove the unbound probe, the cells were resuspended with Binding buffer. Different final concentrations of IL-2-6H protein diluted with Binding buffer solution were added, and they were incubated at 37 °C for 30 min. After washing once with PBS, the cells were resuspended with 200 μL of Binding buffer, and dead cells were labeled with DAPI and then detected by flow cytometry. In the confocal detection experiment, after labeling the cells with the probe and incubating them with IL-2-6H, Hoechst33342 was used to stain the cell nuclei at room temperature. After washing with PBS, the cells were resuspended with 100 μL of Binding buffer, dropped onto a 35 mm glass-bottom culture dish, and observed and photographed under a confocal microscope.

[0105] The results showed that as the concentration of IL-2 increased, the fluorescence on the cell surface enhanced, demonstrating that the probe embedded in the cell membrane could still effectively bind to IL-2 and change its conformation to emit fluorescence. Figure 15 A). The results of confocal microscopy imaging also showed that a ring of high fluorescence signal would appear on the cell surface in the solution containing IL-2. Figure 15 B), further demonstrating the ability of this probe to detect IL-2 on the cell surface. 6. Detection of IL-2 secretion by T cells stimulated at different times

[0106] IL-2 is mainly secreted by activated T cells, and the activation degree of T cells can be judged by detecting IL-2. To investigate the performance of the chol-Apt35 probe in practical applications, T cells and Nalm6 cells were cultured for 48 h under the conditions of stimulation with or without CD3 / CD28 antibodies, and then the probe constructed in this study and flow antibodies were used to detect IL-2 secretion.

[0107] Coat 24-well plates one day in advance, with the final concentration of CD3 / CD28 antibody being 5 μg / mL, and let it stand overnight at 4°C. Resuscitate T cells, seed 1×106 cells per well, and culture them in 1 mL of x-VIVo15 serum-free medium. Nalm6 cells were treated under the same conditions as a control. After 48 h of stimulation, aspirate 150 μL of T cells and Nalm6 cells, add 50 μL of chol-Apt35 to make the final concentration of the probe 50 nM, continue to incubate at 37°C for 2 h, wash with PBS, add DAPI, and then detect with a flow cytometer. For the remaining cells, after 48 h of stimulation, add 1000× GolgiStop protein transport inhibitor, block at 37°C for 4 h, then centrifuge to discard the supernatant, fix and permeabilize using the BD Cytofix / Cytoperm kit, and detect by flow cytometry after labeling with IL-2 antibody at a ratio of 1:200. For the detection of IL-2 secretion at different activation times, stimulate T cells with CD3 / CD28 antibody 48, 36, 24, and 12 h in advance respectively. In the antibody detection group, add GolgiStop to block protein transport at the last 4 hours, and in the probe detection group, add the probe at a final concentration of 50 nM and incubate for the last 2 h, and the remaining operations are the same as before.

[0108] As Figure 16 shown in A, the results of both detection methods showed that after stimulation with CD3 / CD28, the secretion of IL-2 by T cells increased, while the IL-2 level of Nalm6 did not change. The activation degree of T cells increased with the extension of the stimulation time within 48 h. Detection at different time points showed that the secretion of IL-2 also gradually increased, and the results of the probe and flow antibody detections had a high consistency. Figure 16 B and C). 7. Plasmid transformation and extraction

[0109] The CD19-CAR plasmid, pMD2.G, and psPAX2 packaging plasmids are all stored in the laboratory. When amplifying the plasmids, they are respectively transformed into DH5α Escherichia coli, activated, and then spread on LB plates containing 50 μg / mL sodium ampicillin. After colonies grow, single colonies are picked and cultured in a shaker to expand the culture. The plasmids are extracted using the Tiangen endotoxin-free small-scale midiprep kit. After detecting the concentration with Nanodrop, they can be stored in a -20°C refrigerator. 8. CD19-CAR virus packaging and infection

[0110] One night before virus packaging, HEK293T cells are passaged and plated. Each 10-cm culture dish is plated with 1×107 cells and cultured in DMEM containing 10% FBS. The next day, transfection is carried out using liposome transfection reagent. Prepare solution A and solution B according to the following system: (for each dish) Solution A: 500 μL Opti-MEM medium + 40 μL liposome transfection reagent, let stand at room temperature for 5 min; Solution B: 8 μg CD19-CAR plasmid, 6 μg psPAX2 plasmid, 4 μg pMD2.G, add and mix with 500 μL Opti-MEM medium, and prepare according to the number of dishes to be packaged. Mix solution A and solution B, let stand at room temperature for 20 min. During this period, change half of the cell culture medium. Then add 1 mL of the mixed solution to each dish and shake well, and place in a 37°C incubator for culture. The supernatant is collected at 48 h and 72 h after transfection respectively. The supernatant is filtered through a 0.45-μm filter membrane to remove cell debris, added to an ultra-high-speed centrifuge tube, strictly balanced, and centrifuged at 25,000 rpm at 4°C for 2 h. After centrifugation, pour out and aspirate the remaining supernatant completely. Resuspend the virus pellet at a ratio of 50 μL PBS per dish, aliquot, and store in a -80°C refrigerator or directly infect T cells.

[0111] T cells are stimulated and activated with CD3 / CD28 antibodies for 48 h before virus infection. The activated T cells are transferred to a centrifuge tube and centrifuged at 1500 rpm for 5 min. Discard the supernatant and resuspend with T cell medium. After counting, adjust the cell concentration to 1×106 / mL. Plate the cells in a 12-well plate, 1 mL per well, add the virus and Polybrene at a final concentration of 10 μg / mL. Different volumes of virus solution can be added for the first infection to explore the optimal concentration. Change the medium 12 h after infection and continue to culture under normal conditions. The detection of the CAR positive rate can be carried out 48 h after infection. Take 5×105 CAR-T and control T cells, label the antibodies at a ratio of 1:200, incubate at 4°C for 30 min, wash once with PBS, and then perform flow cytometry detection. 9. Detection of IL-2 secretion in the CAR-T killing system

[0112] 1) Laser confocal imaging. Label Nalm6 cells with Hoechst33342, incubate at room temperature for 20 min at a ratio of 1:2000. After incubation, wash three times with PBS to remove residual dye as much as possible. Label CAR-Jurkat cells with cpd, adjust the cell concentration to 5×106 / mL, add cpd at a final concentration of 2.5 μM, and incubate at 37 °C for 15 min. Add FBS to terminate staining, centrifuge at 1500 rpm for 5 min, discard the supernatant, and then wash twice with 10% FBS 1640 and once with PBS. Resuspend the cells in Binding buffer and adjust the concentration to 2x106 / mL. Take 100 μL of each of the two types of cells and mix them, incubate at 37 °C for 4 h, and add chol-Apt35 at a final concentration of 50 nM at the 2nd h. After mixing, continue the incubation. Set up a separate CAR-Jurkat labeled probe as a control under normal conditions. After incubation, wash the cells once with PBS, resuspend them in 100 μL of Binding buffer, and then pipette them into a 35 mm optical culture dish for confocal microscopy imaging. Since Hoechst is very likely to diffuse into adjacent cells, corresponding fluorescence is also detected in CAR-Jurkat cells during the final observation. As Figure 17 shown, obvious fluorescence appears around the cells under the stimulation of Nalm6, indicating that CAR-Jurkat cells are activated after being stimulated by the target antigen and secrete increased amounts of IL-2.

[0113] 2) Detection of IL-2 secretion by CAR-T cells with different ET ratios. Stain CAR-T cells with cpd dye using the same method as before. After aspirating the required number of Nalm6 or CD19-KO Nalm6 cells and centrifuging to discard the supernatant, wash once with PBS. Resuspend all three types of cells in X-VIVO15 medium and plate them in a 96-well plate at ratios of 1:1, 1:2, 1:5, and 1:10. The number of target cells is fixed at 2×105 / well, and the number of CAR-T cells is adjusted according to the effector-to-target ratio. The total volume is 200 μL, and co-incubate at 37 °C. In the antibody detection group, add 1000×GolgiStop after 2 h of incubation. In the probe detection group, add chol-Apt35 at a final concentration of 50 nM, mix well, and continue the incubation for 2 h. After 2 h, aspirate the PBS from the probe group, wash once, and then directly perform flow cytometry detection. The antibody group is detected after steps such as washing, fixation, permeabilization, and antibody labeling.

[0114] The T cells were infected with CD19-CAR virus 48 h after stimulation. After detection, the positive rate of CAR can reach 50%-60% ( Figure 18A). Plate CAR-T cells and Nalm6 cells with CD19 knockout separately, and detect the activation effect of tumor cells on CAR-T at different ET ratios. CD19 knockout mimics the situation of antigen loss during clinical CAR-T treatment. An increase in the ET ratio means that one effector cell needs to kill more tumor cells and receive more antigen stimulation. The results of probe detection show that the stimulation effect of Nalm6 with CD19 knockout on CAR-T becomes weaker, the secretion of IL-2 is always lower than that of normal Nalm6, and the secretion of IL-2 also increases with the increase of the ET ratio. Figure 18 B). The results of flow antibody detection are consistent with the probe trend. Figure 18 C). Therefore, one of the advantages of this probe compared with flow antibodies is that it does not require cell fixation, permeabilization, and multiple washings, and can detect live cells that are exerting recognition and killing effects, and can distinguish the differences in IL-2 secretion between CAR-T cells that are bound and unbound to target cells in the same system.

[0115] 3) Detection of IL-2 secretion by activated and non-activated CAR-T cells in the same system. Label Nalm6 cells with anti-CD10 antibody, incubate at 4°C for 30 min at a ratio of 1:200, and then wash away the unbound antibody. Label CAR-T cells with cpd dye. Mix 2×105 of each type of cell and incubate. Add a probe with a final concentration of 50 nM at 2 h and continue to incubate for 2 h. Label probe alone with CAR-T cells as the control for the non-activated state. After incubation, centrifuge to discard the supernatant, resuspend the cells in Binding buffer and label with DAPI for flow cytometry detection. Compare the differences in IL-2 secretion between the double-positive (CAR-T and Nalm6 bound) and cpd single-positive (CAR-T) cell populations in the co-culture system.

[0116] Label Nalm6 with CD10 antibody and CAR-T cells with cpd dye. After co-incubation, detect using the chol-Apt35 probe. The double-positive cell population represents that CAR-T cells recognize and bind to Nalm6, and the two are connected to form an immunological synapse. The cpd single-positive cell population means that CAR-T has not bound to Nalm6 temporarily. Correspondingly, the FAM fluorescence intensity of double-positive cells is much higher than that of single-positive cells. Figure 19 A), and there is no significant difference in the fluorescence intensity between single-positive cells and control CAR-T cells without antigen stimulation. Figure 19 B), proving that this part of the cells has not been stimulated and activated. This experiment effectively distinguishes the IL-2 secretion of effector cells that are and are not exerting killing effects in the same system. 10. Discussion and analysis

[0117] In this embodiment, we constructed a membrane-anchored nucleic acid probe chol-Apt35 that can detect the IL-2 secretion of living cells. One end of the probe is modified with cholesterol to insert into the cell membrane, which can label cells quickly and efficiently and has high stability. The hydrophilic DNA strand is exposed outside the membrane, and the principle of molecular beacon is used to detect IL-2 in the cell microenvironment. We used this probe to detect the IL-2 secretion of T cells or CAR-T cells. The results were highly consistent with those of flow cytometry antibodies, but did not require blocking, permeabilization and fixation, and multiple washings. Only incubation was needed followed by washing and then loading onto the instrument. It can not only detect the changes in IL-2 secretion by T cells at different stimulation times, but also distinguish the differences in IL-2 expression levels of T cells in different activation states in the same system. In summary, we fully verified the performance of this probe through a variety of experiments, demonstrating that it can be used as a new tool for cell IL-2 detection.

[0118] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art can also make various equivalent modifications or substitutions without departing from the spirit of the present invention, and these equivalent modifications or substitutions are all included within the scope defined by the claims of this application. References 1. MOMENI M, MASHAYEKHI K, NAVASHENAQ J G, et al. Identification of G-quadruplex anti-Interleukin-2 aptamer with high specificity through sELEX stringency[J]. Heliyon, 2022, 8(6): e09721. 2. ZHENG W W, YANG L T, ZHOU H, et al. A novel aptamer beacon for rapid screening of recombinant cells and in vivo monitoring of recombinant proteins[J]. Applied microbiology and biotechnology, 2023, 107(2 - 3): 553 - 67. 3. Zhou H, Abudureheman T, Zheng W W, et al. CAR-Aptamers Enable Traceless Enrichment and Monitoring of CAR-Positive Cells and Overcome Tumor Immune Escape[J]. Advanced science (weinheim, Baden-Wurtemberg, Germany), 2023: e2305566.

Claims

1. A biosensor, which comprises two nucleotide chains, wherein, The first nucleotide chain is a nucleic acid aptamer or molecular beacon that binds to IL-2, its 3'-end includes a linker and its 5'-end includes at least one terminal modification; The second nucleotide chain is a complementary sequence that base pairs with the linker, and its 5'- and 3'-ends respectively include at least one terminal modification.

2. The biosensor according to claim 1, wherein, The nucleic acid aptamer or molecular beacon includes a nucleotide sequence selected from the group consisting of or a nucleotide sequence having at least 80% homology with any nucleotide sequence selected from the group consisting of: Apt8-1 (SEQ ID NO: 16); Apt8-2 / Apt8-core (SEQ ID NO: 17); Apt24-1 (SEQ ID NO: 18); Apt24-2 (SEQ ID NO: 19); Apt35 (SEQ ID NO: 20); Apt24-core (SEQ ID NO: 22); and / or Apt35-core (SEQ ID NO: 23).

3. The biosensor according to any one of the preceding claims, wherein, The two nucleotide chains form a secondary structure through base complementary pairing, and the secondary structure includes but is not limited to a hairpin structure, a stem-loop structure, a pseudoknot, a G-quadruplex, etc.; preferably, the two nucleotide chains further form a stem-loop structure through base complementary pairing.

4. The biosensor according to any one of the preceding claims, wherein, The at least one terminal modification includes but is not limited to a terminal modified with a poly-T sequence (T-strand), a PEG-modified terminal, a fluorescent group-modified terminal, a quenching group-modified terminal, an affinity tag (such as biotin, digoxin, etc.)-modified terminal, a phosphorylation-modified terminal, a hydrophobic group-modified terminal, an amino-modified terminal, a linker-modified terminal, a Spacer (such as C3 Spacer, Spacer 18)-modified terminal, an inserted sequence-modified terminal, a functionalized terminal, or a combination thereof; For example, the fluorophore group includes one or more fluorophore groups selected from the group consisting of: small molecule fluorescein, nanomaterials, quantum dots, macromolecular fluorophore groups, and / or combinations thereof; for example, the small molecule fluorescein includes, but is not limited to, 6-carboxyfluorescein (6-FAM), tetramethylrhodamine, 5-carboxytetramethylrhodamine (5-TAMRA), tetramethylrhodamine isothiocyanate (TRITC), coumarin, fluorescein isothiocyanate (FITC), cyanine dyes (such as Cy2, Cy3, Cy5, PE-Cy5.5), lanthanide chelates (such as europium Eu 3 +), ROX, JOE, APC\VIC, hexachlorofluorescein; for example, the macromolecular fluorophore group includes, but is not limited to, fluorescent proteins (e.g., phycoerythrin (PE)), intercalating dyes: ethidium bromide (EB), SYBR Green, ATTO647, ATTO565, Alexa Fluor488; and / or For example, the quenching group includes one or more quenching groups selected from the group consisting of: small molecule quenching agents, nanomaterial quenching agents, and / or a combination thereof; for example, the small molecule quenching agents include but are not limited to Black Hole Quencher (BHQ), Black Hole Quencher 1 (BHQ1), Black Hole Quencher 2 (BHQ2), Black Hole Quencher 3 (BHQ3), Black Hole Quencher 650 (BHQ650), 4-(4-dimethylaminophenylazo)-benzoic acid (DABCYL), TAMRA, Eclipse, MGB, BHQ1; for example, the nanomaterials include but are not limited to nanocarbon materials (such as carbon nanotubes, graphene, etc.), metal nanoparticles (such as gold nanoparticles AuNP); and / or For example, the inserted sequence includes a nucleotide sequence of any length that does not change the property of the nucleic acid aptamer or molecular beacon binding to IL-2, for example, a nucleotide sequence with a length of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 bases; and / or For example, the linker comprises a nucleotide sequence of any length, e.g., a linker having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases; preferably a linker having a length of 20 bases, e.g., AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto; and / or For example, the Spacer comprises one or more selected from the group consisting of: hydrophobic Spacer C3, C6, C12, hydrophilic Spacer9, Spacer 18 or dSpacer, PC linker and / or a combination thereof; and / or For example, the functionalized terminus comprises one or more selected from the group consisting of: hydroxyl, carboxyl, amino or thiol modification and / or a combination thereof; For example, the hydrophobic group comprises one or more selected from the group consisting of: dialkyl lipid, cholesterol,, thiophosphate, hydrophobic Spacer C3, C6, C12 and / or a combination thereof.

5. The biosensor according to any one of the preceding claims, wherein, The aptamer or molecular beacon is a modified aptamer or molecular beacon, and the modification comprises one or more modifications selected from the group consisting of: at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide, at least one terminal modification, at least one spacer modification and combinations thereof; For example, the at least one modified sugar moiety includes but is not limited to a 2'-O-methoxyethyl (2’-OH) modified sugar moiety, a 2′-methoxy modified sugar moiety, a 2′-O-alkyl modified sugar moiety, a bicyclic sugar moiety, a 2’-OH modified sugar moiety, a fluorine-substituted modified sugar moiety and combinations thereof; For example, the at least one modified internucleoside bond includes but is not limited to thiophosphate, phosphonoalkyl ester, dithiophosphate, alkylthiophosphonate, phosphoramidate, carbamate, carbonate, phosphotriester, acetamide ester, carboxymethyl ester and combinations thereof; For example, the at least one modified nucleotide includes but is not limited to peptide nucleic acid (PNA), locked nucleic acid (LNA), arabinonucleic acid, derivatives of peptide nucleic acid (PNA), derivatives of locked nucleic acid (LNA), derivatives of arabinonucleic acid and combinations thereof; For example, the at least one terminal modification includes but is not limited to a terminal modified with a poly-T sequence (T-strand), a PEG-modified terminus, a fluorescent group-modified terminus, a quencher group-modified terminus, an affinity tag (e.g., biotin, digoxin, etc.)-modified terminus, a phosphorylation-modified terminus, a hydrophobic group (e.g., dialkyl lipid, cholesterol, etc.)-modified terminus, an amino-modified terminus, a linker-modified terminus, a Spacer (e.g., C3 Spacer, Spacer 18)-modified terminus, an insert sequence-modified terminus, a functionalized terminus or a combination thereof; For example, the at least one spacer modification includes, but is not limited to, a non-terminal region modified with a fluorescent group, a non-terminal region modified with a quenching group, a non-terminal region modified with an affinity tag (e.g., biotin, digoxin, etc.), a non-terminal region modified with a hydrophobic group (e.g., dilauroyl lipid, cholesterol, etc.), a non-terminal region modified with a complementary sequence (e.g., the neck modified with a complementary sequence (C-strand)), a non-terminal region modified with a Spacer (e.g., C3 Spacer, Spacer 18), or a combination thereof.

6. The biosensor according to any one of the preceding claims, wherein, The biosensor includes one or more moieties selected from the group consisting of a fluorescent group, a quenching group, an insert sequence, a linker, a Spacer, a functionalized terminus, and / or a combination thereof; For example, the fluorescent group is located at the 5'-end, 3'-end, or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end, or non-terminal region of another moiety, and / or between the aptamer or molecular beacon and another moiety; For example, the quenching group is located at the 5'-end, 3'-end, or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end, or non-terminal region of another moiety, and / or between the aptamer or molecular beacon and another moiety; For example, the insert sequence is located at the 5'-end, 3'-end, or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end, or non-terminal region of another moiety, and / or between the aptamer or molecular beacon and another moiety; For example, the linker is located at the 5'-end, 3'-end, or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end, or non-terminal region of another moiety, and / or between the aptamer or molecular beacon and another moiety; For example, the Spacer is located at the 5'-end, 3'-end, or non-terminal region of the aptamer or molecular beacon, at the 5'-end, 3'-end, or non-terminal region of another moiety, and / or between the aptamer or molecular beacon and another moiety.

7. The biosensor according to any one of the preceding claims, wherein, The linker is a nucleotide sequence of any length, for example, a linker having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases; preferably a linker having a length of 20 bases; and / or The complementary sequence is a nucleotide sequence of any length and is base complementary to the linker, for example, a complementary sequence having a length of at least 15, 20, 25, 30, 40, 45, 50, 55, 60, 65, 70 or more bases.

8. The biosensor according to any one of the preceding claims, wherein, The 3'-end of the first nucleotide chain includes a linker having a length of 20 bases and the 5'-end includes a terminus modified with a fluorescent group, and the 5'-end of the second nucleotide chain includes a terminus modified with a hydrophobic group and the 3'-end includes a terminus modified with a quenching group; Preferably, the 3'-end of the first nucleotide chain includes a nucleotide sequence of An adaptor consisting of AAACATCAACTGTACTAATC (SEQ ID NO: 43) or a nucleotide sequence having at least 80% homology thereto, and the 5'-end includes a 6-carboxyfluorescein (6-FAM)-modified end; the 5'-end of the second nucleotide strand includes a cholesterol-modified end and the 3'-end includes a Black Hole Quencher 1 (BHQ1)-modified end; more preferably, the second nucleotide strand includes GATTAGTACAGTTGATGTTT (SEQ ID NO: 44), TTTTTGATTAGTACAGTTGATGTTT (SEQ ID NO: 45) or a nucleotide sequence having at least 80% homology thereto; More preferably, the 3'-end of the first nucleotide strand includes SEQ ID NO: 39 and the second nucleotide strand includes SEQ ID NO:

41.

9. A preparation comprising the biosensor according to any one of the preceding claims; for example, magnetic beads or gel resins for IL-2 detection and / or purification, reagents and / or kits for detecting IL-2 levels, pharmaceutical compositions for IL-2 targeted therapy, etc.

10. Use of the biosensor and / or preparation according to any one of the preceding claims in the preparation of a product for IL-2 targeted diagnosis, IL-2 targeted therapy or detecting the IL-2 level in a sample; For example, the sample is blood, such as serum, immune cells such as T cells, etc., cell culture medium or the live cell secretion microenvironment; and / or The subject is a mammal, such as a human, non-human primate (such as orangutan, ape), rodent (such as rat, mouse, guinea pig), pet (such as cat, dog), livestock (such as horse, cow, sheep, pig, rabbit); and / or For example, the product is magnetic beads or gel resins for IL-2 detection and / or purification, reagents and / or kits for detecting IL-2 levels, pharmaceutical compositions for IL-2 targeted therapy, etc.; preferably, the product is a kit, which includes other compositions or components and / or an instruction manual.