Muscle-targeted complex and use thereof for skipping exon 45 of DMD gene
By using conjugates covalently linked to anti-transferrin receptor 1 antibody in muscle cells, targeted delivery of exon 45 is achieved, solving the problem of insufficient dystrophin expression in the prior art, and improving the therapeutic effect of dishernet muscular dystrophy.
Patent Information
- Application Number
- CN202380082512.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-10-31
- Filing Date
- 2023-10-30
- Publication Date
- 2025-07-08
AI Technical Summary
The prior art is difficult to effectively promote the expression or activity of dystrophins, especially for mutations related to deschenette muscular dystrophy, leading to the occurrence and development of muscle diseases.
A muscle-targeting complex, a conjugate containing a covalently linked conjugate to an anti-transferrin receptor 1 (TfR1) antibody, was developed to promote the skip reading of exon 45 by targeting the delivery of oligonucleotides to muscle cells, thereby improving the expression and function of dystrophins.
It improves the expression and activity of dystrophin, especially the treatment effect of mutations related to dicene muscular dystrophy, enhances muscle function and slows disease progression.
Smart Images

Figure CN120282986A_ABST
Abstract
Description
Related Applications
[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 381,730, filed on October 31, 2022, entitled "MUSCLE TARGETING COMPLEXES AND USES THEREOF FOR SKIPPING EXON 45 OF A DMD GENE", under 35 U.S.C. § 119(e), the entire content of which is incorporated herein by reference. Technical Field
[0002] This application relates to targeting complexes for delivering molecular payloads (e.g., oligonucleotides) to cells, formulations comprising such complexes, and uses thereof, particularly for the treatment of diseases. Reference to Electronic Sequence Listing
[0003] The content of the electronic sequence listing (D082470083WO00-SEQ-COB.xml; size: 38,671 bytes; and creation date: October 30, 2023) is incorporated herein by reference in its entirety. Background Art
[0004] Dystrophinopathy is a unique group of neuromuscular diseases caused by mutations in the dystrophin gene. Dystrophinopathies include Duchenne muscular dystrophy, Becker muscular dystrophy, and X-linked dilated cardiomyopathy. DMD, which encodes dystrophin, is a large gene containing 79 exons and approximately 2.6 million total base pairs. Many mutations in DMD, including exon frameshifts, deletions, substitutions, and duplication mutations, can reduce the expression of functional dystrophin, leading to dystrophinopathy. Summary of the Invention
[0005] According to some aspects, the present disclosure provides muscle targeting complexes that can be used to promote the expression or activity of dystrophin (e.g., truncated dystrophin) and / or methods of treating Duchenne muscular dystrophy in a subject. Truncated dystrophin is functional (e.g., retains the activity of wild-type dystrophin). In some embodiments, truncated dystrophin retains some of the functions of wild-type dystrophin.
[0006] According to some aspects, provided herein is a complex comprising formula (I): [R 1 n1 -R 2 In some embodiments, each R 1 Inclusive (Ia) group: wherein R 3 Comprises a phosphorodiamidate morpholino oligomer (PMO) containing the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21); wherein R 2 Comprises an anti-transferrin receptor 1 (anti-TfR1) antibody, said antibody comprising a heavy chain complementarity determining region 1 (CDR-H1), heavy chain complementarity determining region 2 (CDR-H2), heavy chain complementarity determining region 3 (CDR-H3), light chain complementarity determining region 1 (CDR-L1), light chain complementarity determining region 2 (CDR-L2), and light chain complementarity determining region 3 (CDR-L3) selected from Table 2, wherein R 1 Is covalently linked to R 2 At junction point A; and wherein n1 is an integer of 1 or greater, which represents the number of instances of R 1 in the complex, wherein each instance of R 1 Is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
[0007] In some embodiments, each R 1 Comprises an inclusive (Ib) group: wherein -p is the phosphorodiamidate linkage of the phosphorodiamidate morpholino oligomer (PMO), and wherein the PMO comprises the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21); wherein R 2Comprising an anti-TfR1 antibody, the antibody comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2; wherein R 1 is covalently linked to R at junction point A 2 ; and wherein n1 is an integer of 1 or greater, which represents the number of instances of R 1 , where each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
[0008] In some embodiments, each R 1 comprises a group of formula (Ic): wherein R 2 Comprising an anti-TfR1 antibody, the antibody comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2; wherein R 1 is covalently linked to R 2 ; and wherein n1 is an integer of 1 or greater, which represents the number of instances of R 1 , where each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
[0009] In some embodiments, the complex comprises a structure of formula (Id): wherein -p is the phosphorodiamidate bond of phosphorodiamidate morpholino oligomer (PMO), and wherein the PMO comprises the base sequence of CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21); wherein R 2 Comprising an anti-TfR1 antibody, the antibody comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2, where each instance of the group enclosed in square brackets in formula (Id) is covalently linked to a different amino acid residue of the anti-TfR1 antibody; and wherein n1 is an integer of 1 or greater, which represents the number of instances of the group enclosed in square brackets in formula (Id).
[0010] In some embodiments, the anti-TfR1 antibody is a Fab fragment, a full-length IgG, a Fab' fragment, or an F(ab')2 fragment. In some embodiments, the anti-TfR1 antibody is a Fab fragment.
[0011] In some embodiments, the anti-TfR1 antibody comprises a VH containing the amino acid sequence of SEQ ID NO:17 and a VL containing the amino acid sequence of SEQ ID NO:18. In some embodiments, the anti-TfR1 antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:19 and a light chain containing the amino acid sequence of SEQ ID NO:20.
[0012] In some embodiments, each instance of R 1 is covalently linked to a different lysine residue of the anti-TfR1 antibody.
[0013] In some embodiments, the different amino acid residues comprise K188 and K190 of the light chain constant region based on Kabat numbering.
[0014] In some embodiments, the different amino acid residues are represented by lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain constant region of the anti-TfR1 antibody.
[0015] According to some aspects, there is provided a composition comprising the complex disclosed herein. In some embodiments, the composition is in the form of an aqueous solution.
[0016] In some embodiments, the anti-TfR1 antibody in the complex of the composition comprises a light chain constant region, and at least 80% of the light chain constant region of the anti-TfR1 antibody in the complex of the composition is independently covalently linked to an oligonucleotide at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of each anti-TfR1 antibody and / or the linkage site represented by K190 (based on Kabat numbering).
[0017] In some embodiments, the anti-TfR1 antibody in the complex of the composition comprises a light chain constant region, and at least 80% of the light chain constant region of the anti-TfR1 antibody in the complex of the composition is independently covalently linked to an oligonucleotide at the following linkage sites: the linkage site represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain constant region of each antibody.
[0018] According to some aspects, there is provided herein a method of promoting the expression or activity of dystrophin in a subject. In some embodiments, the method comprises administering to the subject the complex or composition disclosed herein.
[0019] In some embodiments, the dystrophin is a truncated dystrophin.
[0020] According to some aspects, methods are provided herein for treating a subject having a DMD allele with a mutation associated with Duchenne muscular dystrophy. In some embodiments, the method comprises administering to the subject a complex or composition disclosed herein.
[0021] In some embodiments, the complex promotes the expression or activity of dystrophin in the subject. In some embodiments, the dystrophin is truncated dystrophin.
[0022] In some embodiments, the mutant DMD allele comprises a mutation suitable for exon 45 skipping.
[0023] In some embodiments, the mutant DMD allele comprises a frameshift mutation in exon 45. BRIEF DESCRIPTION OF THE DRAWINGS
[0024] Figure 1 The data shown indicate that systemic administration of a conjugate comprising an anti-TfR1 Fab covalently linked to an exon 45-targeted oligonucleotide (ASO) achieved higher levels of ASO in muscle tissue of non-human primates compared to systemic administration of an ASO not covalently linked to a Fab.
[0025] Figure 2 Exon 45 skipping is shown in human myotubes that are wild-type (“WT myotubes”) or contain a mutation suitable for exon 45 skipping introduced by CRISPR / Cas genome editing (“Del46 myotubes”).
[0026] Figure 3 Exposure of tissues (ng / g) in the quadriceps (“Quad”), gastrocnemius (“Gastroc”), heart (“Heart”), and diaphragm (“Dia”) of hTfR1 / hDMD WT / mdx mice is shown 7 days after intravenous administration of a DMD-targeted oligonucleotide (ASO) contained in an anti-TfR1 Fab-ASO conjugate.
[0027] Figures 4A to 4D Exon 45 skipping in muscle tissue of hTfR1 / hDMD WT / mdx mice intravenously treated with vehicle control (“Veh.”) or an anti-TfR1 Fab-ASO conjugate (“anti-TfR1 Fab-ASO conjugate”) 7 days after treatment is shown. Exon skipping is shown in the quadriceps ( Figure 4A )), gastrocnemius ( Figure 4B )), heart ( Figure 4C )), and diaphragm ( Figure 4D ). DETAILED DESCRIPTION
[0028] According to some aspects, the present disclosure provides muscle-targeted complexes that can be used to promote the expression or activity of dystrophin (e.g., truncated dystrophin) and / or methods of treating Duchenne muscular dystrophy in a subject. The truncated dystrophin is functional (e.g., retains the activity of wild-type dystrophin). In some embodiments, the truncated dystrophin retains some of the functions of wild-type dystrophin. In some embodiments, the muscle-targeted complex comprises a muscle-targeting agent (e.g., an anti-TfR1 antibody) covalently linked to an oligonucleotide (e.g., a PMO). In some embodiments, the oligonucleotide comprises a complementary region of the DMD sequence.
[0029] According to some aspects, the present disclosure provides a composition comprising a plurality of complexes. In some embodiments, the complexes of the compositions described herein comprise an antibody (e.g., anti-transferrin receptor 1 (TfR1)) covalently linked to one or more oligonucleotides. In some embodiments, the antibody comprises a heavy chain containing a heavy chain variable region (VH) and a heavy chain constant region, and a light chain containing a light chain variable region (VL) and a light chain constant region. In some embodiments, each of the one or more oligonucleotides is covalently linked to a different amino acid residue (e.g., a lysine residue) of the antibody. In some embodiments, the light chain constant region of the antibody in the complexes of the composition is independently covalently linked to the oligonucleotide at a linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or a linkage site represented by K190 (based on Kabat numbering). In some embodiments, the light chain of the antibody in the complex is covalently linked to the oligonucleotide at a linkage site represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain. Definitions
[0030] Administration: As used herein, the term "administer" or variations thereof means providing a complex to a subject in a physiologically and / or (e.g., and) pharmacologically acceptable manner (e.g., to treat a disorder in the subject).
[0031] About: As used herein, the term "about" or "approximately" when applied to one or more target values refers to a value similar to the stated reference value. In certain embodiments, the term "about" or "approximately" refers to a range of values that fall within 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value, unless otherwise specified or otherwise apparent from the context (unless such numbers exceed 100% of the possible value).
[0032] Antibody: As used herein, the term "antibody" refers to a polypeptide comprising at least one immunoglobulin variable domain or at least one antigenic determinant (e.g., a paratope that specifically binds to an antigen). In some embodiments, the antibody is a full-length antibody. In some embodiments, the antibody is a chimeric antibody. In some embodiments, the antibody is a humanized antibody. However, in some embodiments, the antibody is a Fab fragment, a Fab' fragment, an F(ab')2 fragment, an Fv fragment, or a scFv fragment. In some embodiments, the antibody is a nanobody derived from camelid antibodies or a nanobody derived from shark antibodies. In some embodiments, the antibody is a diabody. In some embodiments, the antibody comprises a framework having a human germline sequence. In another embodiment, the antibody comprises a heavy chain constant domain selected from the IgG, IgG1, IgG2, IgG2A, IgG2B, IgG2C, IgG3, IgG4, IgA1, IgA2, IgD, IgM, and IgE constant domains. In some embodiments, the antibody comprises a heavy (H) chain variable region (abbreviated herein as VH) and / or (e.g., and) a light (L) chain variable region (abbreviated herein as VL). In some embodiments, the antibody comprises a constant domain, such as an Fc region. An immunoglobulin constant domain refers to a heavy or light chain constant domain. The amino acid sequences of human IgG heavy and light chain constant domains and their functional variants are known. With respect to the heavy chain, in some embodiments, the heavy chain of the antibody described herein can be an alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In some embodiments, the heavy chain of the antibody described herein can comprise a human alpha (α), delta (Δ), epsilon (ε), gamma (γ), or mu (μ) heavy chain. In one specific embodiment, the antibody described herein comprises human γ1 CH1, CH2, and / or (e.g., and) CH3 domains. In some embodiments, the amino acid sequence of the VH domain comprises the amino acid sequence of a human gamma (γ) heavy chain constant region, such as any known in the art. Some non-limiting examples of human constant region sequences have been described in the art, e.g., see U.S. Patent No. 5,693,780 and Kabat EA et al., (1991) supra. In some embodiments, the VH domain comprises an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 98%, or at least 99% identity to any variable chain constant region provided herein. In some embodiments, the antibody is modified, e.g., by glycosylation, phosphorylation, sumoylation, and / or (e.g., and) methylation. In some embodiments, the antibody is a glycosylated antibody conjugated to one or more sugar or carbohydrate molecules.In some embodiments, one or more sugar or carbohydrate molecules are conjugated to the antibody by N-glycosylation, O-glycosylation, C-glycosylation, glycosylphosphatidylinositolization (GPI anchor attachment), and / or (e.g., and) phosphoglycosylation. In some embodiments, one or more sugar or carbohydrate molecules are monosaccharides, disaccharides, oligosaccharides, or polysaccharides. In some embodiments, one or more sugar or carbohydrate molecules are branched oligosaccharides or branched polysaccharides. In some embodiments, one or more sugar or carbohydrate molecules comprise mannose units, glucose units, N-acetylglucosamine units, N-acetylgalactosamine units, galactose units, fucose units, or phospholipid units. In some embodiments, the antibody is a construct comprising a polypeptide comprising one or more antigen-binding fragments of the present disclosure linked to a linker polypeptide or an immunoglobulin constant domain. The linker polypeptide comprises two or more amino acid residues linked by peptide bonds and is used to link one or more antigen-binding portions. Some examples of linker polypeptides have been reported (see, e.g., Holliger, P., et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R.J., et al. (1994) Structure 2:1121-1123). Additionally, the antibody can be part of a larger immunoadhesion molecule formed by the covalent or non-covalent association of the antibody or antibody portion with one or more other proteins or peptides. Some examples of such immunoadhesion molecules include the preparation of a tetrameric scFv molecule using a streptavidin core region (Kipriyanov, S.M., et al. (1995) Human Antibodies and Hybridomas 6:93-101), and the preparation of bivalent and biotinylated scFv molecules using cysteine residues, a tag peptide, and a C-terminal polyhistidine tag (Kipriyanov, S.M., et al. (1994) Mol. Immunol. 31:1047-1058).
[0033] CDR: As used herein, the term "CDR" refers to the complementarity determining regions within the variable sequences of an antibody. A typical antibody molecule comprises a variable heavy chain region (VH) and a variable light chain region (VL), which are generally involved in antigen binding. The VH and VL regions can be further subdivided into hypervariable regions, also known as "complementarity determining regions" ("CDR"), interspersed with more conserved regions called "framework regions" ("FR"). Each VH and VL typically consists of three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR 1 , CDR1, FR 2 , CDR2, FR3, CDR3, FR4. The boundaries of the framework regions and CDRs can be precisely defined using methods known in the art, such as by the Kabat definition, the IMGT definition, the Chothia definition, the AbM definition, and / or (e.g., and) the contact definition (all of which are well known in the art). See, for example, Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242; the international ImMunoGeneTics information www.imgt.org, Lefranc, M.-P. et al., Nucleic Acids Res., 27: 209-212 (1999); Ruiz, M. et al., Nucleic Acids Res., 28: 219-221 (2000); Lefranc, M.-P, Nucleic Acids Res., 29: 207-209 (2001); Lefranc, M.-P., Nucleic Acids Res., 31: 307-310 (2003); Leffanc, M.-P. et al., In Silico Biol., 5, 0006 (2004) [Epub], 5: 45-60 (2005); Lefranc, M.-P et al, Nucleic Acids Res., 33: D593-597 (2005); Lefranc, M.-P. et al., Nucleic Acids Res., 37: D1006-1012 (2009); Lefranc, M.-P. et al., Nucleic Acids Res, 43: D413-422 (2015); Chothia et al, (1989) Nature 342: 877; Chothia, C. et al. (1987) J. Mol. Biol. 196: 901-917, A1-lazikani et al (1997) J. Molec. Biol. 273: 927-948; and Almagro, J. Mol. Recognit. 17: 132-143 (2004). See also bioinf.org.uk / abs. The CDRs used herein can refer to CDRs defined by any method known in the art. Two antibodies having the same CDR means that the amino acid sequences of the CDRs of the two antibodies are the same, as determined by the same method (e.g., IMGT definition).
[0034] There are three CDRs in each variable region of the heavy and light chains, referred to as CDR1, CDR2, and CDR3 for each variable region. The term "CDR set" as used herein refers to the set of three antigen-binding CDRs that occur within a single variable region. The exact boundaries of these CDRs have been defined differently according to different systems. The system described by Kabat (Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991))) not only provides a clear residue numbering system applicable to any variable region of an antibody, but also provides the precise residue boundaries that define the three CDRs. These CDRs can be referred to as Kabat CDRs. Subparts of the CDRs can be named L1, L2, and L3 or H1, H2, and H3, where "L" and "H" name the light and heavy chain regions respectively. These regions can be referred to as Chothia CDRs, which have boundaries that overlap with the Kabat CDRs. Padlan (FASEB J. 9:133-139 (1995)) and MacCallum (J Mol Biol 262(5):732-45 (1996)) have described other boundaries that define CDRs that overlap with the Kabat CDRs. Some other CDR boundary definitions do not strictly follow one of the above systems, but will still overlap with the Kabat CDRs, although they can be shortened or lengthened based on prediction or experimental findings that a particular residue or group of residues or even an entire CDR will not significantly affect antigen binding. The methods used herein can utilize CDRs defined according to any of these systems. Some examples of CDR definition systems are provided in Table 1. Table 1. CDR Definitions <![CDATA[IMGT 1 > <![CDATA[Kabat 2 > <![CDATA[Chothia 3 > CDR-H1 27 to 38 31 to 35 26 to 32 CDR-H2 56 to 65 50 to 65 53 to 55 CDR-H3 105 to 116 / 117 95 to 102 96 to 101 CDR-L1 27 to 38 24 to 34 26 to 32 CDR-L2 56 to 65 50 to 56 50 to 52 CDR-L3 105 to 116 / 117 89 to 97 91 to 96 1 the international ImMunoGeneTics information imgt.org, Lefranc, M.-P. et al., Nucleic Acids Res., 27:209-212 (1999) 2Kabat et al. (1991) Sequences of Proteins of Immunological Interest, 5th Edition, U.S. Department of Health and Human Services, NIH Publication No. 91 - 3242 3 Chothia et al., J. Mol. Biol. 196: 901 - 917 (1987))
[0035] Complementary: The term "complementary" as used herein refers to the ability of two nucleotides or two sets of nucleotides to pair precisely. In particular, complementary is a term that characterizes the degree of binding between two nucleotides or two sets of nucleotides caused by hydrogen bond pairing. For example, if the base at a position in an oligonucleotide can hydrogen bond with the base at the corresponding position of a target nucleic acid (e.g., mRNA), the bases are considered complementary to each other at that position. Base pairing can include both canonical Watson - Crick base pairing and non - Watson - Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). For example, in some embodiments, for complementary base pairing, an adenine - type base (A) is complementary to a thymine - type base (T) or a uracil - type base (U), a cytosine - type base (C) is complementary to a guanine - type base (G), and universal bases such as 3 - nitropyrrole or 5 - nitroindole can hybridize with any A, C, U, or T and are considered complementary. Inosine (I) is also considered a universal base in the art and is considered complementary to any A, C, U, or T.
[0036] Covalently linked: The term "covalently linked" as used herein refers to the characteristic that two or more molecules are joined together by at least one covalent bond. In some embodiments, two molecules can be covalently linked together by a single bond such as a disulfide bond or a disulfide bridge that acts as a linker between the molecules. However, in some embodiments, two or more molecules can be covalently linked together by a molecule that acts as a linker, which joins two or more molecules together through multiple covalent bonds. In some embodiments, the linker can be a cleavable linker. However, in some embodiments, the linker can be a non - cleavable linker.
[0037] DMD Allele: As used herein, the term "DMD allele" refers to either alternative form (e.g., wild-type or mutant form) of the DMD gene. In some embodiments, a DMD allele can encode dystrophin that retains its normal and typical function. In some embodiments, a DMD allele can contain one or more mutations that cause muscular dystrophy. Common mutations that cause Duchenne muscular dystrophy involve frameshift, deletion, substitution, and duplication mutations in one or more of the 79 exons present in the dystrophin allele (e.g., exon 8, exon 23, exon 41, exon 44, exon 50, exon 51, exon 52, exon 53, or exon 55). Additional examples of DMD mutations are disclosed, for example, in Flanigan KM, et al., Mutational spectrum of DMD mutations in dystrophinopathy patients: application of modern diagnostic techniques to a large cohort. Hum Mutat. 2009 Dec;30(12):1657-66, the contents of which are incorporated herein by reference in their entirety.
[0038] Duchenne Muscular Dystrophy: As used herein, the term "Duchenne muscular dystrophy" refers to a muscle disease caused by mutations in the DMD allele located at the Xp21 locus on the X chromosome. Symptoms of Duchenne muscular dystrophy include muscle loss or degeneration, weakened muscle function, pseudohypertrophy of the tongue and calf muscles, a high risk of neurological abnormalities, and shortened lifespan. Duchenne muscular dystrophy corresponds to (associated with) Online Mendelian Inheritance in Man (OMIM) Entry #310200.
[0039] Dystrophin: As used herein, the term "dystrophin" refers to either alternative form (e.g., wild-type or mutant form) of the dystrophin protein. Dystrophin is a rod-shaped cytoplasmic protein that is part of a protein complex that links the intracellular cytoskeleton of muscle fibers to the extracellular matrix. Lack of dystrophin causes Duchenne muscular dystrophy.
[0040] Dystrophinopathy: The term "dystrophinopathy" as used herein refers to a muscle disease caused by one or more mutant DMD alleles. Dystrophinopathies include a spectrum of disorders (ranging from mild to severe), which include Duchenne muscular dystrophy, Becker muscular dystrophy, and DMD-associated dilated cardiomyopathy (DCM). In some embodiments, at one end of the spectrum, dystrophinopathy phenotypically presents as an asymptomatic increase in the serum concentration of creatine phosphokinase (CK) and / or (e.g., and) muscle cramps accompanied by myoglobinuria. In some embodiments, at the other end of the spectrum, dystrophinopathy phenotypically presents as a progressive muscle disease, which is typically classified as Duchenne or Becker muscular dystrophy when skeletal muscle is primarily affected, and as DMD-associated dilated cardiomyopathy (DCM) when the heart is primarily affected. Some symptoms of Duchenne muscular dystrophy include muscle loss or degeneration, weakened muscle function, pseudohypertrophy of the tongue and calf muscles, a high risk of neurological abnormalities, and a shortened lifespan. Duchenne muscular dystrophy corresponds to Online Mendelian Inheritance in Man (OMIM) Entry #310200. Becker muscular dystrophy corresponds to OMIM Entry #300376. Dilated cardiomyopathy corresponds to OMIM Entry X#302045.
[0041] Exonic splicing enhancer (ESE): The term "exonic splicing enhancer" or "ESE" as used herein refers to a nucleic acid sequence motif within an exon of a gene, precursor mRNA, or mRNA that directs or enhances the splicing of precursor mRNA into mRNA, for example as described in Blencowe et al., Trends Biochem Sci 25, 106-10. (2000), which is incorporated herein by reference. An ESE is a splicing signature. An ESE can direct or enhance splicing to remove, for example, one or more introns and / or one or more exons from a gene transcript. The length of an ESE motif is typically 6 to 8 nucleobases. SR proteins (e.g., proteins encoded by the genes SRSF1, SRSF2, SRSF3, SRSF4, SRSF5, SRSF6, SRSF7, SRSF8, SRSF9, SRSF10, SRSF11, SRSF12, TRA2A, or TRA2B) bind to an ESE via their RNA recognition motif regions to promote splicing. ESE motifs can be identified by a variety of methods, including those described in Cartegni et al., Nucleic Acids Research, 2003, Vol. 31, No. 13, 3568–3571, which is incorporated herein by reference.
[0042] Framework: The term "framework" or "framework sequence" as used herein refers to the remaining sequence of the variable region minus the CDRs. Since the exact definition of the CDR sequences can be determined by different systems, the meaning of the framework sequence accordingly has different interpretations. The six CDRs (CDR-L1, CDR-L2, and CDR-L3 of the light chain and CDR-H1, CDR-H2, and CDR-H3 of the heavy chain) also divide the framework regions on the light and heavy chains into four subregions (FR1, FR2, FR3, and FR4) on each chain, where CDR1 is located between FR1 and FR2, CDR2 is located between FR2 and FR3, and CDR3 is located between FR3 and FR4. In the absence of designation of a particular subregion as FR1, FR2, FR3, or FR4, the framework regions referred to by others represent the combined FRs within the variable region of a single naturally occurring immunoglobulin chain. The FR as used herein represents one of the four subregions, and multiple FRs represent two or more of the four subregions that make up the framework region. Human heavy and light chain acceptor sequences are known in the art. In one embodiment, acceptor sequences known in the art can be used in the antibodies disclosed herein.
[0043] Human antibody: The term "human antibody" as used herein is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences. The human antibodies of the present disclosure may contain amino acid residues that are not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by in vitro random or site-specific mutagenesis or by in vivo somatic mutation), such as in the CDRs, and particularly in CDR3. However, the term "human antibody" as used herein is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species (e.g., mouse) have been grafted onto human framework sequences.
[0044] Humanized antibody: The term "humanized antibody" refers to an antibody that contains heavy and light chain variable region sequences from a non-human species (e.g., mouse) but in which at least a portion of the VH and / or (e.g., and) VL sequences have been altered to be more "human-like" (i.e., more similar to human germline variable sequences). One type of humanized antibody is a CDR-grafted antibody, in which human CDR sequences are introduced into non-human VH and VL sequences to replace the corresponding non-human CDR sequences. In one embodiment, humanized anti-transferrin receptor antibodies and antigen-binding portions are provided. Such antibodies can be produced by obtaining a murine anti-transferrin receptor monoclonal antibody using conventional hybridoma techniques and subsequently humanizing it using in vitro genetic engineering, such as those disclosed in PCT Publication No. WO 2005 / 123126A2 by Kasaian et al.
[0045] Kabat numbering: The terms "Kabat numbering", "Kabat definition", and "Kabat notation" are used interchangeably herein. These terms, as recognized in the art, refer to a system for numbering amino acid residues in the heavy and light chain variable regions of an antibody or its antigen-binding portion that are more variable (i.e., hypervariable) than other amino acid residues (Kabat et al. (1971) Ann. NY Acad. Sci. 190:382-391 and Kabat, E.A., et al. (1991) Sequences of Proteins of Immunological Interest, 5th ed., U.S. Department of Health and Human Services, NIH Publication No. 91-3242). For the heavy chain variable region, the hypervariable region of CDR1 is amino acids 31 to 35, the hypervariable region of CDR2 is amino acids 50 to 65, and the hypervariable region of CDR3 is amino acids 95 to 102. For the light chain variable region, the hypervariable region of CDR1 is amino acids 24 to 34, the hypervariable region of CDR2 is amino acids 50 to 56, and the hypervariable region of CDR3 is amino acids 89 to 97.
[0046] Morpholino: As used herein, the term "morpholino", also known as "phosphorodiamidate morpholino oligomer", refers to a molecular structure comprising: a methylene morpholine ring backbone linked by phosphorodiamidate groups, to which nucleobases are attached. In some embodiments, the oligonucleotide can be a morpholino-based compound. Morpholino-based oligomeric compounds are described in Dwaine A. Braasch and David R. Corey, Biochemistry, 2002, 41(14), 4503-4510; Genesis, Volume 30, Issue 3, 2001; Heasman, J., Dev. Biol., 2002, 243, 209-214; Nasevicius et al., Nat. Genet., 2000, 26, 216-220; Lacerra et al., Proc. Natl. Acad. Sci., 2000, 97, 9591-9596; and U.S. Patent No. 5,034,506, issued July 23, 1991. In some embodiments, the morpholino-based oligomeric compound is a phosphorodiamidate morpholino oligomer (PMO) (e.g., as described in Iverson, Curr. Opin. Mol. Ther., 3:235-238, 2001; and Wang et al., J. Gene Med., 12:354-364, 2010; the disclosures of which are incorporated herein by reference in their entireties).
[0047] Oligonucleotide: As used herein, the term "oligonucleotide" refers to an oligomeric nucleic acid compound up to 200 nucleotides in length. Some examples of oligonucleotides include, but are not limited to, RNAi oligonucleotides (e.g., siRNA, shRNA), microRNAs, spacer oligomers, chimeric oligomers, phosphorodiamidate morpholinos, peptide nucleic acids, aptamers, guide nucleic acids (e.g., Cas9 guide RNA), etc. The oligonucleotide can be single-stranded or double-stranded. In some embodiments, the oligonucleotide can comprise one or more modified nucleosides (e.g., 2'-O-methyl sugar modifications, purine or pyrimidine modifications). In some embodiments, the oligonucleotide can comprise one or more modified internucleoside linkages. In some embodiments, the oligonucleotide can comprise one or more phosphorothioate linkages, which can be in the Rp or Sp stereochemical conformation.
[0048] Complementary Region: As used herein, the term "complementary region" refers to a nucleotide sequence, such as an oligonucleotide, that is sufficiently complementary to a homologous nucleotide sequence, such as a target nucleic acid, such that the two nucleotide sequences are capable of annealing to each other under physiological conditions (e.g., in a cell). In some embodiments, the complementary region is fully complementary to the homologous nucleotide sequence of the target nucleic acid. However, in some embodiments, the complementary region is partially complementary to the homologous nucleotide sequence of the target nucleic acid (e.g., at least 80%, 90%, 95%, or 99% complementary). In some embodiments, the complementary region contains 1, 2, 3, or 4 mismatches compared to the homologous nucleotide sequence of the target nucleic acid.
[0049] Specific Binding: As used herein, the term "specific binding" refers to the ability of a molecule to bind to a binding partner with a degree of affinity or avidity such that the molecule can be used to distinguish the binding partner from a suitable control in a binding assay or other binding context. With respect to an antibody, the term "specific binding" refers to the ability of the antibody to bind to a specific antigen with a degree of affinity or avidity such that the antibody can be used to distinguish the specific antigen from other antigens, e.g., to the extent that it permits preferential targeting of certain cells (e.g., muscle cells) by binding to an antigen as described herein. In some embodiments, an antibody specifically binds to a target if the K D is at least about 10 -4 M, 10 -5 M, 10 -6 M, 10 -7 M, 10 -8 M, 10 -9 M, 10 -10 M, 10 -11 M, 10 -12 M, 10 -13 M or less. In some embodiments, the antibody specifically binds to the transferrin receptor (e.g., an epitope in the apical domain of the transferrin receptor).
[0050] Splice acceptor site: The term "splice acceptor site" or "splice acceptor" as used herein refers to a nucleic acid sequence motif at the 3' end of an intron in a gene or pre-mRNA or spanning an intron / exon junction that is involved in splicing pre-mRNA into mRNA (i.e., removing the intron from the pre-mRNA) and may be referred to as a splicing signature. The splice acceptor site contains a terminal AG sequence at the 3' end of the intron, which is typically preceded (in the 5' direction) by a high pyrimidine (C / U) region. Upstream of the splice acceptor site is the branch point. A lariat loop intermediate structure is formed by a transesterification reaction between the branch point and the splice donor site, releasing the 3'-OH of the 5' exon, which then reacts with the first nucleotide of the 3' exon, thereby ligating the exons and releasing the intron lariat. It is known that the AG sequence at the 3' end of the intron in the splice acceptor site is crucial for correct splicing, as changing one of these nucleotides results in inhibition of splicing. Rarely, alternative splice acceptor sites have an AC instead of the more common AG at the 3' end of the intron. The common splice acceptor site motif has a [Y-rich region]-NCAGG or Y x sequence of NYAGG or a sequence similar thereto, where Y represents a pyrimidine, N represents any nucleotide, and x is a number from 4 to 20. The cleavage site is after AG, where AG represents the 3'-terminal nucleotide of the excised intron.
[0051] Subject: The term "subject" as used herein refers to a mammal. In some embodiments, the subject is a non-human primate or a rodent. In some embodiments, the subject is a human. In some embodiments, the subject is a patient, such as a human patient suffering from or suspected of suffering from a disease. In some embodiments, the subject is a human patient suffering from or suspected of suffering from a disease caused by a mutated DMD gene sequence (e.g., a mutation in an exon of the DMD gene sequence). In some embodiments, the subject suffers from a dystrophinopathy, such as Duchenne muscular dystrophy.
[0052] Transferrin Receptor: The term "transferrin receptor" (also known as TFRC, CD71, p90, TFR, or TFR1) as used herein refers to an internalizing cell surface receptor that binds transferrin to facilitate the uptake of iron by endocytosis. In some embodiments, the transferrin receptor can be of human origin (NCBI Gene ID 7037), non-human primate origin (e.g., NCBI Gene ID 711568 or NCBI Gene ID 102136007), or rodent origin (e.g., NCBI Gene ID 22042). Additionally, multiple human transcript variants encoding different isoforms of the receptor have been characterized (e.g., as annotated by the following GenBank RefSeq accession numbers: NP_001121620.1, NP_003225.2, NP_001300894.1, and NP_001300895.1).
[0053] Ranges: All ranges provided in this disclosure include the endpoints. Complex
[0054] Complexes comprising an antibody covalently linked to an oligonucleotide are provided herein. In some embodiments, the complex comprises a muscle-targeting antibody (e.g., an anti-TfR1 antibody) covalently linked to one or more oligonucleotides. In some embodiments, the oligonucleotide is a PMO. In some embodiments, the oligonucleotide is an oligonucleotide that targets a mutated DMD allele to promote exon skipping (e.g., promote skipping of exon 45). The complexes disclosed herein can be used in methods for promoting dystrophin expression or activity and / or treating Duchenne muscular dystrophy in a subject, which comprises administering to the subject an effective amount of the complex.
[0055] The complexes disclosed herein generally comprise a linker that covalently links an antibody disclosed herein (e.g., an anti-TfR1 antibody disclosed herein) to an oligonucleotide (e.g., a PMO). The linker comprises at least one covalent bond.
[0056] In some embodiments, the light chain constant region of the antibody in the complex is covalently linked to the oligonucleotide at a linkage site represented by K188 (based on Kabat numbering) of the light chain constant region and / or a linkage site represented by K190 (based on Kabat numbering). In some embodiments, the light chain of the antibody in the complex is covalently linked to the oligonucleotide at a linkage site represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain.
[0057] In some embodiments, the complexes disclosed herein comprise formula (I): [R 1 n1 -R 2 The structure, wherein each R 1 independently comprises a compound containing an oligonucleotide (e.g., PMO), and R 2 comprises an anti-TfR1 antibody, and wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of R 1 in each complex. In some embodiments, each R 1 independently comprises a group containing an oligonucleotide. In some embodiments, each R 1 independently comprises a group containing additional elements in addition to the oligonucleotide. In some embodiments, R 2 comprises an anti-TfR1 antibody. In some embodiments, R 2 comprises an anti-TfR1 Fab.
[0058] In R 2In some embodiments of the antibody comprising an anti-TfR1 antibody, the antibody comprises the sequences shown in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) comprising the sequence shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising the sequence shown in SEQ ID NO: 2, 8 or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising the sequence shown in SEQ ID NO: 3, 9 or 14; and / or comprises a light chain complementarity determining region 1 (CDR-L1) comprising the sequence shown in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) comprising the sequence shown in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising the sequence shown in SEQ ID NO: 6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 17, and / or comprises a light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 18. In some embodiments, the antibody comprises a VH comprising the amino acid sequence of SEQ ID NO: 17 and / or comprises a VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, the antibody comprises a heavy chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 19, and / or comprises a light chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 20. In some embodiments, the antibody comprises a heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and / or comprises a light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, an F(ab')2 fragment, a scFv or an Fv. In some embodiments, the antibody is a Fab fragment.
[0059] In some embodiments, the value of n1 for each or any complex (e.g., any complex of any of the compositions or methods disclosed herein) is an integer from 1 up to the number of amino acid residues desired or targeted for conjugation in the antibody (e.g., the number of lysine residues in the antibody). In some embodiments, in each complex, the value of n1 is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In some embodiments, in each complex, the value of n1 is independently selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. In some embodiments, in each complex, the value of n1 is independently 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3.
[0060] In some embodiments, the complexes described herein are present as a composition (e.g., in an aqueous solution) for administration to a subject. In some embodiments, the composition comprises a plurality of complexes. In some embodiments, the plurality of complexes each comprise a common targeting agent (e.g., an antibody) and a common oligonucleotide (e.g., a PMO). In some such embodiments, the different complex types are characterized by having different numbers of oligonucleotides covalently linked to the antibody. For example, in some embodiments, the composition for administration to a subject comprises a plurality of complex types, wherein each complex type comprises formula (I): [R 1 n1 -R 2 of the structure, wherein each R 1 independently comprises a compound containing an oligonucleotide (e.g., a PMO), and R 2 comprises an anti-TfR1 antibody, and wherein in each complex type, n1 is independently an integer of 1 or greater, which represents the number of instances of R 1 in each complex of that complex type, and wherein the different complex types of the composition are characterized by having different n1 values (e.g., n1 values of 1 to 27, 1 to 26, 1 to 25, 1 to 20, 1 to 15, 1 to 10, 1 to 5, or 1 to 3).
[0061] In some embodiments, the light chain constant region of the antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering). In some embodiments, the light chain of the antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by the lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody.
[0062] In some embodiments, the composition for administering to a subject in the methods described herein comprises an unconjugated antibody (e.g., in trace amounts) and an antibody conjugated to one or more oligonucleotides. In some embodiments, the unconjugated antibody can be referred to as formula (I): [R 1 n1 -R 2 a compound of structure, where n1 is zero. Thus, in some embodiments, the composition for administering to a subject in the methods described herein comprises formula (I): [R 1 n1 -R 2 a compound (e.g., complex) of structure, where each R 1 independently comprises a group containing an oligonucleotide, R 2 comprises an anti-TfR1 antibody, and n1 is independently zero or a greater integer, which reflects the number of instances of R 1 in each compound (e.g., complex). In some embodiments, compared to all compounds in the composition having a structure of formula (I): [R 1 n1 -R 2 where n1 is 1 or greater, the fraction of the compound in the composition having n1 equal to zero for this structure is less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%.
[0063] In some embodiments, each instance of R 1 in the complex is conjugated to a different amino acid residue of the antibody. In some embodiments, each different amino acid contains an ε-amino group (e.g., lysine, arginine). However, in some embodiments, each different amino acid covalently linked to R 1 is cysteine. In some embodiments, each different amino acid covalently linked to R 1 is lysine. In some embodiments, R 1 is directly covalently linked to an amino acid residue of the antibody. However, in some embodiments, R 1 Indirect covalent attachment to an amino acid of the antibody, e.g., covalent attachment to a glycosylation site on the amino acid. In some embodiments, R 1 is not covalently attached to an amino acid residue present in the CDR region of the antibody.
[0064] In some embodiments, the complexes disclosed herein comprise Formula (I): [R 1 n1 -R 2 wherein each R 1 independently comprises a group of Formula (Ia): wherein R 3 is an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO); wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of R 1 in each complex, and each R 1 is covalently attached to R 2 at the point of attachment A (e.g., indirectly or directly, e.g., directly). In some embodiments, R 2 comprises an anti-TfR1 antibody containing a sequence as shown in Table 2. For example, in some embodiments, R 2 comprises an anti-TfR1 antibody, the anti-TfR1 antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) containing a sequence as shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing a sequence as shown in SEQ ID NO: 2, 8 or 13, a heavy chain complementarity determining region 3 (CDR-H3) containing a sequence as shown in SEQ ID NO: 3, 9 or 14; and / or comprising a light chain complementarity determining region 1 (CDR-L1) containing a sequence as shown in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) containing a sequence as shown in SEQ ID NO: 5 or 11 and a light chain complementarity determining region 3 (CDR-L3) containing a sequence as shown in SEQ ID NO: 6 or 16. In some embodiments, R 2 comprises an anti-TfR1 antibody containing a heavy chain variable region (VH) and / or containing a light chain variable region (VL), the heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 17, the light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 18. In some embodiments, R 2 Comprising an anti-TfR1 antibody containing VH and / or containing VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 17 and the VL comprises the amino acid sequence of SEQ ID NO: 18. In some embodiments, R 2 Comprising an anti-TfR1 antibody containing a heavy chain and / or containing a light chain, wherein the heavy chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 19 and the light chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 20. In some embodiments, R 2 Comprising an anti-TfR1 antibody containing a heavy chain and / or containing a light chain, wherein the heavy chain comprises the amino acid sequence of SEQ ID NO: 19 and the light chain comprises the amino acid sequence of SEQ ID NO: 20. In some embodiments, R 2 Comprising an anti-TfR1 antibody that is a Fab fragment, full-length IgG, Fab' fragment, F(ab')2 fragment, scFv or Fv. In some embodiments, R 2 Comprising an anti-TfR1 antibody that is a Fab fragment. In some embodiments, R 3 Is an oligonucleotide, for example, a phosphorodiamidate morpholino oligomer (PMO) comprising the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21). In some embodiments, each internucleoside linkage of the PMO is a phosphorodiamidate linkage. In some embodiments, R 2 Comprising Fab, and each R 1 Is covalently linked (e.g., indirectly or directly, such as directly) to a different amino acid residue of the Fab at the junction point A, optionally wherein each different amino acid residue is lysine. In some embodiments, each R 1 Is covalently linked at the junction point A through a linkage site represented by a lysine (K) residue of the antibody to R 2 Covalently. In some embodiments, the light chain constant region of the antibody in the complex is covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) and / or the linkage site represented by K190 (based on Kabat numbering) of the light chain constant region. In some embodiments, the light chain of the antibody in the complex is covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, from 1 to 26, from 1 to 10, from 1 to 5 or from 1 to 3).
[0065] In some embodiments, the complexes disclosed herein comprise formula (I): [R 1 n1 -R 2 having the structure, wherein each R 1 comprises a group of formula (Ib): wherein -p is a phosphorodiamidate linkage of a phosphorodiamidate morpholino oligomer (PMO); and wherein the PMO comprises the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21), wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of R 1 in each complex, and each R 1 is covalently linked (e.g., indirectly or directly linked, such as directly linked) to R 2 at the junction point A. In some embodiments, R 2 comprises an anti-TfR1 antibody containing a sequence as shown in Table 2. For example, in some embodiments, R 2 comprises an anti-TfR1 antibody, the anti-TfR1 antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) containing a sequence as shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing a sequence as shown in SEQ ID NO: 2, 8 or 13, and a heavy chain complementarity determining region 3 (CDR-H3) containing a sequence as shown in SEQ ID NO: 3, 9 or 14; and / or comprising a light chain complementarity determining region 1 (CDR-L1) containing a sequence as shown in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) containing a sequence as shown in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing a sequence as shown in SEQ ID NO: 6 or 16. In some embodiments, R 2 comprises an anti-TfR1 antibody containing a heavy chain variable region (VH) and / or containing a light chain variable region (VL), the heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 17, and the light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 18. In some embodiments, R 2 comprises an anti-TfR1 antibody containing a VH and / or containing a VL, the VH comprising the amino acid sequence of SEQ ID NO: 17 and the VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, R 2 Comprises anti-TfR1 antibodies comprising a heavy chain and / or a light chain, wherein the heavy chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 19, and the light chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 20. In some embodiments, R 2 Comprises anti-TfR1 antibodies comprising a heavy chain and / or a light chain, wherein the heavy chain comprises the amino acid sequence of SEQ ID NO: 19 and the light chain comprises the amino acid sequence of SEQ ID NO: 20. In some embodiments, R 2 Comprises anti-TfR1 antibodies that are Fab fragments, full-length IgG, Fab' fragments, F(ab')2 fragments, scFv, or Fv. In some embodiments, R 2 Comprises anti-TfR1 antibodies that are Fab fragments. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 Comprises Fab, and each R 1 Is covalently linked (e.g., indirectly or directly, such as directly) to a different amino acid residue of the Fab at linkage point A, optionally wherein each different amino acid residue is lysine. In some embodiments, each R 1 Is covalently linked to R 2 At linkage point A through a linkage site represented by a lysine (K) residue of the antibody. In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) in the constant region of the light chain of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the anti-TfR1 antibody.
[0066] In some embodiments, the complexes disclosed herein comprise formula (I): [R 1 n1 -R 2 Of the structure, wherein each R 1 Comprises a group of formula (Ic): Wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of R 1 In each complex, and each R 1 Is at linkage point A with R 2 Covalent linkage (e.g., indirect or direct linkage, such as direct linkage). In some embodiments, R 2 comprises an anti-TfR1 antibody comprising a sequence as shown in Table 2. For example, in some embodiments, R 2 comprises an anti-TfR1 antibody, the anti-TfR1 antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) comprising a sequence as shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) comprising a sequence as shown in SEQ ID NO: 2, 8 or 13, and a heavy chain complementarity determining region 3 (CDR-H3) comprising a sequence as shown in SEQ ID NO: 3, 9 or 14; and / or comprising a light chain complementarity determining region 1 (CDR-L1) comprising a sequence as shown in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) comprising a sequence as shown in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) comprising a sequence as shown in SEQ ID NO: 6 or 16. In some embodiments, R 2 comprises an anti-TfR1 antibody comprising a heavy chain variable region (VH) and / or a light chain variable region (VL), the heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 17, and the light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 18. In some embodiments, R 2 comprises an anti-TfR1 antibody comprising a VH and / or a VL, the VH comprising the amino acid sequence of SEQ ID NO: 17 and the VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, R 2 comprises an anti-TfR1 antibody comprising a heavy chain and / or a light chain, the heavy chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 19, and the light chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 20. In some embodiments, R 2 comprises an anti-TfR1 antibody comprising a heavy chain and / or a light chain, the heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and the light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, R 2 comprises an anti-TfR1 antibody that is a Fab fragment, a full-length IgG, a Fab' fragment, an F(ab')2 fragment, a scFv or an Fv. In some embodiments, R 2An anti-TfR1 antibody that is a Fab fragment. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 comprises a Fab, and each R 1 is covalently linked to a different amino acid residue of the Fab at junction point A (e.g., indirectly or directly, such as directly), optionally wherein each different amino acid residue is lysine. In some embodiments, each R 1 is covalently linked to R 2 at junction point A through a linkage site represented by a lysine (K) residue of the antibody. In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) of the light chain constant region of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the anti-TfR1 antibody.
[0067] In some embodiments, the complexes disclosed herein comprise a structure of formula (Id): wherein -p is a phosphorodiamidate morpholino oligomer (PMO) phosphorodiamidate linkage; and wherein the PMO comprises the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21); wherein R 2 comprises an anti-TfR1 antibody (e.g., a Fab), the anti-TfR1 antibody (e.g., a Fab) comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2, optionally wherein the antibody (e.g., a Fab) comprises a VH having the amino acid sequence of SEQ ID NO: 17 and a VL having the amino acid sequence of SEQ ID NO: 18, and further optionally wherein the antibody (e.g., a Fab) comprises a heavy chain having the amino acid sequence of SEQ ID NO: 19 and a light chain having the amino acid sequence of SEQ ID NO: 20; and wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of the group enclosed in square brackets, wherein each instance of the group enclosed in square brackets is covalently linked to a different amino acid residue of the antibody (e.g., a Fab), optionally wherein each different amino acid residue is lysine. In some embodiments, R 2Comprises an anti-TfR1 antibody (e.g., Fab), said anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 1 (CDR-H1) containing a sequence as shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing a sequence as shown in SEQ ID NO: 2, 8 or 13, a heavy chain complementarity determining region 3 (CDR-H3) containing a sequence as shown in SEQ ID NO: 3, 9 or 14; and / or comprising a light chain complementarity determining region 1 (CDR-L1) containing a sequence as shown in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) containing a sequence as shown in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing a sequence as shown in SEQ ID NO: 6 or 16. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing a heavy chain variable region (VH) and / or containing a light chain variable region (VL), said heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 17, said light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 18. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing a VH and / or containing a VL, said VH comprising the amino acid sequence of SEQ ID NO: 17, said VL comprising the amino acid sequence of SEQ ID NO: 18. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing a heavy chain and / or containing a light chain, said heavy chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 19, said light chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 20. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing a heavy chain and / or containing a light chain, said heavy chain comprising the amino acid sequence of SEQ ID NO: 19, said light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, from 1 to 26, from 1 to 10, from 1 to 5 or from 1 to 3). In some embodiments, R 2An anti-TfR1 antibody (e.g., Fab) comprising different amino acid residues of an anti-TfR1 antibody (e.g., Fab) covalently linked (e.g., indirectly or directly, such as indirectly), optionally wherein each different amino acid residue is lysine. In some embodiments, each instance of the group enclosed in square brackets in the structure of formula (Id) is covalently linked to a linkage site represented by a lysine (K) residue of the anti-TfR1 antibody (e.g., Fab). In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) of the constant region of the light chain of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain of the anti-TfR1 antibody.
[0068] In some embodiments, the complex described herein comprises a structure of formula (A): Where n is from 0 to 15 (e.g., 3), and m is from 0 to 15 (e.g., 4). In some embodiments, the antibody is an anti-TfR1 antibody (e.g., the anti-TfR1 antibodies provided in Table 2). In some embodiments, the oligonucleotide is a PMO and comprises the nucleotide sequence of SEQ ID NO:21. In some embodiments, each internucleoside linkage of the PMO is a phosphorodiamidate linkage. In some embodiments, the amide adjacent to the anti-TfR1 antibody shown in the structure is produced by reaction with the amine (e.g., lysine ε-amine) of the anti-TfR1 antibody. In some embodiments, the complex described herein comprises an anti-TfR1 Fab covalently linked through a lysine of the Fab to the 5'-end of the PMO. In some embodiments, the antibody comprises the sequences shown in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) containing the sequence shown in SEQ ID NO:1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing the sequence shown in SEQ ID NO:2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) containing the sequence shown in SEQ ID NO:3, 9, or 14; and / or comprises a light chain complementarity determining region 1 (CDR-L1) containing the sequence shown in SEQ ID NO:4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) containing the sequence shown in SEQ ID NO:5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing the sequence shown in SEQ ID NO:6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:17 and / or comprises a light chain variable region (VL) containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:18. In some embodiments, the antibody comprises a VH containing the amino acid sequence of SEQ ID NO:17 and / or comprises a VL containing the amino acid sequence of SEQ ID NO:18. In some embodiments, the antibody comprises a heavy chain containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:19 and / or comprises a light chain containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:20. In some embodiments, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:19 and / or comprises a light chain containing the amino acid sequence of SEQ ID NO:20. In some embodiments, the antibody is a Fab fragment, a full-length IgG, a Fab' fragment, an F(ab')2 fragment, a scFv, or an Fv.
[0069] In each disclosed complex (e.g., comprising formula (I): [R 1 ] n1 -R 2 A complex structure such as one in which each R 1 A complex comprising a group of formula (Ia), (Ib) or (Ic); a complex comprising a structure of formula (Id); or a complex comprising a structure of formula (A)) may comprise a structure having the stereochemistry shown in formula (B): wherein n is 0 to 15 (e.g., 3), and m is 0 to 15 (e.g., 4). It is understood that the stereochemistry shown in Formula (B) is applicable to the corresponding portion of any formula or structure provided herein (e.g., Formula (Ia), (Ib), (Ic), (Id), or (A)).
[0070] In some embodiments, the complex disclosed herein (eg, comprising formula (I): [R 1 ] n1 -R 2 A complex structure such as one in which each R 1 The light chain constant region of an antibody comprising a group of formula (Ia), (Ib) or (Ic); a complex comprising a structure of formula (Id); or a complex comprising a structure of formula (A)) is independently covalently linked to an oligonucleotide at the following linkage sites: a linkage site represented by K188 (based on Kabat numbering) of the light chain constant region and / or a linkage site represented by K190 (based on Kabat numbering). In some embodiments, the complex disclosed herein (e.g., a complex comprising formula (I): [R 1 ] n1 -R 2 A complex structure such as one in which each R 1 The light chain of an antibody comprising a complex of formula (Ia), (Ib) or (Ic); a complex comprising the structure of formula (Id); or a complex comprising the structure of formula (A)) is independently covalently linked to an oligonucleotide at the following linkage site: a linkage site represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain. Antibody
[0071] In some embodiments, the complex described herein comprises an antibody that binds to human transferrin receptor 1 (TfR1). An exemplary human TfR1 amino acid sequence corresponding to NCBI sequence NP_003225.2 (transferrin receptor protein 1 isoform 1, Homo sapiens) is as follows:
[0072] Table 2 provides some examples of the sequences of anti-TfR1 antibodies that can be used for the complexes provided herein. Table 2. Some examples of anti-TfR1 antibody sequences
[0073] In some embodiments, the anti-TfR1 antibody of the present disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO:1 (according to the IMGT definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO:2 (according to the IMGT definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO:3 (according to the IMGT definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO:4 (according to the IMGT definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO:5 (according to the IMGT definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO:6 (according to the IMGT definition system).
[0074] In some embodiments, the anti-TfR1 antibody of the present disclosure comprises a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO:7 (according to the Kabat definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO:8 (according to the Kabat definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO:9 (according to the Kabat definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO:10 (according to the Kabat definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO:11 (according to the Kabat definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO:6 (according to the Kabat definition system).
[0075] In some embodiments, the anti-TfR1 antibodies of the present disclosure comprise a heavy chain complementarity determining region 1 (CDR-H1) of SEQ ID NO:12 (according to the Chothia definition system), a heavy chain complementarity determining region 2 (CDR-H2) of SEQ ID NO:13 (according to the Chothia definition system), a heavy chain complementarity determining region 3 (CDR-H3) of SEQ ID NO:14 (according to the Chothia definition system), a light chain complementarity determining region 1 (CDR-L1) of SEQ ID NO:15 (according to the Chothia definition system), a light chain complementarity determining region 2 (CDR-L2) of SEQ ID NO:5 (according to the Chothia definition system), and a light chain complementarity determining region 3 (CDR-L3) of SEQ ID NO:16 (according to the Chothia definition system).
[0076] In some embodiments, the anti-TfR1 antibodies of the present disclosure comprise a heavy chain variable region (VH) that, compared to a VH comprising the amino acid sequence of SEQ ID NO:17, comprises no more than 25 amino acid variations in the framework region (e.g., no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid variation). As an alternative or in addition (e.g., in addition), the anti-TfR1 antibodies of the present disclosure comprise a light chain variable region (VL) that, compared to a VL comprising the amino acid sequence of SEQ ID NO:18, comprises no more than 25 amino acid variations in the framework region (e.g., no more than 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acid variation).
[0077] In some embodiments, the anti-TfR1 antibodies of the present disclosure comprise a VH that comprises an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identity to the VH comprising the amino acid sequence of SEQ ID NO:17 in the framework region. As an alternative or in addition (e.g., in addition), in some embodiments, the anti-TfR1 antibodies of the present disclosure comprise a VL that comprises an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98%, or 99%) identity to the VL comprising the amino acid sequence of SEQ ID NO:18 in the framework region.
[0078] In some embodiments, the anti-TfR1 antibody of the present disclosure comprises a VH containing the amino acid sequence of SEQ ID NO: 17. As an alternative or in addition (e.g., in addition), in some embodiments, the anti-TfR1 antibody of the present disclosure comprises a VL containing the amino acid sequence of SEQ ID NO: 18.
[0079] In some embodiments, the anti-TfR1 antibody of the present disclosure comprises a heavy chain containing an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identity to the amino acid sequence of SEQ ID NO: 19. As an alternative or in addition (e.g., in addition), the anti-TfR1 antibody of the present disclosure comprises a light chain containing an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identity to the amino acid sequence of SEQ ID NO: 20. In some embodiments, the anti-TfR1 antibody of the present disclosure is a Fab comprising a heavy chain containing an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identity to the amino acid sequence of SEQ ID NO: 19. As an alternative or in addition (e.g., in addition), the anti-TfR1 antibody of the present disclosure is a Fab comprising a light chain containing an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 95%, 98% or 99%) identity to the amino acid sequence of SEQ ID NO: 20.
[0080] In some embodiments, the anti-TfR1 antibody of the present disclosure comprises a heavy chain containing the amino acid sequence of SEQ ID NO: 19. As an alternative or in addition (e.g., in addition), the anti-TfR1 antibody of the present disclosure comprises a light chain containing the amino acid sequence of SEQ ID NO: 20. In some embodiments, the anti-TfR1 antibody of the present disclosure is a Fab comprising a heavy chain containing the amino acid sequence of SEQ ID NO: 19. As an alternative or in addition (e.g., in addition), the anti-TfR1 antibody of the present disclosure is a Fab comprising a light chain containing the amino acid sequence of SEQ ID NO: 20.
[0081] In some embodiments, the anti-TfR1 antibodies provided herein can have one or more post-translational modifications. In some embodiments, N-terminal cyclization, also known as pyro-Glu formation, can occur at the N-terminal glutamate (Glu) and / or glutamine (Gln) residues of the antibody during production. Thus, it should be understood that antibodies designated as having a sequence that includes an N-terminal glutamate or glutamine residue encompass antibodies that have undergone pyro-Glu formation due to post-translational modification. In some embodiments, pyro-Glu formation occurs in the heavy chain sequence. In some embodiments, the formation of pyro-Glu occurs in the light chain sequence. Linkage site
[0082] Complexes are provided herein that include an antibody covalently linked to one or more oligonucleotides. In some embodiments, the antibody includes a heavy chain that contains a heavy chain variable region (VH) and a heavy chain constant region and a light chain that contains a light chain variable region (VL) and a light chain constant region. In some embodiments, each of the one or more oligonucleotides is covalently linked at a linkage site represented by a lysine (K) residue of the antibody. In some embodiments, compositions are provided that include multiple complexes, where each complex includes an antibody covalently linked to one or more oligonucleotides, and each of the one or more oligonucleotides is linked to the antibody via a different linkage site.
[0083] In some embodiments, the linkage site is located in the light chain of the antibody. In some embodiments, the linkage site is located in the light chain constant region of the antibody. For example, in some embodiments, the linkage site is represented by K188 or K190 of the light chain constant region based on Kabat numbering.
[0084] In some embodiments, the light chain constant region of the antibody in the complex of the composition is covalently linked to the oligonucleotide independently at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering). For example, in some embodiments, the linkage site is represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody. In some embodiments, the linkage site is represented by K190 (based on Kabat numbering) of the light chain constant region of the antibody. In some embodiments, the linkage site is represented by K188 (based on Kabat numbering) and K190 (based on Kabat numbering) of the light chain constant region of the antibody. In some embodiments, at least 80% (e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) of the light chain constant region of the antibody in the complex of the composition is covalently linked to the oligonucleotide independently at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering). In some embodiments, about 80% to 98%, 80% to 95%, 80% to 90%, 80% to 85%, 85% to 98%, 85% to 95%, 85% to 90%, 90% to 98%, 90% to 95%, 95% to 97%, or 95% to 98% of the light chain constant region of the antibody in the complex of the composition is covalently linked to the oligonucleotide independently at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering). In some embodiments, about 85% to 95% (e.g., 85% to 95%, 85% to 90% or 90% to 95%) of the light chain constant region of the antibody in the complex of the composition is covalently linked to the oligonucleotide independently at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering). In some embodiments, 90% to 95% (e.g., about 90%, about 91%, about 92%, about 93%, about 94% or about 95%) of the light chain constant region of the antibody in the complex of the composition is covalently linked to the oligonucleotide independently at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering).It should be understood that the complex of the light chain constant region of an antibody covalently linked to an oligonucleotide at the linkage site represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) of the light chain constant region includes: a complex of an antibody covalently linked to an oligonucleotide at the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody; a complex of an antibody covalently linked to an oligonucleotide at the linkage site represented by K190 (based on Kabat numbering) of the light chain constant region of the antibody; and / or a complex of an antibody covalently linked to an oligonucleotide at the linkage sites represented by K188 (based on Kabat numbering) and K190 (based on Kabat numbering) of the light chain constant region of the antibody.
[0085] In some embodiments, the number of lysine (K) residues referred to herein is based on Kabat numbering (Kabat et al. (1971) Ann. NY Acad, Sci. 190: 382-391 and Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)). The variable and constant regions of the heavy chain and the variable and constant regions of the light chain of the antibodies provided herein are numbered separately. Kabat numbering of the variable regions of the light and heavy chains of antibodies is described in the art, for example, in Kabat et al. (1971) Ann. NY Acad, Sci. 190: 382-391 and Kabat et al., Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. (1987) and (1991)). Kabat numbering of the constant regions of the light and heavy chains of the antibodies provided herein can be found at imgt.org / IMGTScientificChart / Numbering / Hu_IGHGnber.html and imgt.org / IMGTScientificChart / Numbering / Hu_IGKCnber.html (see also Edelman, G.M. et al., Proc. Natl. Acad. USA, 63, 78-85 (1969). PMID: 5257969; Hieter, P.A. et al., Cell, 22, 197-207 (1980). PMID: 6775818; Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md. 647, 662, 680, 689 (1991)).
[0086] In some embodiments, the light chain of the antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. For example, in some embodiments, the linkage site is represented by the K at the 4th position of the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. In some embodiments, the linkage site is represented by the K at the 6th position of the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. In some embodiments, the linkage sites are represented by the K at the 4th position and the K at the 6th position of the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. In some embodiments, at least 80% (e.g., at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99%) of the light chains of the antibody in the complex of the composition are independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. In some embodiments, 80% to 98%, 80% to 95%, 80% to 90%, 80% to 85%, 85% to 98%, 85% to 95%, 85% to 90%, 90% to 98%, 90% to 95%, 95% to 97% or 95% to 98% of the light chains of the antibody in the complex of the composition are independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. In some embodiments, 85% to 95% (e.g., 85% to 95%, 85% to 90% or 90% to 95%) of the light chains of the antibody in the complex of the composition are independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody. In some embodiments, 90% to 95% (e.g., about 90%, about 91%, about 92%, about 93%, about 94% or about 95%) of the light chains of the antibody in the complex of the composition are independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody.It should be understood that the complex of the light chain of the antibody covalently linked to the oligonucleotide at the linkage site represented by the lysine (K) residue contained in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody includes: the complex of the antibody covalently linked to the oligonucleotide at the linkage site represented by K at position 4 contained in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody; the complex of the antibody covalently linked to the oligonucleotide at the linkage site represented by K at position 6 contained in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody; and / or the complex of the antibody covalently linked to the oligonucleotide at the linkage site represented by K at position 4 and the linkage site represented by K at position 6 contained in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain.
[0087] As used herein, the term "about" refers to a variation of ±5% to 10% based on the % being modified by the term. oligonucleotide
[0088] In some embodiments, the oligonucleotides of the complexes described herein are single-stranded oligonucleotides. In some embodiments, the oligonucleotides can be used to target DMD (e.g., for exon skipping). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) target a DMD allele (e.g., a mutant DMD allele). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) target a region of DMD RNA (e.g., the Dp427m transcript of SEQ ID NO: 23, or DMD RNA, such as a pre-mRNA, that contains the sequence of SEQ ID NO: 26). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) comprise a complementary region of DMD RNA (e.g., the Dp427m transcript of SEQ ID NO: 23). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) comprise a complementary region of an exon (e.g., exon 45) or an intron of DMD RNA. In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) target a splice donor site, a splice acceptor site, a branch point, or an exon splicing enhancer (ESE) of DMD RNA (e.g., the DMD pre-mRNA encoded by the human dystrophin (DMD) gene (e.g., NCBI accession number NG_012232.1)). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) target an exon splicing enhancer (ESE) sequence in DMD (e.g., the ESE sequence of exon 45). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) target a splice acceptor site sequence in DMD (e.g., the splice acceptor site sequence of exon 45).
[0089] Some examples of DMD RNA sequences and exon sequences that can be targeted by the oligonucleotides of the complexes are provided below.
[0090] Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA (NCBI Reference Sequence: NM_004006.2; SEQ ID NO: 23).
[0091] Homo sapiens dystrophin (DMD), locus around exon 45 (nucleotides 1376066 to 1376301 of NCBI Reference Sequence: NG_012232.1; exon 45 Underlined ):
[0092] Homo sapiens dystrophin (DMD), transcript variant Dp427m, exon 45 (nucleotides 6683 to 6858 of NCBI Reference Sequence: NM_004006.2):
[0093] In some embodiments, the oligonucleotides useful for targeting DMD (e.g., for exon skipping) are 10 to 35 (e.g., 10 to 35, 15 to 35, 10 to 30, 15 to 30, 15 to 25, 17 to 27, 18 to 26, 19 to 25, 20 to 24, 20 to 35, 20 to 30, 20 to 25, 20 to 23, 21 to 24, 21 to 23, or 20 to 22) nucleotides in length. In some embodiments, the oligonucleotides useful for targeting DMD (e.g., for exon skipping) are 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length, optionally 17 to 27 nucleotides, or 22 nucleotides in length.
[0094] In some embodiments, the oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a complementary region of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides of the DMD RNA. In some embodiments, the oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a complementary region of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides of an exon of the DMD RNA.
[0095] In some embodiments, the oligonucleotides useful for targeting DMD (e.g., for exon skipping) comprise a complementary region of at least 8 (e.g., at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30) consecutive nucleotides of the DMD sequence as set forth in any one of SEQ ID NO: 23 to 26.
[0096] In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) comprise a complementary region having at least 6 (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22) consecutive nucleotides of the target sequence as shown in SEQ ID NO: 25 (CAGgAACTCCAGGATGGCATTG). In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) comprise at least 6 (e.g., at least 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22) consecutive nucleotides of the sequence shown in SEQ ID NO: 21 (CAATGCCATCCTGGAGTTCCTG).
[0097] In some embodiments, the oligonucleotides that can be used to target DMD (e.g., for exon skipping) comprise the nucleotide sequence of SEQ ID NO: 21. In some embodiments, any one of the oligonucleotides provided herein is a PMO. In some embodiments, each internucleoside linkage of the PMO is a phosphorodiamidate linkage.
[0098] In some embodiments, it should be understood that methylation of the nucleobase uracil at the C5 position forms thymine. Thus, in some embodiments, a nucleotide or nucleoside having C5-methylated uracil (or 5-methyl-uracil) can be equivalently identified as a thymine nucleotide or nucleoside.
[0099] In some embodiments, any one or more thymine bases (T) in any of the oligonucleotides provided herein (e.g., the oligonucleotide shown in SEQ ID NO: 21) can be independently and optionally a uracil base (U), and / or any one or more Us in the oligonucleotides provided herein can be independently and optionally a T. Composition
[0100] In some embodiments, a composition comprising a complex (i.e., multiple complexes) is formulated in a manner suitable for the methods described herein. In some embodiments, a formulation is used to deliver a composition comprising a muscle-targeting complex to a subject, the formulation minimizing degradation, facilitating delivery and / or (e.g., and) uptake, or providing additional beneficial properties to the complexes in the formulation. Thus, in some embodiments, a composition comprising a complex (e.g., multiple complexes comprising a PMO covalently linked to a Fab) is formulated with a suitable buffer (e.g., a pharmaceutically acceptable buffer). In some embodiments, a composition comprising a muscle-targeting complex (e.g., a complex comprising a PMO covalently linked to a Fab) is formulated in an aqueous solution. In some embodiments, a composition comprising multiple complexes can be lyophilized (e.g., for storage). In some embodiments, the lyophilized composition can be reconstituted (e.g., with water) for administration to a subject. The composition (e.g., in an aqueous solution or in a lyophilized composition) can be appropriately prepared such that when administered to a subject, whether administered into the immediate environment of the target cells or systemically, a sufficient amount of the complex can enter the target muscle cells.
[0101] In some embodiments, a composition for administration to a subject in the methods described herein (e.g., a composition in an aqueous solution) comprises a complex (i.e., multiple complexes), wherein each complex comprises a phosphorodiamidate morpholino oligomer (PMO) covalently linked to an antibody. In some embodiments, a composition for administration to a subject in the methods described herein (e.g., a composition in an aqueous solution) comprises a complex, wherein each complex comprises a phosphorodiamidate morpholino oligomer (PMO) covalently linked to an anti-TfR1 antibody, optionally, wherein the antibody of such a complex comprises CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 as shown in Table 2, and further optionally, wherein the antibody of such a complex comprises VH and / or (e.g., and) VL as shown in Table 2. In some embodiments, the antibody is an anti-TfR1 Fab (e.g., an anti-TfR1 Fab comprising CDRs having the amino acid sequences as shown in Table 2 and / or VH and / or VL having the amino acid sequences as shown in Table 2).
[0102] In some embodiments, a composition for administration to a subject in the methods described herein (e.g., a composition in an aqueous solution) comprises a complex (i.e., multiple complexes), wherein each complex is of formula (I): [R 1 n1 -R 2 wherein each R 1 independently comprises a compound containing an oligonucleotide (e.g., a PMO) and is covalently linked to R 2 wherein R2 comprises an anti-TfR1 antibody, and wherein in each complex, n1 is independently an integer of 1 or greater, which represents the number of instances of R in each complex 1 in the composition.
[0103] In some embodiments, the value of n1 for each complex in the composition is independently and optionally an integer from 1 up to the number of amino acid residues in the antibody (R 2 ) that are desired or targeted for conjugation (e.g., the number of lysine residues). In some embodiments, the value of n1 for each complex in the composition is independently and optionally selected from the integers 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, and 27. In some embodiments, the value of n1 for each complex in the composition is independently and optionally selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, and 26. In some embodiments, the value of n1 for each complex in the composition is independently and optionally selected from the integers from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3. In some embodiments, the average value of n1 for the complexes in the composition is from 1 to 3, 1 to 5, 1 to 10, 1 to 26, or 1 to 27.
[0104] In some embodiments, the composition for administration to a subject in the methods described herein comprises an unconjugated antibody (e.g., in trace amounts) and an antibody conjugated to one or more oligonucleotides. In some embodiments, the unconjugated antibody can be referred to as of formula (I): [R 1 n1 -R 2 a compound of structure, wherein n1 is zero. Thus, in some embodiments, the composition for administration to a subject in the methods described herein comprises a compound of formula (I): [R 1 n1 -R 2 a compound (e.g., a complex) of structure, wherein each R 1 independently comprises a group containing an oligonucleotide, R 2 comprises an anti-TfR1 antibody, and n1 is independently zero or an integer greater, which reflects the number of instances of R in each compound (e.g., complex). In some embodiments, in the composition having formula (I): [R 1 1 n1 -R 2 Compared to all compounds in which n1 of the structure is 1 or greater, the fraction of the compound in the composition in which n1 of the structure is zero is less than 10%, less than 5%, less than 1%, less than 0.5%, less than 0.1%, less than 0.05%, or less than 0.01%.
[0105] In some embodiments, R in the complexes herein (e.g., the complexes of the compositions provided herein) 1 each instance of is conjugated to a different amino acid residue of the antibody. In some embodiments, each different amino acid contains an ε-amino group (e.g., lysine, arginine). However, in some embodiments, the R 1 each different amino acid covalently linked to is cysteine. In some embodiments, the R 1 each different amino acid covalently linked to is lysine. In some embodiments, R 1 is directly covalently linked to an amino acid residue of the antibody. However, in some embodiments, R 1 is indirectly covalently linked to an amino acid of the antibody, e.g., covalently linked to a glycosylation site on the amino acid. In some embodiments, there is provided a formulation in which the R 1 complex conjugated to an amino acid residue present in the CDR region of the antibody is present only in trace amounts, or in undetectable amounts, or not at all. In some embodiments, there is provided a formulation in which the R 1 complex conjugated to an amino acid residue present in the CDR region of the antibody is undetectable in the formulation using standard detection techniques.
[0106] In some embodiments, the light chain constant region of the antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of the antibody and / or the linkage site represented by K190 (based on Kabat numbering). In some embodiments, the light chain of the antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by the lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody.
[0107] In some embodiments, the compositions described herein (e.g., the compositions in aqueous solution) comprise complexes containing formula (I): [R 1 n1 -R 2 structures, wherein each R in the complexes of the compositions provided herein 1 independently comprises a group of formula (Ia): wherein R3 is an oligonucleotide, such as a phosphorodiamidate morpholino oligomer (PMO); wherein in each complex, n1 is independently an integer (eg, 1 or greater) representing the number of R 1 The number of instances, and each R 1 At the connection point A and R 2 In some embodiments, R 2 The invention comprises an anti-TfR1 antibody comprising a sequence as shown in Table 2. For example, in some embodiments, R 2 The invention comprises an anti-TfR1 antibody, wherein the anti-TfR1 antibody comprises a heavy chain complementary determining region 1 (CDR-H1) comprising a sequence as shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementary determining region 2 (CDR-H2) comprising a sequence as shown in SEQ ID NO: 2, 8 or 13, and a heavy chain complementary determining region 3 (CDR-H3) comprising a sequence as shown in SEQ ID NO: 3, 9 or 14; and / or comprises a light chain complementary determining region 1 (CDR-L1) comprising a sequence as shown in SEQ ID NO: 4, 10 or 15, a light chain complementary determining region 2 (CDR-L2) comprising a sequence as shown in SEQ ID NO: 5 or 11, and a light chain complementary determining region 3 (CDR-L3) comprising a sequence as shown in SEQ ID NO: 6 or 16. In some embodiments, R 2 An anti-TfR1 antibody comprising a heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 17 and / or comprising a light chain variable region (VL), wherein the heavy chain variable region (VH) comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 18. In some embodiments, R 2 The invention comprises an anti-TfR1 antibody comprising a VH and / or comprising a VL, wherein the VH comprises the amino acid sequence of SEQ ID NO: 17, and the VL comprises the amino acid sequence of SEQ ID NO: 18. In some embodiments, R 2 An anti-TfR1 antibody comprising a heavy chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 19 and / or comprising a light chain comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO: 20. In some embodiments, R 2Comprises anti-TfR1 antibodies containing heavy chains and / or light chains, said heavy chain comprising the amino acid sequence of SEQ ID NO: 19 and said light chain comprising the amino acid sequence of SEQ ID NO: 20. In some embodiments, R 2 Comprises anti-TfR1 antibodies that are Fab fragments, full-length IgG, Fab’ fragments, F(ab’)2 fragments, scFv or Fv. In some embodiments, R 2 Comprises anti-TfR1 antibodies that are Fab fragments. In some embodiments, R 3 Is an oligonucleotide, e.g., a phosphorodiamidate morpholino oligomer (PMO) comprising the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO: 21). In some embodiments, each internucleoside linkage of the PMO is a phosphorodiamidate linkage. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab), and each R 1 Is covalently linked (e.g., indirectly or directly, e.g., directly) to a different amino acid residue of the antibody (e.g., Fab) at attachment point A, optionally wherein each different amino acid residue is a lysine. In some embodiments, each R 1 Is covalently linked at attachment point A to R 2 via a linkage site represented by a lysine (K) residue of the antibody. In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) of the constant region of the light chain of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the anti-TfR1 antibody. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, 1 to 26, 1 to 10, 1 to 5 or 1 to 3). In some embodiments, a composition (e.g., a composition in an aqueous solution) for administration to a subject in the methods described herein comprises a complex comprising formula (I): [R 1 n1 -R 2 having a structure wherein n1 is 0.
[0108] In some embodiments, a composition (e.g., a composition in an aqueous solution) described herein comprises a complex having the structure of formula (I): [R 1 n1 -R 2 wherein each instance of R 1 in the complex of the composition provided herein comprises a group of formula (Ib): wherein -p is the phosphorodiamidate linkage of a phosphorodiamidate morpholino oligomer (PMO); and wherein the PMO comprises the base sequence of GAATGCCATCCTGGAGTTCCTG (SEQ ID NO:21), wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of R in each complex 1 instances, and each R 1 is covalently linked to R at the junction point A 2 (e.g., indirectly or directly linked, e.g., directly linked). In some embodiments, R 2 comprises an anti-TfR1 antibody containing a sequence as shown in Table 2. For example, in some embodiments, R 2 comprises an anti-TfR1 antibody, the anti-TfR1 antibody comprising a heavy chain complementarity determining region 1 (CDR-H1) containing a sequence as shown in SEQ ID NO:1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing a sequence as shown in SEQ ID NO:2, 8 or 13, a heavy chain complementarity determining region 3 (CDR-H3) containing a sequence as shown in SEQ ID NO:3, 9 or 14; and / or comprising a light chain complementarity determining region 1 (CDR-L1) containing a sequence as shown in SEQ ID NO:4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) containing a sequence as shown in SEQ ID NO:5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing a sequence as shown in SEQ ID NO:6 or 16. In some embodiments, R 2 comprises an anti-TfR1 antibody containing a heavy chain variable region (VH) and / or a light chain variable region (VL), the heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:17, the light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:18. In some embodiments, R 2 comprises an anti-TfR1 antibody containing a VH and / or a VL, the VH comprising the amino acid sequence of SEQ ID NO:17, the VL comprising the amino acid sequence of SEQ ID NO:18. In some embodiments, R 2Comprises an anti-TfR1 antibody comprising a heavy chain and / or a light chain, wherein the heavy chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:19, and the light chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:20. In some embodiments, R 2 Comprises an anti-TfR1 antibody comprising a heavy chain and / or a light chain, wherein the heavy chain comprises the amino acid sequence of SEQ ID NO:19 and the light chain comprises the amino acid sequence of SEQ ID NO:20. In some embodiments, R 2 Comprises an anti-TfR1 antibody that is a Fab fragment, full-length IgG, Fab' fragment, F(ab')2 fragment, scFv or Fv. In some embodiments, R 2 Comprises an anti-TfR1 antibody that is a Fab fragment. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, 1 to 26, 1 to 10, 1 to 5 or 1 to 3). In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab), and each R 1 Is covalently linked (e.g., indirectly or directly, e.g., directly) to a different amino acid residue of the antibody (e.g., Fab) at junction point A, optionally wherein each different amino acid residue is lysine. In some embodiments, each R 1 Is covalently linked at junction point A to R 2 Via a linkage site represented by a lysine (K) residue of the antibody. In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) in the constant region of the light chain of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain of the anti-TfR1 antibody. In some embodiments, the composition (e.g., a composition in aqueous solution) for administration to a subject in the methods described herein further comprises a complex comprising formula (I): [R 1 n1 -R 2 Of the structure, wherein n1 is 0.
[0109] In some embodiments, the composition (e.g., a composition in aqueous solution) described herein comprises a complex having the structure of formula (I): [R 1 n1 -R 2 Structure, wherein R in the complex of the composition provided herein 1 Each instance of contains a group of formula (Ic): 1 wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of R in each complex, and each R 1 is covalently linked (e.g., indirectly or directly linked, such as directly linked) to R at the junction point A. 2 In some embodiments, R 2 contains an anti-TfR1 antibody containing a sequence as shown in Table 2. For example, in some embodiments, R 2 contains an anti-TfR1 antibody, and the anti-TfR1 antibody contains a heavy chain complementarity determining region 1 (CDR-H1) containing a sequence as shown in SEQ ID NO: 1, 7 or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing a sequence as shown in SEQ ID NO: 2, 8 or 13, and a heavy chain complementarity determining region 3 (CDR-H3) containing a sequence as shown in SEQ ID NO: 3, 9 or 14; and / or contains a light chain complementarity determining region 1 (CDR-L1) containing a sequence as shown in SEQ ID NO: 4, 10 or 15, a light chain complementarity determining region 2 (CDR-L2) containing a sequence as shown in SEQ ID NO: 5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing a sequence as shown in SEQ ID NO: 6 or 16. In some embodiments, R 2 contains an anti-TfR1 antibody containing a heavy chain variable region (VH) and / or a light chain variable region (VL), and the heavy chain variable region (VH) contains an amino acid sequence having at least 85% (e.g., at least 95%) identity with SEQ ID NO: 17, and the light chain variable region (VL) contains an amino acid sequence having at least 85% (e.g., at least 95%) identity with SEQ ID NO: 18. In some embodiments, R 2 contains an anti-TfR1 antibody containing a VH and / or a VL, the VH contains the amino acid sequence of SEQ ID NO: 17, and the VL contains the amino acid sequence of SEQ ID NO: 18. In some embodiments, R 2 contains an anti-TfR1 antibody containing a heavy chain and / or a light chain, the heavy chain contains an amino acid sequence having at least 85% (e.g., at least 95%) identity with SEQ ID NO: 19, and the light chain contains an amino acid sequence having at least 85% (e.g., at least 95%) identity with SEQ ID NO: 20. In some embodiments, R 2Comprises anti-TfR1 antibodies containing a heavy chain and / or a light chain, the heavy chain comprising the amino acid sequence of SEQ ID NO:19 and the light chain comprising the amino acid sequence of SEQ ID NO:20. In some embodiments, R 2 Comprises anti-TfR1 antibodies that are Fab fragments, full-length IgG, Fab’ fragments, F(ab’)2 fragments, scFv or Fv. In some embodiments, R 2 Comprises anti-TfR1 antibodies that are Fab fragments. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, 1 to 26, 1 to 10, 1 to 5, or 1 to 3). In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab), and each R 1 Is covalently linked (e.g., indirectly or directly, such as directly) to a different amino acid residue of the antibody (e.g., Fab) at junction point A, optionally wherein each different amino acid residue is lysine. In some embodiments, each R 1 Is covalently linked at junction point A to R 2 Through a linkage site represented by a lysine (K) residue of the antibody. In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) of the constant region of the light chain of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by a lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain of the anti-TfR1 antibody. In some embodiments, the composition (e.g., a composition in an aqueous solution) for administration to a subject in the methods described herein further comprises a complex comprising formula (I): [R 1 n1 -R 2 Of structure, where n1 is 0.
[0110] In some embodiments, the composition (e.g., a composition in an aqueous solution) described herein comprises a complex containing the structure of formula (Id): Wherein -p is a phosphorodiamidate morpholino oligomer (PMO) phosphorodiamidate linkage; and wherein the PMO comprises the base sequence CAATGCCATCCTGGAGTTCCTG (SEQ ID NO:21), where R 2 Comprises an anti-TfR1 antibody (e.g., Fab), said anti-TfR1 antibody (e.g., Fab) comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2, and CDR-L3 selected from Table 2, optionally wherein said antibody (e.g., Fab) comprises a VH containing the amino acid sequence of SEQ ID NO:17 and a VL containing the amino acid sequence of SEQ ID NO:18, and further optionally wherein said antibody (e.g., Fab) comprises a heavy chain containing the amino acid sequence of SEQ ID NO:19 and a light chain containing the amino acid sequence of SEQ ID NO:20; and wherein in each complex, n1 is independently an integer (e.g., an integer of 1 or greater), which represents the number of instances of the group enclosed by square brackets, wherein each instance of the group enclosed by square brackets is covalently linked to a different amino acid residue of the antibody (e.g., Fab), optionally wherein each different amino acid residue is lysine. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing the sequences shown in Table 2. For example, in some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab), said anti-TfR1 antibody (e.g., Fab) comprising a heavy chain complementarity determining region 1 (CDR-H1) containing the sequence shown in SEQ ID NO:1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing the sequence shown in SEQ ID NO:2, 8, or 13, and a heavy chain complementarity determining region 3 (CDR-H3) containing the sequence shown in SEQ ID NO:3, 9, or 14; and / or comprising a light chain complementarity determining region 1 (CDR-L1) containing the sequence shown in SEQ ID NO:4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) containing the sequence shown in SEQ ID NO:5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing the sequence shown in SEQ ID NO:6 or 16. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing a heavy chain variable region (VH) and / or a light chain variable region (VL), said heavy chain variable region (VH) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:17, and said light chain variable region (VL) comprising an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:18. In some embodiments, R 2 Comprises an anti-TfR1 antibody (e.g., Fab) containing a VH and / or a VL, said VH comprising the amino acid sequence of SEQ ID NO:17 and said VL comprising the amino acid sequence of SEQ ID NO:18. In some embodiments, R 2Comprising an anti-TfR1 antibody (e.g., Fab) containing a heavy chain and / or a light chain, wherein the heavy chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:19, and the light chain comprises an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:20. In some embodiments, R 2 Comprising an anti-TfR1 antibody (e.g., Fab) containing a heavy chain and / or a light chain, wherein the heavy chain comprises the amino acid sequence of SEQ ID NO:19 and the light chain comprises the amino acid sequence of SEQ ID NO:20. In some embodiments, in each complex, n1 is independently an integer (e.g., an integer from 1 to 27, from 1 to 26, from 1 to 10, from 1 to 5, or from 1 to 3). In some embodiments, in each complex, n1 is independently an integer of 1 or greater. In some embodiments, R 2 Comprising an anti-TfR1 antibody (e.g., Fab) covalently linked (e.g., indirectly or directly linked, e.g., indirectly linked) through different amino acid residues of the anti-TfR1 antibody (e.g., Fab), optionally wherein each different amino acid residue is lysine. In some embodiments, each instance of the group enclosed by the square brackets in the structure of formula (Id) is covalently linked to the linkage site represented by the lysine (K) residue of the anti-TfR1 antibody (e.g., Fab). In some embodiments, the lysine (K) residue linkage site of the anti-TfR1 antibody is represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) in the constant region of the light chain of the anti-TfR1 antibody. In some embodiments, the lysine (K) residue linkage site is represented by the lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain of the anti-TfR1 antibody. In some embodiments, the composition (e.g., a composition in an aqueous solution) for administration to a subject in the methods described herein further comprises a complex wherein n1 is 0.
[0111] In some embodiments, the composition described herein (e.g., an aqueous solution) comprises a structure of formula (A): (A), where n is from 0 to 15 (e.g., 3), and m is from 0 to 15 (e.g., 4). In some embodiments, the antibody is an anti-TfR1 antibody (e.g., the anti-TfR1 antibodies provided in Table 2). In some embodiments, the oligonucleotide is a PMO and comprises the base sequence of SEQ ID NO:21. In some embodiments, each internucleoside linkage of the PMO is a phosphorodiamidate linkage. In some embodiments, the amide adjacent to the antibody shown in the structure is produced by reaction with the amine of the antibody (e.g., lysine ε-amine). In some embodiments, the antibody comprises the sequences shown in Table 2. For example, in some embodiments, the antibody comprises a heavy chain complementarity determining region 1 (CDR-H1) containing the sequence shown in SEQ ID NO:1, 7, or 12, a heavy chain complementarity determining region 2 (CDR-H2) containing the sequence shown in SEQ ID NO:2, 8, or 13, a heavy chain complementarity determining region 3 (CDR-H3) containing the sequence shown in SEQ ID NO:3, 9, or 14; and / or comprises a light chain complementarity determining region 1 (CDR-L1) containing the sequence shown in SEQ ID NO:4, 10, or 15, a light chain complementarity determining region 2 (CDR-L2) containing the sequence shown in SEQ ID NO:5 or 11, and a light chain complementarity determining region 3 (CDR-L3) containing the sequence shown in SEQ ID NO:6 or 16. In some embodiments, the antibody comprises a heavy chain variable region (VH) containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:17 and / or comprises a light chain variable region (VL) containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:18. In some embodiments, the antibody comprises a VH containing the amino acid sequence of SEQ ID NO:17 and / or comprises a VL containing the amino acid sequence of SEQ ID NO:18. In some embodiments, the antibody comprises a heavy chain containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:19 and / or comprises a light chain containing an amino acid sequence having at least 85% (e.g., at least 95%) identity to SEQ ID NO:20. In some embodiments, the antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:19 and / or comprises a light chain containing the amino acid sequence of SEQ ID NO:20. In some embodiments, the antibody is a Fab fragment, full-length IgG, Fab’ fragment, F(ab’)2 fragment, scFv, or Fv.
[0112] In each composition disclosed herein, the complex of the composition (e.g., comprising formula (I): [R 1 n1 -R 2 A complex of the structure, such as where each R 1 A complex containing a group of formula (Ia), (Ib) or (Ic); a complex containing a structure of formula (Id); or a complex containing a structure of formula (A)) may contain a structure having the stereochemistry shown in formula (B): where n is from 0 to 15 (such as 3), and m is from 0 to 15 (such as 4). It should be understood that the stereochemistry shown in formula (B) can be applied to the corresponding part of any formula or structure provided herein (e.g., formula (Ia), (Ib), (Ic), (Id) or (A)).
[0113] In some embodiments, the complex of the composition disclosed herein (e.g., containing formula (I): [R 1 n1 -R 2 of the structure, such as where each R 1 A complex containing a group of formula (Ia), (Ib) or (Ic); a complex containing a structure of formula (Id); or a complex containing a structure of formula (A)) the light chain constant region of the antibody in the complex is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by K188 (based on Kabat numbering) and / or K190 (based on Kabat numbering) of the light chain constant region of the antibody in the complex. In some embodiments, the complex of the composition disclosed herein (e.g., containing formula (I): [R 1 n1 -R 2 of the structure, such as where each R 1 A complex containing a group of formula (Ia), (Ib) or (Ic); a complex containing a structure of formula (Id); or a complex containing a structure of formula (A)) the light chain of the antibody in the complex is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain of the antibody in the complex.
[0114] In some embodiments, there is provided a product (e.g., the lyophilized composition described herein) produced by a method including lyophilizing an aqueous solution of the composition described herein (e.g., in aqueous form).
[0115] In some embodiments, the composition is formulated to be compatible with its intended route of administration. Some examples of the route of administration include parenteral administration, such as intravenous, intradermal, subcutaneous administration. Generally, the route of administration is intravenous or subcutaneous. Use / Treatment method
[0116] As described herein, a complex comprising an anti-TfR1 antibody (e.g., Fab) covalently linked to an oligonucleotide (e.g., a phosphorodiamidate morpholino oligomer (PMO)) is effective in treating a subject having a dystrophinopathy (e.g., Duchenne muscular dystrophy). In some embodiments, the complex comprises an oligonucleotide that promotes exon skipping of an mRNA expressed from a mutant DMD allele.
[0117] In some embodiments, the subject can be a human subject, a non-human primate subject, a rodent subject, or any suitable mammalian subject. In some embodiments, the subject can have Duchenne muscular dystrophy or other dystrophinopathy. In some embodiments, the subject has a mutant DMD allele that optionally comprises at least one mutation in a DMD exon that causes a frameshift mutation and results in incorrect RNA splicing / processing. In some embodiments, the subject has symptoms of severe dystrophinopathy, such as muscle atrophy or muscle loss. In some embodiments, the subject has an asymptomatic elevation of the creatine phosphokinase (CK) serum concentration and / or (e.g., and) muscle cramps accompanied by myoglobinuria. In some embodiments, the subject has a progressive muscle disease, such as Duchenne muscular dystrophy or Becker muscular dystrophy or DMD-related dilated cardiomyopathy (DCM). In some embodiments, the subject does not have symptoms of dystrophinopathy.
[0118] In some embodiments, the subject has a mutation in the DMD gene suitable for exon 45 skipping. In some embodiments, the complex described herein can be effective in treating a subject having a mutation in the DMD gene suitable for exon 45 skipping. In some embodiments, the complex comprises an oligonucleotide, such as an antisense oligonucleotide that promotes exon 45 skipping of a pre-mRNA, e.g., in a pre-mRNA encoded by a mutant DMD gene (e.g., a DMD gene having a mutation suitable for exon 45 skipping).
[0119] In some embodiments, a pharmaceutical composition comprising the complex as described herein can be administered by a suitable route, which can include intravenous administration, e.g., as a bolus or by continuous infusion over a period of time. In some embodiments, intravenous administration can be by intramuscular, intraperitoneal, intrathecal, subcutaneous, intra-articular, intrasynovial, or intrathecal routes. In some embodiments, the pharmaceutical composition can be in solid form, aqueous form, or liquid form. In some embodiments, the aqueous or liquid form can be atomized or lyophilized. In some embodiments, the atomized or lyophilized form can be reconstituted with an aqueous solution or liquid solution.
[0120] Compositions for intravenous administration can contain a variety of carriers such as vegetable oils, dimethylacetamide, dimethylformamide, ethyl lactate, ethyl carbonate, isopropyl myristate, ethanol, and polyols (glycerol, propylene glycol, liquid polyethylene glycol, etc.). For intravenous injection, water-soluble antibodies can be administered by the infusion method, by which a pharmaceutical preparation containing the complex and a physiologically acceptable excipient is infused. Physiologically acceptable excipients can include, for example, 5% dextrose, 0.9% saline, Ringer’s solution, or other suitable excipients. Intramuscular preparations, such as sterile preparations in a suitable soluble salt form of the complex, can be dissolved in a pharmaceutical excipient such as water for injection, 0.9% saline, or 5% dextrose solution and administered.
[0121] In some embodiments, a pharmaceutical composition comprising a complex containing a muscle targeting agent (e.g., an anti-TfR1 antibody, e.g., anti-TfR1 Fab) covalently linked to an oligonucleotide (e.g., a PMO) is administered by site-specific or local delivery techniques. Some examples of these techniques include implantable depot sources of the complex, local delivery catheters, site-specific carriers, direct injection, or direct application.
[0122] In some embodiments, a pharmaceutical composition comprising a complex containing a muscle targeting agent (e.g., an anti-TfR1 antibody, e.g., anti-TfR1 Fab) covalently linked to an oligonucleotide (e.g., a PMO) is administered at an effective concentration that confers a therapeutic effect on the subject. As is well recognized by those skilled in the art, the effective amount varies depending on the severity of the disease, the unique characteristics of the subject being treated (e.g., age, physical condition, health, or weight), the duration of the treatment, the nature of any concurrent treatment, the route of administration, and related factors. These related factors are known to those skilled in the art and can be addressed by routine experimentation alone. In some embodiments, the effective concentration is the maximum dose considered safe for the patient. In some embodiments, the effective concentration will be the lowest possible concentration that provides maximum efficacy.
[0123] Empirical considerations (e.g., the half-life of the complex in the subject) will generally help to determine the concentration of the pharmaceutical composition to be used for treatment. The frequency of administration can be determined and adjusted empirically to maximize the efficacy of the treatment.
[0124] Any suitable method can be used to evaluate the efficacy of the treatment. In some embodiments, the efficacy of the treatment can be evaluated as follows: by an assessment of the observations of symptoms associated with dystrophinopathy (e.g., muscle atrophy or muscle weakness), by a measurement of the self-reported outcomes of the subject (e.g., mobility, self-care, daily activities, pain / discomfort, and anxiety / depression), or by a quality-of-life metric (e.g., lifespan).
[0125] In some embodiments, a pharmaceutical composition comprising a complex comprising a muscle targeting agent (e.g., an anti-TfR1 antibody, e.g., anti-TfR1 Fab) covalently linked to an oligonucleotide (e.g., a PMO) as described herein is administered to a subject at an effective concentration sufficient to modulate target gene activity or expression by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95% relative to a control (e.g., the baseline level of gene expression prior to treatment). Example Example 1. Delivery of a DMD-targeting oligonucleotide to muscle tissue following systemic administration to non-human primates
[0126] This study evaluated the delivery of a conjugate comprising anti-TfR1 Fab (referred to herein as "anti-TfR1 Fab-ASO conjugate" in this example), the anti-TfR1 Fab having the heavy and light chain sequences shown in Table 2, which was covalently linked (by lysine conjugation) to a DMD exon 45 skipping oligonucleotide (referred to herein as "ASO" in this example) through a cleavable linker comprising a valine-citrulline sequence. The ASO was a PMO and comprised the base sequence of SEQ ID NO:21. The anti-TfR1 Fab-ASO conjugate had the following structure: where -p is the phosphorodiamidate linkage of the ASO, and where R 2 comprises anti-TfR1 Fab.
[0127] The distribution of the ASO in muscle tissue was tested in healthy non-human primates. At week 0 and week 4, two doses of 30 mg / kg of the ASO not covalently linked to an antibody ("naked"), or the anti-TfR1 Fab-ASO conjugate at a dose equivalent to 30 mg / kg of ASO, were administered to naïve male cynomolgus monkeys (n = 4 per group) by intravenous infusion. The animals were sacrificed 4 weeks after the second dose (i.e., 8 weeks after the first dose), and tissues were harvested.
[0128] Quantification of tissue ASO accumulation was performed using a sandwich ELISA and a probe complementary to the ASO sequence. A standard curve was generated and the ASO level (in ng / g) was derived from the linear regression of the standard curve. Compared to the administration of naked ASO, after administration of the anti-TfR1 Fab-ASO conjugate, the ASO was distributed to all evaluated tissues at a higher level. Intravenous administration of naked ASO resulted in ASO levels approaching the background levels in the heart and diaphragm ("Dia") at the evaluated time points, and very low levels in the quadriceps ("Quad") and biceps. Administration of the anti-TfR1 Fab-ASO conjugate led to a substantial accumulation of ASO in the measured tissues at the evaluated time points, in the order of heart > diaphragm ("Dia") > quadriceps ("Quad") > biceps( Figure 1 ).
[0129] These results indicate that a complex containing an anti-TfR1 antibody (e.g., Fab) covalently linked to an oligonucleotide (e.g., PMO) achieved enhanced delivery of the oligonucleotide to muscle tissue after systemic administration compared to the administration of ASO not included in the complex (i.e., ASO not covalently linked to an anti-TfR1 antibody). Example 2. Skipping of exon 45 in human skeletal muscle myoblasts
[0130] This study evaluated the skipping of exon 45 in the DMD transcript after treatment with the conjugate described in Example 1 (referred to as "anti-TfR1 Fab-ASO conjugate" in this example), which contains an anti-TfR1 Fab covalently linked to a DMD exon 45 skipping oligonucleotide ("ASO").
[0131] Human skeletal muscle myoblasts (obtained from the Association Institut de Myologie) were modified using CRISPR / Cas to introduce a deletion of exon 46 in the DMD gene, thus reflecting a common mutation suitable for exon 45 skipping in patients with Duchenne muscular dystrophy, generating a mutant myoblast cell line ("Del46"). Wild-type and mutant myoblasts were used to generate myotubes (respectively, "WT myotubes" and "Del46 myotubes").
[0132] WT and Del46 myotubes were treated with an anti-TfR1 Fab-ASO conjugate at an ASO equivalent concentration of 10 μM. After incubation with the conjugate, total RNA was harvested and cDNA synthesis was performed. End-point PCR was performed to evaluate the extent of exon 45 skipping in the cells. The PCR products were quantified using capillary electrophoresis, and the relative amounts of skipped and non-skipped amplicons were used to generate the ratio of the exon 45-skipped amplicon to the total amount of amplicons present:
[0133] The results showed that, compared with wild-type myotubes, the anti-TfR1 Fab-ASO conjugate induced greater exon 45 skipping in myotubes containing a DMD mutation suitable for exon 45 skipping( Figure 2 ). After treatment with the anti-TfR1 Fab-ASO conjugate, exon 45 skipping measured in wild-type myotubes was approximately 18%, compared with approximately 70% exon 45 skipping measured in Del46 myotubes. This indicates that the anti-TfR1 Fab-ASO conjugate is capable of achieving exon 45 skipping in myotubes, and that such skipping is more pronounced in myotubes containing a DMD mutation suitable for exon 45 skipping. Example 3. Delivery of DMD-targeted oligonucleotides to muscle tissue and resulting exon 45 skipping following systemic administration to a humanized mouse model of Duchenne muscular dystrophy
[0134] This study evaluated the delivery to muscle tissue and subsequent exon 45 skipping following a single intravenous administration of the conjugate described in Example 1 (referred to in that example as the "anti-TfR1 Fab-ASO conjugate") (comprising an anti-TfR1 Fab covalently linked to a DMD exon 45 skipping oligonucleotide ("ASO")).
[0135] hDMD WT / mdx mice (obtained from Academisch Ziekenhuis Leiden) were crossed with mice expressing human TfR1 to generate hTfR1 / hDMD WT / mdx mice. The anti-TfR1 Fab-ASO conjugate was administered intravenously to hTfR1 / hDMD WT / mdx mice at an ASO-equivalent dose of 30 mg / kg. Seven days after a single dose of the conjugate, the concentration of ASO and exon 45 skipping were measured in multiple muscle tissues. Tissue exposure of ASO (measured as ng ASO / g tissue) was measured by hybridization ELISA (Burki et al., Nucleic Acid Ther. 2015 Oct;25(5):275-84, which is incorporated herein by reference). Exon 45 skipping was measured using endpoint PCR as described in Example 2 above.
[0136] The results showed that, after a single dose of the conjugate, ASO accumulated in multiple muscle tissues. Tissue exposure measured in muscle tissues was approximately 2,000 ng / g in quadriceps muscle ("Quad"), approximately 2,400 ng / g in gastrocnemius muscle ("Gastroc"), approximately 14,000 ng / g in heart ("Heart"), and approximately 7,300 ng / g in diaphragm ("Dia")(Figure 3 )。 Additionally, enhanced exon 45 skipping was observed in each muscle tissue tested in mice treated with the conjugate compared to mice treated with vehicle control (“Veh.”). Exon 45 skipping in vehicle-treated mice compared to conjugate-treated mice was approximately 0.4% vs 1.0% in quadriceps muscle ( Figure 4A ); approximately 0.2% vs 0.75% in gastrocnemius muscle ( Figure 4B ); approximately 0.7% vs 1.5% in heart ( Figure 4C ); and approximately 0.2% vs 1.2% in diaphragm ( Figure 4D ).
[0137] These results indicate that conjugates comprising an anti-TfR1 antibody (e.g., Fab) covalently linked to an oligonucleotide (e.g., PMO, such as an exon skipping PMO) achieve delivery of the oligonucleotide to muscle tissue following systemic administration, and such conjugates comprising an exon skipping oligonucleotide (e.g., exon 45 skipping PMO oligonucleotide) induce exon skipping in muscle tissue following systemic delivery. Equivalent schemes and terms
[0138] The disclosure illustratively described herein can be practiced appropriately without any one or more elements, one or more limitations not specifically disclosed herein. Thus, for example, in each instance herein, any one of the terms “comprising / including,” “consisting essentially of,” and “consisting of” can be replaced with any one of the other two terms. The terms and expressions employed are used as terms of description and not of limitation, and use of such terms and expressions is not intended to exclude any equivalent forms of the features shown and described or portions thereof, but it should be recognized that various modifications are possible within the scope of the disclosed subject matter. Accordingly, it is understood that although the present disclosure has been specifically disclosed by some preferred embodiments, optional features, those skilled in the art can make modifications and variations of the concepts disclosed herein, and such modifications and variations are considered to be within the scope of the present disclosure.
[0139] In addition, in instances where the present disclosure is described in terms of a Markush group or other alternative group, those skilled in the art will recognize that the present disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group or other group.
[0140] It should be understood that in some embodiments, when describing the structure of an oligonucleotide or other nucleic acid, reference may be made to the sequences shown in the sequence listing. In some such embodiments, the actual oligonucleotide or other nucleic acid may have one or more alternative nucleotides (e.g., the RNA counterpart of a DNA nucleotide or the DNA counterpart of an RNA nucleotide) and / or (e.g., and) one or more modified nucleotides and / or (e.g., and) one or more modified internucleoside linkages and / or (e.g., and) one or more other modifications, while retaining complementary properties that are substantially the same or similar to the specified sequence.
[0141] Unless otherwise specified herein or clearly contradicted by the context, a noun used without an article in the context of describing the present invention (especially in the context of the appended claims) will be construed to mean one or more. Unless otherwise indicated, the terms "comprising," "having," "including," and "containing" will be construed as open-ended terms (i.e., meaning "including but not limited to"). Unless otherwise specified herein, a recitation of a range of values herein is merely intended to be a shorthand method of referring separately to each individual value falling within the range, and each individual value is incorporated into the specification as if it were recited herein individually. Unless otherwise specified herein or clearly contradicted by the context in other respects, all methods described herein may be performed in any suitable order. Unless otherwise stated, the use of any and all examples or exemplary language (e.g., "such as") provided herein is merely intended to better illustrate the invention and does not pose a limitation on the scope of the invention. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the invention.
[0142] Some embodiments of the invention are described herein. After reading the foregoing description, variations of those embodiments may become apparent to those of ordinary skill in the art.
[0143] The inventors expect those skilled in the art to employ such variations as appropriate, and the inventors intend the invention to be practiced otherwise than as specifically described herein. Accordingly, as permitted by applicable law, the invention includes all modifications and equivalents of the subject matter recited in the appended claims. In addition, unless otherwise specified herein or clearly contradicted by the context in other respects, the invention covers any combination of the above elements in all possible variations thereof. Those skilled in the art will recognize or be able to ascertain using no more than routine experimentation many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the appended claims.
Claims
1. Inclusion (I): [R 1 n1 -R 2 The complex of the structure, wherein each R 1 Contains the group of formula (Ia): wherein R 3 a phosphorodiamidate morpholino oligomer (PMO) comprising a base sequence containing CAATGCCATCCTGGAGTTCCTG (SEQ ID NO:21); wherein R 2 comprises an anti-transferrin receptor 1 (anti-TfR1) antibody, said antibody comprising a heavy chain complementarity determining region 1 (CDR-H1), a heavy chain complementarity determining region 2 (CDR-H2), a heavy chain complementarity determining region 3 (CDR-H3), a light chain complementarity determining region 1 (CDR-L1), a light chain complementarity determining region 2 (CDR-L2), and a light chain complementarity determining region (CDR-L3) selected from Table 2 where R 1 is covalently linked to R at the junction point A 2 ; and where n1 is an integer of 1 or greater, which represents the number of instances of R in the complex 1 , where each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
2. Inclusive formula (I): [R 1 n1 -R 2 Structure of the complex, where each R 1 Contains the group of formula (Ib): wherein -p is the phosphorodiamidate linkage of a phosphorodiamidate morpholino oligomer (PMO), and wherein the PMO comprises the base sequence of CAATGCCATCCTGGAGTTCCTG (SEQ ID NO:21); wherein R 2 comprises an anti-TfR1 antibody, said antibody comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 selected from Table 2; wherein R 1 is covalently linked to R at the junction point A 2 ; and wherein n1 is an integer of 1 or greater, which represents the number of instances of R 1 , and each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
3. Inclusive formula (I): [R 1 n1 -R 2 structure complex, where each R 1 contains the inclusive formula (Ic) group: wherein R 2 comprises an anti-TfR1 antibody, said antibody comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 selected from Table 2; where R 1 is covalently linked to R at the junction point A 2 ; and where n1 is an integer of 1 or greater, which represents the number of instances of R 1 , where each instance of R 1 is covalently linked to a different amino acid residue of the anti-TfR1 antibody.
4. A complex comprising the structure of formula (Id): wherein -p is the phosphorodiamidate linkage of a phosphorodiamidate morpholino oligomer (PMO), and wherein the PMO comprises the base sequence of CAATGCCATCCTGGAGTTCCTG (SEQ ID NO:21); wherein R 2 comprises an anti-TfR1 antibody, said antibody comprising CDR-H1, CDR-H2, CDR-H3, CDR-L1, CDR-L2 and CDR-L3 selected from Table 2, wherein each instance of the group enclosed in square brackets in formula (Id) is covalently linked to a different amino acid residue of the anti-TfR1 antibody; and wherein n1 is an integer of 1 or greater, which represents the number of instances of the group enclosed in square brackets in formula (Id).
5. The complex according to any one of claims 1 to 4, wherein the anti-TfR1 antibody is a Fab fragment, a full-length IgG, a Fab' fragment, or an F(ab')2 fragment.
6. The composition according to any one of claims 1 to 5, wherein the anti-TfR1 antibody is a Fab fragment.
7. The complex according to any one of claims 1 to 6, wherein the anti-TfR1 antibody comprises a VH containing the amino acid sequence of SEQ ID NO:17 and a VL containing the amino acid sequence of SEQ ID NO:
18.
8. The complex according to any one of claims 1 to 7, wherein the anti-TfR1 antibody comprises a heavy chain containing the amino acid sequence of SEQ ID NO:19 and a light chain containing the amino acid sequence of SEQ ID NO:
20.
9. The complex according to any one of claims 1 to 8, wherein each instance of R 1 is covalently linked to a different lysine residue of the anti-TfR1 antibody.
10. The complex according to any one of claims 1 to 9, wherein the different amino acid residues comprise K188 and K190 of the light chain constant region based on Kabat numbering.
11. The complex according to any one of claims 1 to 10, wherein the different amino acid residues are represented by lysine (K) residues in the sequence motif DYEKHKVYA (SEQ ID NO:27) of the light chain constant region of the anti-TfR1 antibody.
12. A composition comprising the complex according to any one of claims 1 to 11, optionally wherein the composition is in the form of an aqueous solution.
13. The composition according to claim 12, wherein the anti-TfR1 antibody in the complex of the composition comprises a light chain constant region, and wherein at least 80% of the light chain constant region of the anti-TfR1 antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage site represented by K188 (based on Kabat numbering) of the light chain constant region of each anti-TfR1 antibody and / or the linkage site represented by K190 (based on Kabat numbering).
14. The composition according to claim 12, wherein the anti-TfR1 antibody in the complex of the composition comprises a light chain constant region, and wherein at least 80% of the light chain constant region of the anti-TfR1 antibody in the complex of the composition is independently covalently linked to the oligonucleotide at the following linkage sites: the linkage sites represented by the lysine (K) residue in the sequence motif DYEKHKVYA (SEQ ID NO: 27) of the light chain constant region of each antibody.
15. A method for promoting the expression or activity of dystrophin in a subject, the method comprising administering to the subject the complex according to any one of claims 1 to 11 or the composition according to any one of claims 12 to 14.
16. The method according to claim 15, wherein the dystrophin is a truncated dystrophin.
17. A method for treating a subject having a DMD allele with a mutation associated with Duchenne muscular dystrophy, the method comprising administering to the subject the complex according to any one of claims 1 to 11 or the composition according to any one of claims 12 to 14.
18. The method according to claim 17, wherein the complex promotes the expression or activity of dystrophin in the subject.
19. The method according to claim 18, wherein the dystrophin is a truncated dystrophin.
20. The method according to any one of claims 17 to 19, wherein the mutant DMD allele comprises a mutation suitable for exon 45 skipping.
21. The method according to any one of claims 17 to 20, wherein the mutant DMD allele comprises a frameshift mutation in exon 45.
Citation Information
Patent Citations
Uncharged morpholino-based polymers having achiral intersubunit linkages
US5034506A
Ankle foot dorsiflexor / supporter
US5257969A
Recombinant antibodies for human therapy
US5693780A
Antibodies against human interleukin-13 and uses therefor
WO2005123126A2