Use of IFN-Lambda mRNA to treat viral infections

By transfection using mRNA encoding IFN-λ polypeptides, the problem of unsustainable delivery in existing IFN-λ treatments is solved, and durable antiviral activation in vivo is achieved, reducing the frequency and dose of administration.

CN120285155APending Publication Date: 2025-07-11ETHRIS
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510472800.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2020-11-04
Filing Date
2021-11-04
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

现有IFNλ治疗方法需要频繁施用高剂量的重组蛋白质以维持短暂的抗病毒活性,难以在体内持续有效地递送和激活下游抗病毒靶标。

Method used

The mRNA encoding the IFN-λ polypeptide is used to deliver it to the target tissue by transfection, activate downstream antiviral targets, and achieve a lasting activation effect.

Benefits of technology

Long-lasting antiviral activity was shown in vitro and in vivo, with downstream target activation time up to more than 120 hours, reducing the frequency and dose of administration, especially in the case of the virus entering cells through the ACE2 receptor.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120285155A_ABST
    Figure CN120285155A_ABST
Patent Text Reader

Abstract

The name of the invention is use of IFN-lambda mRNA in the treatment of viral infections. The present invention relates to a pharmaceutical composition comprising an mRNA encoding an IFN-lambda polypeptide for use in the treatment of a virus-induced disease, preferably a virus-induced respiratory disease, such as COVID-19.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application. The filing date of the original application is November 4, 2021, the application number is 202180074507X, and the invention title is "Use of IFN-λ mRNA for the treatment of viral infections".

[0002] The present invention relates to a pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for the treatment of virus-induced diseases, preferably virus-induced respiratory diseases such as influenza or COVID-19.

[0003] Interferons are a group of proteins that are currently divided into three different families: type I interferons, type II interferons, and type III interferons.

[0004] Type I interferons are a family closely related to glycoproteins, consisting of 13 IFN-α subtypes as well as IFN-β, IFN-κ, IFN-ε, and IFN-ω. In humans, the IFN-α gene family consists of 12 different subtypes encoded by 14 genes, including one pseudogene and two genes encoding the same protein (Díaz et al., Genomics 22 (1994), 540-552), namely IFN-α1, IFN-α2, IFN-α8, IFN-α14, IFN-α17, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α10, IFN-α16, IFN-α21 (da Rocha Matos et al., Emerg Microbes Infect. 8, (2019), 1763-1776).

[0005] Regarding IFN-α subtypes, they have been found to reveal a spectrum of antiviral, anti-proliferative, and immunomodulatory responses. Type I interferons play an important role in the innate immune response to respiratory viral infections. The mechanism involves the initial release of interferon-β (which in turn stimulates further release of interferon-β) and interferon-αs in a cascade mediated by the type I interferon receptor.

[0006] There is a type II interferon, namely IFN-γ, which binds to a different receptor than type I interferons and has very different functions from type I IFNs.

[0007] Type III interferons are a recently discovered interferon family. They are also known as interferon lambda (IFNλ). IFNλ are three closely related proteins that were discovered in 2003. Interferon lambda-1 is also known as IL-29, while interferon lambda-2 and λ-3 are also known as IL-28A and IL-28B, respectively. These interferons bind to a third receptor distinct from the receptors for type I and type II interferons. These interferons have been shown to have antiviral activity. Interferon lambda has been found to play important roles in a variety of viral infections, including HCV, HBV, influenza virus, rhinovirus, respiratory syncytial virus (RSV), lymphocytic choriomeningitis virus (LCMV), rotavirus, reovirus, norovirus, and West Nile virus (WNV). In vivo experimental approaches using IFNλ receptor knockout mice have emphasized the importance of IFNλ signaling in controlling levels of influenza A virus (IAV), SARS coronavirus, RSV, and human metapneumovirus in the lungs, as well as norovirus, reovirus, and rotavirus in the gastrointestinal tract. In vivo studies have shown that compared to IFNα / β, IFNλ shows a reduced ISG response, while it is much less inflammatory in vivo than IFNα / β. Interestingly, although having a lower inflammatory response compared to type I IFN, IFNλ still retains many antiviral properties. This has stimulated the development of IFNλ as an alternative therapy to IFNα for the clinical treatment of HCV infection (Muir et al., J. Hepatol. 61 (2014), 1238-1246). Recent developments have also shown that IFNλ therapy can also be used to control respiratory viral infections. IFNλ2 and 3 have been shown to control the pulmonary titers of IAV similarly to IFNα or IFNβ treatment (Davidson et al., EMBO Mol. Med. 8 (2016), 1099-1112; Kim et al., Am. J. Respir. Cell Mol. Biol. 56 (2017), 202-212). Importantly, IFNλ therapy avoids the excessive pulmonary inflammation associated with IFNα therapy (Kim et al., Am. J. Respir. Cell Mol. Biol. 56 (2017), 202-212). To date, the therapeutic applications of IFNλ have focused on the administration of recombinantly produced proteins. However, because proteins are cleared from the system relatively rapidly, the use of recombinantly produced proteins requires repeated administration of relatively high doses of protein and thus can only act for a short period of time. For example, in Dinnon III et al. (Nature https: / / doi.org / 10.1038 / s41586-020-2708-8 (2020)), 2 μg of peg-IFNλ1 was administered subcutaneously to mice.Similarly, Davidson et al. (EMBO Mol. Med. 8 (2016), 1099-1112) described the administration of 2.6 μg / 50 μl of IFNλ3 to B6.A2G-Mx mice for the treatment or prevention of influenza infection. In Galani et al. (Immunity 46 (2017), 875-890), it was reported that mice were treated with 5 or 10 μg of recombinant murine pegylated IFNλ.

[0008] Accordingly, there is a need to provide means and methods for delivering IFNλ in vivo to a target tissue in an effective manner, i.e., in a manner that ensures its activity over an extended period of time and allows it to exert its effect over an extended period of time. This would allow for a reduction in the amount of IFNλ administered to a patient over a given period of time and also allow for a reduction in the number of administrations to the patient.

[0009] The present invention addresses this need by providing the embodiments described in the claims.

[0010] Accordingly, the present invention relates to a pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for the treatment and / or prevention of virus-induced diseases.

[0011] The present invention is based on the discovery that mRNA encoding IFN-λ, when transfected into cells used as a model of alveolar epithelial cells, can generate an extremely effective and long-lasting activation of downstream targets important for the antiviral activity of IFN-λ. Specifically, in an in vitro model using A-549 cells (a model of type II-like lung cells / alveolar epithelial cells), even at very low mRNA doses, the downstream targets IFIT3, ISG15, IFIT1, and OAS3, which indicate the antiviral activity of IFN-λ, are activated to high levels and for an extended period of time (more than 120 hours). These results can be confirmed in in vivo experiments in mice.

[0012] Furthermore, surprisingly, in A-549 cells that had been stably transfected previously to express the ACE2 receptor, when mRNA encoding an IFN-λ polypeptide was used, the induction of downstream targets was as high as in A-549 cells that do not express the ACE2 receptor, while in the case of administration of recombinant IFN-λ protein, the induction of downstream targets was much lower in A-549 cells expressing ACE2 compared to A-549 cells that do not express the ACE2 receptor. This indicates that in cells expressing the ACE2 receptor, administration of recombinant IFNλ polypeptide does not result in effective activation of downstream targets, while administration of mRNA encoding IFNλ allows for effective activation. Thus, in the case of a viral infection targeting cells expressing ACE2, i.e., where the virus enters the cell via the ACE2 receptor, the use of mRNA encoding IFNλ is particularly advantageous.

[0013] Furthermore, it can be shown in air - liquid interface (ALI) cultures of different cell types that, although the corresponding receptors are expected to be located on the basolateral side of the cells (facing the liquid medium), surprisingly, mRNA encoding IFNλ is able to show an effect on activating downstream targets when applied to the apical side of the cells (facing the air). These results can be confirmed by in - vivo experiments in mice, in which mRNA encoding IFNλ is directly applied to the lungs. It is well - known that the airway epithelium forms a mechanical barrier separating the external environment from the internal environment, and the structural polarity of the epithelium is crucial for the integrity of the barrier and is controlled by a complex cell - cell adhesion complex containing zonula adherens and zonula occludens (for example, see Humlicek et al., J. Immunol. 178 (2007), 6395 - 6403). In addition, it is well - known that the functions of certain cytokines are polarized because the corresponding receptors are apparently only present on the basolateral side of the cells, so they only act when located basolaterally with respect to the airway epithelium. Thus, if the barrier function of epithelial cells has been physically or pharmacologically disrupted previously, the response of the airway epithelium to certain cytokines can only be observed after application to the airway lumen (Humlicek et al., ibid.). Therefore, it is surprising that applying IFNλ mRNA to the apical side of epithelial cells cultured in ALI cultures, or directly applying it to the lungs of mice without disrupting the barrier function of epithelial cells, leads to effective activation of downstream targets of IFNλ (which indicates an antiviral effect).

[0014] In principle, in the context of the present invention, mRNA encoding an IFNλ polypeptide can be used for treating and / or preventing any possible virus - induced disease. It has been shown that IFNλ exhibits antiviral activity against many viruses in vitro. In vivo, antiviral activity of IFNλ has been observed specifically against viruses infecting epithelial cells of the respiratory, gastrointestinal, and urogenital tracts, as well as the liver (see, for example, Lazear et al., Immunity 43 (2015), 15 - 28; Table 1). Virus - induced diseases that can be treated or prevented according to the present invention include diseases caused by viruses belonging to the families Pneumoviridae, Orthomyxoviridae, Adenoviridae, Arenaviridae, Paramyxoviridae, Flaviviridae, Retroviridae, Caliciviridae, Picornaviridae, Coronaviridae, Parvoviridae, Reoviridae, Herpesviridae, or Hepadnaviridae.

[0015] Viruses belonging to the family Pneumoviridae include human metapneumovirus.

[0016] Viruses belonging to the family Orthomyxoviridae include influenza viruses.

[0017] Viruses belonging to the family Adenoviridae include adenoviruses.

[0018] Viruses belonging to the family Arenaviridae include lymphocytic choriomeningitis virus.

[0019] Viruses belonging to the family Paramyxoviridae include respiratory syncytial virus.

[0020] Viruses belonging to the family Flaviviridae include dengue virus, hepatitis C virus, Zika virus, and West Nile virus.

[0021] Viruses belonging to the family Retroviridae include human immunodeficiency virus.

[0022] Viruses belonging to the family Caliciviridae include Norwalk virus.

[0023] Viruses belonging to the family Picornaviridae include rhinovirus.

[0024] Viruses belonging to the family Coronaviridae include SARS-CoV, SARS-CoV2, MERS, and HCoV-NL63, -OC43, -229E, and HKU1.

[0025] Viruses belonging to the family Parvoviridae include bocavirus.

[0026] Viruses belonging to the family Reoviridae include reovirus and rotavirus.

[0027] Viruses belonging to the family Herpesviridae include cytomegalovirus and herpes simplex virus, such as herpes simplex virus 1 and 2.

[0028] Viruses belonging to the family Hepadnaviridae include hepatitis B virus.

[0029] In a preferred embodiment, the virus-induced disease is a virus-induced respiratory disease. In this context, preferably, the virus that induces a respiratory disease is selected from rhinovirus, influenza virus, parainfluenza virus, metapneumovirus, respiratory syncytial virus, adenovirus, and coronavirus.

[0030] In a specifically preferred embodiment, the virus is a virus that enters cells via the ACE2 receptor. ACE2 (angiotensin-converting enzyme 2) is an enzyme attached to the cell membranes of cells in the lungs, arteries, heart, kidneys, and intestines. It lowers blood pressure by catalyzing the hydrolysis of angiotensin II to angiotensin. ACE2 also serves as an entry point for some coronaviruses to enter cells, including SARS-CoV, SARS-CoV-2, and HCoV-NL63.

[0031] Thus, in a specifically preferred embodiment, the virus is a coronavirus, and most preferably a virus selected from SARS-CoV, SARS-CoV-2, and HCoV-NL63.

[0032] Thus, in a specifically preferred embodiment, the virus-induced diseases are SARS (caused by SARS-CoV), COVID-19 (caused by SARS-CoV-2), and mild to moderate upper respiratory tract infections, severe lower respiratory tract infections, croup and bronchiolitis (caused by HCoV-NL63).

[0033] The IFNλ protein encoded by the mRNA contained in the pharmaceutical composition can be any possible IFNλ protein, specifically interferon λ-1 (also known as IL-29), interferon λ-2 (also known as IL-28A), or interferon λ-3 (IL-28B), or any combination thereof. In a preferred embodiment, the IFNλ protein is a human protein.

[0034] In one embodiment, the IFNλ-1 protein encoded by the mRNA contained in the pharmaceutical composition is IFNλ-1, preferably IFNλ-1 comprising the amino acid sequence shown in SEQ ID NO:2. In a more preferred embodiment, the mRNA encoding IFNλ-1 comprises the coding region shown in SEQ ID NO:1.

[0035] In one embodiment, the IFNλ protein encoded by the mRNA contained in the pharmaceutical composition is IFNλ-2, preferably IFNλ-2 comprising the amino acid sequence shown in SEQ ID NO:4. In a more preferred embodiment, the mRNA encoding IFNλ-2 comprises the coding region shown in SEQ ID NO:3.

[0036] In one embodiment, the IFNλ protein encoded by the mRNA contained in the pharmaceutical composition is IFNλ-3, preferably IFNλ-3 comprising the amino acid sequence shown in SEQ ID NO:6. In a more preferred embodiment, the mRNA encoding IFNλ-3 comprises the coding region shown in SEQ ID NO:5.

[0037] In some embodiments of the present invention, the polynucleotides used according to the present invention may comprise unmodified nucleotides and modified nucleotides. As used herein, the term "unmodified nucleotide" refers to A, C, G, and U nucleotides. As used herein, the term "modified nucleotide" refers to any naturally occurring or non-naturally occurring isomers of A, C, G, and U nucleotides, as well as any naturally occurring or non-naturally occurring analogs, alternatives or modified nucleotides or their isomers having, for example, chemical modifications or substituted residues. Modified nucleotides may have base modifications and / or sugar modifications. Modified nucleotides may also have phosphate group modifications, for example, with respect to the 5' prime cap of an mRNA molecule. Modified nucleotides also include nucleotides synthesized post-transcriptionally by covalent modification of nucleotides. Further, any suitable mixture of unmodified nucleotides and modified nucleotides is possible. Many non-limiting examples of modified nucleotides can be found in the literature (e.g., Cantara et al., Nucleic Acids Res, 2011, 39(Suppl_1):D195-D201; Helm and Alfonzo, Chem Biol, 2014, 21(2):174-185; Carell et al., Angew Chem Int Ed Engl, 2012, 51(29):7110-31) and some preferred modified nucleotides are exemplarily mentioned hereinafter based on their respective nucleoside residues: 1-methyladenosine, 2-methylthio-N6-hydroxy-n-valerylcarbamoyladenosine, 2-methyladenosine, 2'-O-ribosylphosphoadenosine, N6-methyl-N6-threonylcarbamoyladenosine, N6-acetyladenosine, N6-glycylcarbamoyladenosine, N6-isopentenyladenosine, N6-methyladenosine, N6-threonylcarbamoyladenosine, N6,N6-dimethyladenosine, N6-(cis-hydroxyisopentenyl)adenosine, N6-hydroxy-n-valerylcarbamoyladenosine, 1,2'-O-dimethyladenosine, N6,2'-O-dimethyladenosine, 2'-O-methyladenosine, N6,N6,2'-O-trimethyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-methyladenosine, 2-methylthio-N6-isopentenyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, N6-2-methylthio-N6-threonylcarbamoyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 7-methyladenosine, 2-methylthio-adenosine, 2-methoxy-adenosine, 2'-amino-2'-deoxyadenosine, 2'-azido-2'-deoxyadenosine, 2'-fluoro-2'-deoxyadenosine, 2-aminopurine, 2,6-diaminopurine, 7-deaza-adenosine, 7-deaza-8-aza-adenosine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine; 2-thiocytidine, 3-methylcytidine, N4-acetylcytidine, 5-formylcytidine, N4-methylcytidine, 5-methylcytidine, 5-hydroxymethylcytidine, 5-hydroxycytidine, lysidine, N4-acetyl-2'-O-methylcytidine, 5-formyl-2'-O-methylcytidine, 5,2'-O-dimethylcytidine, 2-O-methylcytidine, N4,2'-O-dimethylcytidine, N4,N4,2'-O-trimethylcytidine, isocytidine, pseudocytidine, pseudoisocytidine, 2-thio-cytidine, 2'-methyl-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-bromocytidine, 2'-azido-2'-deoxycytidine, 2'-amino-2'-deoxycytidine, 2'-fluoro-2'-deoxycytidine, 5-azacytidine, 3-methyl-cytidine, 1-methyl-pseudoisocytidine, pyrrolocytidine, pyrrolopseudoisocytidine, 2-thio-5-methylcytidine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, 2-methoxy-cytidine, 2-methoxy-5-methyl-cytidine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, zebularine, 5-azazebularine, 5-methylzebularine, 5-aza-2-thiozebularine, 2-thiozebularine; 1-methylguanosine, N2,7-dimethylguanosine, N2-methylguanosine, 2'-O-ribophosphoguanosine, 7-methylguanosine, hydroxywybutosine, 7-aminomethyl-7-deazaguanosine, 7-cyano-7-deazaguanosine, N2,N2-dimethylguanosine, N2,7,2'-O-trimethylguanosine, N2,2'-O-dimethylguanosine, 1,2'-O-dimethylguanosine, 2'-O-methylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2J-trimethylguanosine, isoguanosine, 4-demethylwyosine, epoxywyosine, under-modified hydroxywybutosine, methylated under-modified hydroxywybutosine, isowyosine, peroxwybutosine, galactosyl-wyosine, mannosyl-wyosine, wyosine, queuosine, methylwyosine, wyosine, 7-aminocarboxypropyl-demethylwyosine, 7-aminocarboxypropylwyosine, 7-aminocarboxypropylwyosine methyl ester, 7-deaza-guanosine, 7-deaza-8-aza-guanosine, 6-thio-guanosine, 6-thio-7-deaza-guanosine, 6-thio-7-deaza-8-aza-guanosine, 7-methyl-guanosine, 6-thio-7-methyl-guanosine, 7-methylinosine, 6-methoxy-guanosine, 1-methylguanosine, 8-oxo-guanosine, 7-methyl-8-oxo-guanosine, 1-methyl-6-thio-guanosine, N2-methyl-6-thio-guanosine, N2,N2-dimethyl-6-thio-guanosine, N1-methylguanosine, 2'-amino-3'-deoxyguanosine, 2'-azido-2'-deoxyguanosine, 2'-fluoro-2'-deoxyguanosine, 2-thiouridine, 3-(3-amino-3-carboxypropyl)uridine, 3-methyluridine, 4-thiouridine, 5-methyl-2-thiouridine, 5-methylaminomethyluridine, 5-carboxymethyluridine, 5-carboxymethylaminomethyluridine, 5-hydroxyuridine, 5-methyluridine, 5-taurinomethyluridine, 5-carbamoylmethyluridine, 5-(carboxymethoxy)uridine methyl ester, dihydrouridine, 5-methyldihydrouridine, 5-methylaminomethyl-2-thiouridine, 5-(carboxymethoxy)uridine, 5-(carboxymethoxy)-2'-O-methyluridine methyl ester, 5-(isopentenylaminomethyl)uridine, 5-(isopentenylaminomethyl)-2-thiouridine, 3,2'-O-dimethyluridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-carbamoyloxymethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carbamoylmethyl-2-thiouridine, 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-(isopentenylaminomethyl)-2'-O-methyluridine, 5,2'-O-dimethyluridine, 2'-O-methyluridine, 2'-O-methyl-2-thiouridine, 2-thio-2'-O-methyluridine, uridine 5-oxyacetic acid, 5-methoxycarbonylmethyluridine, methyl uridine 5-oxyacetate, 5-methoxyuridine, 5-aminomethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-thiouridine, 5-methylaminomethyl-2-selenouridine, 5-methoxycarbonylmethyl-2-thiouridine, 5-taurylmethyl-2-thiouridine, pseudouridine, 1-methyl-3-(3-amino-3-carboxypropyl)pseudouridine, 1-methylpseudouridine, 3-methylpseudouridine, 2'-O-methylpseudouridine, 5-formyluridine, 5-aminomethyl-2-geranyluridine, 5-taurylmethyluridine, 5-iodouridine, 5-bromouridine, 2'-methyl-2'-deoxyuridine, 2'-amino-2'-deoxyuridine, 2'-azido-2'-deoxyuridine, 2'-fluoro-2'-deoxyuridine, inosine, 1-methylinosine, 1,2'-O-dimethylinosine, 2'-O-methylinosine, 5-aza-uridine, 2-thio-5-aza-uridine, 4-thio-pseudouridine, 2-thio-pseudouridine, 5-carboxymethyl-uridine, 1-carboxymethyl-pseudouridine, 5-propynyl-uridine, 1-propynyl-pseudouridine, 1-taurylmethyl-pseudouridine, 5-taurylmethyl-2-thio-uridine, 1-taurylmethyl-4-thio-uridine, 5-methyl-uridine, 1-methyl-pseudouridine, 4-thio-1-methyl-pseudouridine, 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-dihydropseudouridine, 2-methoxyuridine, 2-methoxy-4-thio-uridine, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, 1,2'-O-dimethyladenosine, 1,2'-O-dimethylguanosine, 1,2'-O-dimethylinosine, 2,8-dimethyladenosine, 2-methylthiomethylthio-N6-isopentenyl-adenosine, 2-geranylsulphur uridine, 2-lyscytidine, 2-methylthio-cyclic N6-threonylcarbamoyladenosine, 2-methylthio-N6-(cis-hydroxyisopentenyl)adenosine, 2-methylthio-N6-hydroxy-norvalylcarbamoyladenosine, 2-methylthio-N6-threonylcarbamoyladenosine, 2-selenouridine, 2-thio-2'-O-methyluridine, 2'-O-methyladenosine, 2'-O-methylcytidine, 2'-O-methylguanosine, 2'-O-methylinosine, 2'-O-methylpseudouridine, 2'-O-methyluridine, methyl 2'-O-methyluridine 5-oxyacetate, 2'-O-ribosyladenosine phosphate, 2'-O-ribosylguanosine phosphate, 3,2'-O-dimethyluridine, 3-(3-amino-3-carboxypropyl)-5,6-dihydrouridine, 3-(3-amino-3-carboxypropyl)pseudouridine, 5,2'-O-dimethylcytidine, 5,2'-O-dimethyluridine, methyl 5-(carboxyhydroxymethyl)-2'-O-methyluridine, 5-(isopentenylaminomethyl)-2'-O-methyluridine, 5-aminomethyl-2-geranylthiouridine, 5-aminomethyl-2-selenouridine, 5-aminomethyluridine, 5-carbamoylmethyl-2'-O-methyluridine, 5-carboxyhydroxymethyluridine, 5-carboxymethyl-2-thiouridine, 5-carboxymethylaminomethyl-2-geranylthiouridine, 5-carboxymethylaminomethyl-2-selenouridine, 5-carboxymethylaminomethyl-2'-O-methyluridine, 5-cyanomethyluridine, 5-formyl-2'-O-methylcytidine, methyl 5-methoxycarbonylmethyl-2'-O-methyluridine, 5-methylaminomethyl-2-geranylthiouridine, 7-aminocarboxypropyl-demethylwyeoside, 7-methylguanosine, 8-methyladenosine, N2,2'-O-dimethylguanosine, N2,7,2'-O-trimethylguanosine, N2,7-dimethylguanosine, N2,N2,2'-O-trimethylguanosine, N2,N2,7-trimethylguanosine, N2,N2,7-trimethylguanosine, N4,2'-O-dimethylcytidine, N4,N4,2'-O-trimethylcytidine, N4,N4-dimethylcytidine, N4-acetyl-2'-O-methylcytidine, N6,2'-O-dimethyladenosine, N6,N6,2'-O-trimethyladenosine, N6-formyladenosine, N6-hydroxymethyladenosine, agmatidine, 2-methylthio-cyclic N6-threonylcarbamoyladenosine, glutamyl-wyeoside, guanosine added to any nucleotide, guanosylated 5'-end, hydroxy-N6-threonylcarbamoyladenosine; most preferably, pseudouridine, N1-methyl-pseudouridine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-methylcytidine, 2-thiouridine, 5-iodouridine and / or 5-methyl-uridine.,

[0038] In addition, the term "modified nucleotide" includes nucleotides containing isotopes such as deuterium. The term "isotope" refers to elements having the same number of protons but different numbers of neutrons resulting in different mass numbers. Thus, for example, isotopes of hydrogen are not limited to deuterium but also include tritium. In addition, the polyribonucleotide may also contain isotopes of other elements, and other elements include, for example, carbon, oxygen, nitrogen, and phosphorus. It is also possible that the modified nucleotide is deuterated or contains another isotope of hydrogen or another isotope of oxygen, carbon, nitrogen, or phosphorus.,

[0039] The total number of modified nucleotide types in the polynucleotide can be 0, 1, 2, 3, or 4. Thus, in some embodiments, at least one nucleotide of one nucleotide type (e.g., at least one U nucleotide) can be a modified nucleotide. In some embodiments, at least one nucleotide of a total of two nucleotide types (e.g., at least one U nucleotide and at least one C nucleotide) can be a modified nucleotide. In some embodiments, at least one nucleotide of a total of three nucleotide types (e.g., at least one G nucleotide, at least one U nucleotide, and at least one C nucleotide) can be a modified nucleotide. In some embodiments, at least one nucleotide of all four nucleotide types can be a modified nucleotide. In all of these embodiments, one or more nucleotides of each nucleotide type can be modified, and the percentage of the modified nucleotides of each nucleotide type is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%.

[0040] In some embodiments, the total percentage of modified nucleotides contained in the mRNA molecule to be purified is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 100%.

[0041] In preferred embodiments, the mRNA is an mRNA containing a combination of modified and unmodified nucleotides. Preferably, it is an mRNA containing the combination of modified and unmodified nucleotides described in WO2011 / 012316. It has been reported that the mRNA described therein exhibits increased stability and reduced immunogenicity. In preferred embodiments, in such a modified mRNA, 5 - 50% of the cytidine nucleotides and 5 - 50% of the uridine nucleotides are modified. The nucleotides containing adenosine and guanosine can be unmodified. The adenosine and guanosine nucleotides can be unmodified or partially modified, and they preferably exist in an unmodified form. Preferably, 10 - 35% of the cytidine and uridine nucleotides are modified, and specifically preferably, the content of the modified cytidine nucleotides is in the range of 7.5 - 25%, and the content of the modified uridine nucleotides is in the range of 7.5 - 25%. It has been found that, in fact, a relatively low content of modified cytidine and uridine nucleotides, such as only 10% each, can achieve the desired performance. Specifically preferably, the modified cytidine nucleotide is a 5 - methylcytidine residue, and the modified uridine nucleotide is a 2 - thiouridine residue. Most preferably, the content of the modified cytidine nucleotides and the content of the modified uridine nucleotides are each 25%.

[0042] In certain embodiments of any of the above, the percentage of an analogue of a given nucleotide refers to the input percentage (e.g., the percentage of the analogue in the starting reaction, such as the starting in vitro transcription reaction). In certain embodiments of any of the above, the percentage of an analogue of a given nucleotide refers to the output (e.g., the percentage in the synthesized or transcribed compound). Both options are equally contemplated.

[0043] mRNA can be recombinantly produced in vivo systems by methods known to those skilled in the art.

[0044] Optionally, the modified RNA, preferably the mRNA molecules of the present invention, can be produced in an in vitro system, such as an in vitro transcription system known to those skilled in the art. In vitro transcription systems capable of producing RNA, preferably mRNA, require an input mixture of modified and unmodified ribonucleoside triphosphates to produce modified mRNA molecules.

[0045] Furthermore, the modified RNA, preferably the mRNA molecules, can be chemically synthesized, for example, by conventional chemical synthesis using solid phase supports and standard techniques on an automated nucleotide sequence synthesizer, or by chemically synthesizing the respective DNA sequences and subsequently transcribing in vitro or in vivo.

[0046] The coding region contained in the mRNA and encoding the IFNλ protein can be a partially or fully codon-optimized sequence. Codon optimization refers to the technique of maximizing protein expression by enhancing the translation efficiency of the respective polynucleotide, as in some cases, there are species preferences for the use of given amino acids by codons. Examples of codon-optimized coding regions are the coding regions depicted in SEQ ID NO: 1, 3, and 5.

[0047] Furthermore, the polynucleotide can include further modifications to regulate and / or extend the duration of action. The polynucleotide may also contain an m7GpppG cap, an internal ribosome entry site (IRES), and / or a polyA tail at the 3' end and / or additional sequences for facilitating translation.

[0048] In addition, the polyribonucleotides used according to the invention may further comprise further functional regions and / or 3' or 5' untranslated regions. The 3' and / or 5' untranslated regions may be sequences that are naturally flanking the protein-coding sequence or artificial sequences that contribute to the stability and / or regulation of the polyribonucleotide. Suitable sequences can be identified and studied by routine experimentation. Further, the polyribonucleotide may also have further functional regions and may bind to regulatory elements and target sequences of microRNAs, for example for spatially and temporally controlling the activity of the desired polyribonucleotide, which includes the protein-coding sequence, i.e. for example with respect to a specific cell or cell type and / or developmental stage or specific time period.

[0049] In one embodiment, the mRNA further comprises a 5'- and / or 3'-UTR. In a specifically preferred embodiment, the UTR sequence is the 5'-UTR sequence as described in WO2017 / 167910. Even more preferably, the mRNA comprises a 5'-UTR sequence immediately upstream of the start codon of the coding region, which sequence is shown as: GGGAGACGCCACC (SEQ ID NO:7)

[0050] In a further preferred embodiment, the mRNA further comprises a 3'-UTR, preferably a 3'-UTR having the sequence 5'-TTCG-3'.

[0051] In another preferred embodiment, the mRNA is transcribed from a DNA molecule as described in WO2017 / 167910. More preferably, such a DNA molecule comprises a strand having the following elements:

[0052] (a) a coding region, including the start codon at its 5' end, encoding an IFNλ polypeptide; and

[0053] (b) the sequence GGGAGACGCCACC (SEQ ID NO:7) immediately upstream of the coding sequence, and upstream of this sequence, a promoter recognized by a DNA-dependent RNA polymerase, preferably a promoter having the sequence TAATACGACTCACTATA (SEQ ID NO:8) recognized by T7 DNA-dependent RNA polymerase.

[0054] Thus, in such an embodiment, the sequence upstream of the start codon of the coding region is TAATACGACTCACTATAGGGAGACGCCACC (SEQ ID NO:9).

[0055] In a specifically preferred embodiment, the mRNA is transcribed from a DNA molecule as shown in any one of SEQ ID NOs: 10 to 12. SEQ ID NO: 10 shows the DNA molecule for transcribing an mRNA molecule encoding IFNλ-1. SEQ ID NO: 11 shows the DNA molecule for transcribing an mRNA molecule encoding IFNλ-2. SEQ ID NO: 12 shows the DNA molecule for transcribing an mRNA molecule encoding IFNλ-3.

[0056] The mRNA encoding IFNλ can bind to the mRNA encoding another type of interferon, preferably to a type I interferon or a type II interferon. In a preferred embodiment, the type I interferon is selected from IFN-β, IFN-α1, IFN-α2, IFN-α8, IFN-α14, IFN-α17, IFN-α4, IFN-α5, IFN-α6, IFN-α7, IFN-α10, IFN-α16, and IFN-α21 or any combination thereof. In a specifically preferred embodiment, the type I interferon is IFN-α16 or IFN-β. In another preferred embodiment, the other type of interferon is a type II interferon, particularly IFN-γ. For such an mRNA encoding another interferon, the preferred conjugation embodiments also apply (such as possible modifications, promoter sequences, UTRs, etc.), as described above for the mRNA encoding IFNλ.

[0057] An exemplary RNA sequence encoding IFN-α16 is shown in SEQ ID NO: 16. The encoded protein is shown in SEQ ID NO: 17.

[0058] An exemplary RNA sequence encoding IFN-β is shown in SEQ ID NO: 18. The encoded protein is shown in SEQ ID NO: 19.

[0059] An exemplary RNA sequence encoding IFN-γ is shown in SEQ ID NO: 20. The encoded protein is shown in SEQ ID NO: 21.

[0060] An exemplary DNA sequence that can be transcribed into an mRNA encoding IFN-α16 is shown in SEQ ID NO: 22.

[0061] An exemplary DNA sequence that can be transcribed into an mRNA encoding IFN-β is shown in SEQ ID NO: 23.

[0062] An exemplary DNA sequence that can be transcribed into an mRNA encoding IFN-γ is shown in SEQ ID NO: 24.

[0063] Exemplary mRNA sequences encoding IFN-α16 are shown in SEQ ID NO:25.

[0064] Exemplary mRNA sequences encoding IFN-β are shown in SEQ ID NO:26.

[0065] Exemplary mRNA sequences encoding IFN-γ are shown in SEQ ID NO:27.

[0066] According to the present invention, the mRNA to be administered is in the form of a pharmaceutical composition. As used herein, the term "pharmaceutical composition" refers to a composition for administration to a subject. Exemplary subjects include mammals such as dogs, cats, pigs, cows, sheep, horses, rodents (such as rats, mice, and guinea pigs), or primates (such as gorillas, chimpanzees, and humans). In a most preferred embodiment, the subject is a human.

[0067] Generally, the RNA is included in the pharmaceutical composition in an effective amount. The term "effective amount" refers to an amount sufficient to induce a detectable therapeutic response in a subject to which the pharmaceutical composition is administered.

[0068] The pharmaceutical composition may comprise a pharmaceutically acceptable carrier, i.e., a compound, material, ingredient, and / or composition which, within the scope of sound medical judgment, is suitable for contact with the tissues of humans and animals without excessive toxicity, irritation, allergic response, or other problems or complications commensurate with a reasonable benefit / risk ratio. Thus, a pharmaceutically acceptable carrier is an inert substance formulated with a pharmaceutically active substance to facilitate its handling in view of dosage, absorption, solubility, or pharmacokinetic considerations. Examples of suitable pharmaceutically acceptable carriers are well known in the art and include phosphate buffered saline solutions, buffers, water, emulsions (such as oil / water emulsions), various types of wetting agents, and sterile solutions. In particular, aqueous carriers include water, alcohol / aqueous solutions, emulsions, or suspensions, including saline and buffered media. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils (such as olive oil), and organic esters (such as ethyl oleate). Further examples of pharmaceutically acceptable carriers include, but are not limited to, saline, Ringer's solution, and dextrose solution, citrate, phosphate, and other organic acids; salt-forming counterions such as sodium and potassium; low molecular weight (>10 amino acid residues) polypeptides; proteins such as serum albumin or gelatin; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as histidine, glutamine, lysine, asparagine, arginine, or glycine; carbohydrates including glucose, mannose, or dextrin; monosaccharides; disaccharides; other sugars such as sucrose, mannitol, trehalose, or sorbitol; chelating agents such as EDTA; nonionic surfactants such as polyoxyethylene sorbitan monolaurate commercially available under the trade name Tween, propylene glycol, Pluronics, or polyethylene glycol; antioxidants including methionine, ascorbic acid, and tocopherol; and / or preservatives such as octadecyl dimethyl benzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butanol, or benzyl alcohol; alkyl esters of p-hydroxybenzoic acid such as methyl p-hydroxybenzoate or propyl p-hydroxybenzoate; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol). Suitable pharmaceutically acceptable carriers and their formulations are described in more detail in Remington's Pharmaceutical Sciences, 17th Edition, 1985, Mack Publishing Co. In addition, preservatives, stabilizers, and other additives may also be present, such as, for example, antimicrobial agents, antioxidants, chelating agents, and inert gases, nano-systems, or liposomes, etc.

[0069] The administration of mRNA encoding IFNλ protein for treating and / or preventing virus-induced diseases can be achieved by means and methods known to those skilled in the art, specifically by ensuring that the mRNA reaches the intended target tissue / target cell. Possible routes are, for example, intravenous, intramuscular, intradermal, subcutaneous, and delivery into the respiratory system.

[0070] If the virus-induced disease is a respiratory disease, administration into the respiratory system is preferred. Possibilities for delivery into the respiratory system include instillation and inhalation. Optionally, for delivering the mRNA into the lungs, i.v. administration can also be carried out with a formulation having tropism for the lungs.

[0071] In a preferred embodiment, the pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide is administered to a patient via inhalation.

[0072] The mRNA can be inhaled in any form suitable for inhalation. In a preferred embodiment, the mRNA is present in the pharmaceutical composition in a form suitable for inhalation in the form of an aerosol. A particularly suitable way of administering the mRNA to the respiratory system of a patient is by nebulization.

[0073] In a preferred embodiment, the inhalation is bolus inhalation. This means that during inhalation, for only a very short time, the aerosol containing the active agent is mixed into the inhaled air. If the aerosol containing the active agent is mixed with the air at the beginning of inhalation, then the active agent will reach the deep parts of the lungs with the first part of the inhaled air. If the addition of the active agent is stopped at the end of inhalation, then no active agent is deposited in the central region of the lungs, i.e., the airways, at the end of inhalation. Depending on the requirements of the underlying disease state, by using bolus inhalation, it is possible to better target different regions of the lungs, such as the peripheral or central regions of the lungs, for the deposition of the active agent.

[0074] In the pharmaceutical composition, the mRNA can advantageously be combined with compounds that facilitate the delivery of the mRNA to the target cell or target tissue and / or increase its stability. One possibility in this regard is to form nanoparticles of the RNA with suitable substances, such as those described in PCT / EP2020 / 053774.

[0075] Examples of preferred agents or reagents for delivering and / or introducing the RNA into the target cell or target tissue are liposome transfection reagents (LTRs) in the context of this article.

[0076] One specific mode for delivering and / or introducing mRNA into target cells or target tissues is transfection. Thus, it is contemplated that the mRNA to be used is transfected (into (target) cells or tissues), delivered / administered by transfection, and / or prepared for transfection. The means and methods for transfecting mRNA are well-known in the art and are described, for example, in Tavernier (loc.cit.), Yamamoto (Eur J Pharm Biopharm. 71(3)(2009), 484-9) and Kormann (Nat Biotechnol. 29(2)(2011), 154-7). Specific transfection modes are lipofection, magnetofection, magnetolipofection, or complexation with polymers. Thus, the mRNA to be used can be prepared for lipofection, prepared to be transfected by lipofection, delivered / introduced by lipofection, and / or administered by lipofection.

[0077] Thus, the pharmaceutical composition can (further) comprise at least one lipid or liposomal transfection reagent or enhancer (LTR; liposomal transfection reagent). The mRNA to be used may be included in the LTR, complexed with the LTR, and / or delivered by the LTR. In particular, the mRNA to be used can be included in and / or delivered by the (respective) lipofection complex comprising the mRNA and the LTR. The pharmaceutical composition can (further) comprise a lipofection complex.

[0078] LTRs are known in the art and are distributed, for example, by OzBiosciences, Marseille, France. For example, such LTRs can be lipids or lipid-like substances, preferably cationic lipids or cationic lipid-like substances, such as the lipid-like substances disclosed in PCT / EP2014 / 063756 (e.g., C12-(2-3-2)), such as the lipids disclosed in EP2285772 (e.g., Dogtor) and the lipopolyamines disclosed in EP1003711 (e.g., DreamFect TM and DreamFect Gold TM ). Specific LTRs can be selected from the following:

[0079] (i) C12-(2-3-2);

[0080] (ii) DreamFectTM, preferably DreamFect Gold TM (DF TM / DF-Gold TM ; OzBiosciences, Marseille, France);

[0081] (iii) Dogtor (OzBiosciences, Marseille, France); and

[0082] (iv) Lipofectamine classes, such as Lipofectamine 2000 (Invitrogene, CA, USA).

[0083] In principle, Dogtor is preferred, DreamFect TM is more preferred, and DF-Gold TM and C12-(2-3-2) are even more preferred LTRs.

[0084] For example, LTRs such as Dogtor are described in EP2285772. For example, LTRs such as DF TM or DF-Gold TM are described in EP1003711. In principle, oligomers, polymers or lipids such as those disclosed in PCT / EP2014 / 063756, specific cationic lipids such as those disclosed in EP2285772 and specific lipopolyamines such as those disclosed in EP1003711 are preferred LTRs. LTRs such as C12-(2-3-2) and DF-Gold TM are most preferred.

[0085] Non-limiting examples of lipofection complexes are DF-Gold TM / RNA lipoplex and C12-(2-3-2) / RNA lipoplex.

[0086] C12-(2-3-2) is a particularly preferred LTR having the structure shown in formula (V) (see et al., Angew Chem Int Ed Engl., 2016; 55(33):9591-5):

[0087]

[0088] C12-(2-3-2) is preferably as described, for example, in WO 2016 / 075154 A1, EP 3013964 and Preparation as described by et al. (Angew Chem Int Ed Engl., 2016; 55(33):9591-5). The cationic lipid can be prepared by mixing N1-(2-aminoethyl)-N3-(2-((3,4-dimethoxybenzyl)amino)ethyl)propane-1,3-diamine (8.9 g, 1 equivalent, 28.67 mmol) with 1,2-epoxydodecane (42.27, 8 equivalents, 229.4 mmol), and mixing at 80 °C with continuous shaking for 24 hours, then purifying and removing the 3,4-dimethoxybenzyl protecting group.

[0089] Different isomers of C12-(2-3-2) can be used, such as the racemate, S isomer, and / or R isomer. Preferably, C12-(2-3-2) is used as the pure R isomer and has the structure shown in formula (VI). To obtain the pure R isomer of C12-(2-3-2), it can be prepared by synthesis using the R isomer of 1,2-epoxydodecane as described above for C12-(2-3-2).

[0090]

[0091] Thus, in a preferred embodiment, the pharmaceutical composition comprises mRNA encoding IFNλ and further comprises a lipid having the structure shown in formula (V) (preferably as shown in formula (VI)).

[0092] A further particularly preferred LTR is the cationic lipid having formula (VII), also referred to herein as "dL_P", which can be synthesized by reacting N,N'-bis(2-aminoethyl)-1,3-propanediamine with N-dodecylacrylamide using boric acid as a catalyst. For the reaction, the mixture can be stirred under microwave irradiation at 100 °C.

[0093] Thus, in a further preferred embodiment, the pharmaceutical composition comprises mRNA encoding IFNλ and further comprises a lipid having the structure shown in formula (VII).

[0094]

[0095] In addition, the pharmaceutical composition comprises cationic lipids having formula (V), (VI) and / or (VII), preferably dL_P and / or C12-(2-3-2), more preferably the R isomers of dL_P and / or C12-(2-3-2), which are included in the formulations described below. In particular, the agents and reagents described herein for delivering and / or introducing RNA into target cells or target tissues and the LTRs described herein can be combined with one or more (e.g., two, three or four) further lipids (e.g., cholesterol, DPPC, DOPE and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG2000)). These further lipids can support the desired functions of the agent / reagent and LTR (supporting and / or increasing the delivery and / or introduction of RNA into cells or tissues respectively and enhancing transfection efficiency), and act as respective "helper lipids". Specific examples of such "helper lipids" are cholesterol, DPPC, DOPE and / or PEG-lipids (e.g., DMPE-PEG, DMG-PEG (e.g., DMG-PEG2000)). The further lipids (e.g., "helper lipids") can also be part of the complex / particle(s) disclosed herein. A person skilled in the art can readily prepare the complex / particle according to the invention. Examples of further lipids (e.g., "helper lipids") are also known in the art. A person skilled in the art can readily select a suitable further lipid (e.g., "helper lipid") and the ratio of the agent / reagent / LTR to the further lipid (e.g., "helper lipid"). Such ratios can be molar ratios of agent / reagent / LTR: further lipid(s) of 1-4:1-5, 3-4:4-6, about 4: about 5, about 4: about 5.3 (narrower ranges are preferred). For example, the agent / reagent / LTR can be combined with three further lipids such as DPPC, cholesterol and DMG-PEG2000 at molar ratios of 8:5.3:4.4:0.9, or more particularly 8:5.29:4.41:0.88 respectively.

[0096] Preferably, dL_P and / or C12-(2-3-2), more preferably the R isomers of dL_P and / or C12-(2-3-2), are produced as described above and used together with the helper lipids DPPC and cholesterol and the PEG-lipid DMG-PEG2000 at a molar ratio of 8:5.29:4.41:0.88 to formulate lipid particles.

[0097] A composition prepared by mixing the R-isomer of C12-(2-3-2) (Formula VI) with lipid DPPC, cholesterol, and PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 is also referred to herein as "LF92". A composition prepared by mixing dL_P (Formula VII) with lipid DPPC, cholesterol, and PEG-lipid DMG-PEG2000 in a molar ratio of 8:5.29:4.41:0.88 is also referred to herein as "LF111".

[0098] As also described exemplarily in, for example, WO2016 / 075154A1, EP3013964, and Zhang et al. (TERMIS, 2019, Tissue Engineering: Part A, Vol. 25, Numbers 1 and 2), dL_P and / or C12-(2-3-2) can be used as non-viral vectors to form stable lipoplexes with mRNA based on the electrostatic interaction between the positively charged amino groups of the lipids and the negatively charged phosphate groups of the mRNA molecules (Anderson, Human Gene Therapy 14, 2003, 191-202). To stabilize the lipoplex structure and reduce leakage, dL_P and / or C12-(2-3-2), more preferably the R-isomer of dL_P and / or C12-(2-3-2), can be provided with two helper lipids, namely 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) and cholesterol (Anderson, Drug Delivery 11, 2004, 33-39; Liang, Journal of Colliod and Interface Science 278, 2004, 53-62). Finally, 1,2-dimyristoyl-sn-glycerol, methoxypolyethylene glycol (DMG-PEG) 2kD (DMG-PEG2000) will be added to the lipid mixture to provide PEGylated liposomes. It is well known that PEGylation improves the physicochemical properties of liposomal formulations by enhancing water solubility, preventing enzymatic degradation, and limiting immune and antigenic reactions (Milla, Current Drug Metabolism 13, 2012, 105-119). The final N / P ratio of the entire acetic acid lipid mixture is 8:5.29:4.41:0.88, representing the molar ratio of the amino groups of dL_P and / or C12-(2-3-2) / DPPC / cholesterol / DMG-PEG2000 to one phosphate group of the mRNA molecule, respectively.

[0099] Thus, in a preferred embodiment, the pharmaceutical composition comprises mRNA encoding IFNλ and further comprises dL_P and / or C12-(2-3-2), preferably the R-isomer of dL_P and / or C12-(2-3-2), formulated with DPPC, cholesterol and DMG-PEG2000.

[0100] In addition, in a particularly preferred embodiment, the pharmaceutical composition comprises mRNA encoding IFNλ and further comprises dL_P and / or C12-(2-3-2), preferably the R-isomer of dL_P and / or C12-(2-3-2), formulated with DPPC, cholesterol and DMG-PEG2000, wherein the final N / P ratio of the whole acetic acid lipid mixture is 8:5.29:4.41:0.88, which is the molar ratio of the amino groups of dL_P and / or C12-(2-3-2) / DPPC / cholesterol / DMG-PEG2000 to one phosphate group of the mRNA molecule.

[0101] As described above, the R-isomer of C12-(2-3-2) formulated with DPPC, cholesterol and DMG-PEG2000 is also referred to as the LF92 formulation.

[0102] Thus, in a particularly preferred embodiment of a pharmaceutical composition comprising mRNA encoding IFNλ, the pharmaceutical composition further comprises the LF92 formulation.

[0103] As described above, dL_P formulated with DPPC, cholesterol and DMG-PEG2000 is also referred to as the LF111 formulation.

[0104] Thus, in another preferred embodiment of a pharmaceutical composition comprising mRNA encoding IFNλ, the pharmaceutical composition further comprises the LF111 formulation.

[0105] When the pharmaceutical composition is administered to a human patient via inhalation, a dose inhaled by the patient preferably contains mRNA encoding the IFN-λ polypeptide between 200 μg and 15 mg. As shown in the attached examples, experiments in mice have shown that when administered to the lungs via instillation, induction of IFNλ downstream targets (indicating antiviral activity) can be achieved with very low levels of IFNλ mRNA. When extrapolated to human patients based on the weight of the lungs, an effective amount of IFNλ mRNA is expected to be in the range of 200 μg to 15 mg per dose, preferably between 250 μg and 5 mg per dose, even more preferably between 250 μg and 1 mg per dose, and even more preferably between 250 μg and 750 μg per dose.

[0106] The number of doses administered to the subject depends on the actual purpose. In the case of acute viral infections, the following administrations are preferably carried out:

[0107] - One dose at a time (e.g., in the case of a mild infection); or

[0108] - One dose every two days within a period of 2, 4, 6, 8, 10 or 14 days; or

[0109] - One dose per day within a period of 2, 3, 4, 5, 6, 7, 8, 9 or 10 days; or

[0110] - Two doses per day within a period of 2, 3, 4, 5, 6, 7, 8, 9 or 10 days.

[0111] In the case of preventing viral infection or exacerbation of virus-induced lung diseases (such as asthma or COPD), the following administrations are preferably carried out:

[0112] - One dose per week, preferably for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 weeks, preferably for 1, 2, 3, 4, 5, 6 or 7 months.

[0113] The present invention also relates to mRNA molecules, which comprise a sequence as shown in any one of SEQ ID No: 13 to 15, 25, 26 or 27:

[0114] SEQ ID No: 13 to 15, 25, 26 and 27 respectively contain the codon-optimized coding regions of IFNλ-1, -2 and -3, IFNα16, IFNβ and IFNγ. In addition, each of these mRNAs contains the sequence GGGAGACGCCACC (SEQ ID NO: 7) immediately upstream of the start codon and the sequence 5'-TTCG-3' as the 3'-UTR.

[0115] Preferably, such an mRNA further comprises a polyA tail, for example, about 200 nucleotides.

[0116] The present invention also relates to DNA molecules comprising a sequence as shown in any one of SEQ ID NO: 10 to 12 or 22 to 24. SEQ ID NO: 10 shows a DNA molecule for transcribing an mRNA molecule encoding IFNλ-1. SEQ ID NO: 11 shows a DNA molecule for transcribing an mRNA molecule encoding IFNλ-2. SEQ ID NO: 12 shows a DNA molecule for transcribing an mRNA molecule encoding IFNλ-3. SEQ ID NO: 22 shows a DNA molecule for transcribing an mRNA molecule encoding IFNα16. SEQ ID NO: 23 shows a DNA molecule for transcribing an mRNA molecule encoding IFNβ. SEQ ID NO: 24 shows a DNA molecule for transcribing an mRNA molecule encoding IFNγ.

[0117] Figure 1 Show the IFNλ1 concentration in the cell supernatants treated with rec.hIL-29. Collect the supernatants of A-549 cells treated with the doses of rec.hIL-29 shown on the x-axis and store them at -80 °C. On the day of analysis, perform hIL-29 ELISA according to the kit protocol. Incubate TMB for 15 minutes. Analyze the ΔO.D at 650 and 450 nm using GraphPad Prism V.8.

[0118] Figure 2 Show the IFNλ1 concentration in the cell supernatants transfected with IFNλ mRNA. Collect the supernatants of A-549 cells transfected with the mRNA encoding hIL-29 at the doses shown on the x-axis and store them at -80 °C. On the day of analysis, perform hIL-29 ELISA according to the kit protocol. Incubate TMB for 15 minutes. Analyze the ΔO.D at 450 and 650 nm using GraphPad Prism V.8.

[0119] Figure 3 Show target activation after treatment or transfection with high doses. Transfect A549 cells with 15 ng / well of IFN-λ mRNA and stimulate with 2.9 ng / well of human rec.hIL-29. As a control, transfect A549 with 15 ng / well of the mRNA encoding BMP2-Stop. At different time points (6, 10, 24, 48, 72, and 120 hours), collect and lyse the cells for real-time PCR analysis.

[0120] Figure 4 Show target induction after treatment or transfection with medium doses. Transfect A549 cells with 4 ng / well of IFN-λ mRNA and stimulate with 0.6 ng / well of human rec.hIL-29. As a control, transfect A549 with 4 ng / well of the mRNA encoding BMP2-Stop. At different time points (6, 10, 24, 48, 72, and 120 hours), collect and lyse the cells for real-time PCR analysis.

[0121] Figure 5 Show target activation after transfection or treatment with low doses. Transfect A549 cells with 2 ng / well of IFN-λ mRNA and stimulate with 0.3 ng / well of human rec.hIL-29. As a control, transfect A549 with 2 ng / well of the mRNA encoding BMP2-Stop. At different time points (6, 10, 24, 48, 72, and 120 hours), collect and lyse the cells for real-time PCR analysis.

[0122] Figure 6Target activation after treatment or transfection with very low doses is shown. A549 cells were transfected with 1 ng / well of IFN-λ mRNA and stimulated with 0.1 ng / well of human rec.hIL-29. As a control, A549 was transfected with 1 ng / well of mRNA encoding BMP2-Stop. At different time points (6, 10, 24, 48, 72, and 120 hours), cells were harvested and lysed for real-time PCR analysis.

[0123] Figure 7 Downstream target activation of IFIT1, IFIT3, OAS3, and ISG15, as evaluated by qPCR, 6 hours after treatment with recombinant IFNλ1 or mRNA encoding IFNλ1 is shown. Downstream target activation is plotted against the measured IFNλ1 levels.

[0124] Figure 8 shows:

[0125] (a) IFNλ1 downstream signaling in A-549 and A-549-ACE2 cells 48 hours after transfection with different doses of mRNA. A similar induction pattern was observed for both cell lines.

[0126] (b) IFNλ1 downstream signaling in A-549 and A-549-ACE2 cells using recombinant protein 48 hours after treatment. In this case, higher induction levels were observed in A-549 cells.

[0127] (c) Expression of IFNλ1 in A-549-ACE2 cells: A549-ACE2 cells were transfected with mRNA encoding IFNλ1, and dose-dependent production of IFNλ1 was generated 48 hours after transfection.

[0128] Figure 9 Expression of IFNλ1 in the transfected cell supernatant after transfection of submerged cells is shown. Comparable expression levels were observed between HEK293, A-549, and FreeStyle 293-F cells. Lower levels were observed in 16HBE14o- cells; untreated wells showed background in ELISA. A peak in expression was observed 24 hours after transfection, and the levels remained constant for at least up to 48 hours after transfection.

[0129] In all cell lines except 16HBE14o- cells, a transfection dose of less than 4 ng / well was sufficient to reach an effective antiviral IFNλ concentration of 0.3 ng / ml 6 hours after transfection.

[0130] Figure 10 shows:

[0131] (a) IFNλ1 downstream signaling in submerged A-549 cells after transfection with IFN-λ mRNA. The values shown are normalized to UT (untransfected). Upregulation of all target genes was observed, and the peak expression was at 24 hours post-transfection. Very strong target induction was observed even with low mRNA doses.

[0132] (b) IFNλ1 downstream signaling in submerged 16HBE14o- cells after transfection with IFN-λ mRNA. The values shown are normalized to UT (untransfected). Upregulation of all target genes (lower for OAS3) was observed, and the peak expression was at 24 hours post-transfection. Overall, weak target induction was observed compared to A-549 cells.

[0133] Figure 11 shows:

[0134] (a) ELISA results for IFNλ1 in ALI cultures after transfection with IFNλ1 mRNA. The values were measured 24 hours post-transfection. The total amount of IFNλ1 was measured in the apical and basolateral compartments. Detection of IFNλ1 was as follows: A-549 > 16HBE14o- > Epithelix human primary wt ALI. The maximum basal production in Epithelix ALI was 500-fold lower compared to A-549 ALI.

[0135] (b) Measurement of downstream target activation in ALI cultures 24 hours after transfection with IFNλ1 mRNA. The highest downstream target activation was observed in A-549 ALI cultures. The values shown are normalized to UT (untransfected). The same activation pattern was observed for all cell lines: ISG15 > IFIT1 ≥ IFIT3 > OAS3.

[0136] (c) Endogenous levels of downstream targets in untreated 16HBE and Epithelix human primary ALIs compared to A-549 ALIs. The basal endogenous levels of downstream targets in 16HBE14o- and Epithelix human primary ALIs were 40-fold higher than those in A-549 ALIs.

[0137] Figure 12 shows:

[0138] (a) Quantification of IFNλ1 mRNA in lung homogenates of treated mice at 5 and 24 hours post-treatment. IFNλ1 mRNA was detected in a dose-dependent manner at 5 hours post-application, with very low levels at 24 hours post-application.

[0139] (b) ELISA assay results for detecting IFNλ1 in lung homogenates and BALF at 5 hours and 24 hours after application. IFNλ1 was measurable in lung homogenates and BALF at 5 hours after application. At 24 hours after application, only low levels of IFNλ1 were detectable.

[0140] (c) Downstream activation of IFNλ1 in lung homogenates. The function of human IFNλ1 mRNA in mice was demonstrated. The values shown are normalized to UT (untreated) mice. The target genes were highly induced at 5 hours after application and remained upregulated at 24 hours after application, although at a lower intensity. Compared to other target genes, the induction intensity of OAS3 was lower, but the induction at 24 hours was higher than that at 5 hours.

[0141] Figure 13 Comparison of hIFNλ1 mRNA transfection with recombinant protein is shown (see also Example 8).

[0142] Figure 14 hIFNλ ELISA showing supernatant from transfected A-549 cells: comparison of LF92 with commercially available transfection reagents (see also Example 9).

[0143] Figure 15 Induction of target genes by mRNA formulated with LF92 is shown (see also Example 10).

[0144] Figure 16 In vitro tolerance of mRNA encoding hIFNλ1 formulated with LF92 is shown (see also Example 11).

[0145] Figure 17 shows the correlation of (a) IFIT1 (b) OAS3 (c) ISG15 and (d) MX1 mRNA translation and target gene induction (see also Example 12).

[0146] Figure 18 In vitro inhibition of (a) SARS-CoV-2 and (b) IAV evaluated by qPCR is shown (see also Example 13).

[0147] Figure 19 Detection of hIFNλ1 mRNA in lung homogenates is shown (see also Example 14).

[0148] Figure 20 Detection of hIFNλ1 protein in lung homogenates is shown (see also Example 15).

[0149] Figure 21 shows target gene activation of (a) IFIT1 (b) IFIT3 (c) ISG15 and (d) OAS3 in lung tissue after application of hIFNλ1 mRNA (see also Example 16).

[0150] Figure 22 Shows the detection of chemokines in plasma after single nasal application of hIFNλ1 mRNA (see also Example 17).

[0151] Figure 23 Shows the activation of target genes of (a) IFIT1 (b) IFIT3 (c) ISG15 and (d) OAS3 in lung tissue after treatment with hIFNλ1 mRNA (see also Example 18).

[0152] Figure 24 Shows the detection of hIFNλ1 mRNA deposited in the lungs after nasal application in mice (see also Example 19).

[0153] Figure 25 Shows the body weight during repeated administration of hIFNλ1 mRNA (see also Example 20).

[0154] Figure 26 Shows the quantification of hIFNλ1 mRNA in ferret lung homogenates (see also Example 21).

[0155] Figure 27 Shows the activation of target genes in ferret lung homogenates (see also Example 22).

[0156] Figure 28 Shows the quantification of IFN mRNA, target gene activation and cytokine induction in ferret lung homogenates (see also Example 23).

[0157] Figure 29 Shows the reduction of IAV replication by mRNA encoding IFN (see also Example 24).

[0158] Figure 30 Shows the reduction of SARS-CoV2 replication by mRNA encoding hIFNλ1 (see also Example 25).

[0159] Other aspects and advantages of the present invention will be described in the following examples, which are given by way of illustration and not of limitation. Each publication, patent, patent application or other document cited in this application is hereby incorporated by reference in its entirety. Examples

[0160] Examples 1 and 2 described below are intended to evaluate the downstream target activation by IFNλ1 treatment with recombinant protein or mRNA encoding IFNλ1 in A-549 cells. To this end, A549 cells were incubated with recombinant IFNλ1 for 6 hours or transfected with mRNA encoding IFNλ1, and the downstream activation of IFIT1, IFIT3, OAS3 and ISG15 was analyzed by qPCR at 6, 10, 24, 48, 72, 120 and 168 hours after treatment. In addition, IFNλ1 levels in cell supernatants were determined by hIL-29 ELISA at all sampling time points.

[0161] When A-549 cells were treated with recombinant IFNλ1, downstream target activation was observed at 6 hours after treatment, but rapidly declined at later time points after medium replacement. IFNλ1-ELISA showed that approximately 30% of the added protein was recovered in the supernatant at 6 hours after treatment. When A-549 cells were transfected with mRNA encoding IFNλ1 and the medium was replaced 6 hours after transfection, IFNλ1 could be detected in the supernatants of these cells up to 168 hours, peaking at 48 hours. Downstream targets were also highly induced with low-dose transfected mRNA and remained upregulated up to 120 hours after mRNA transfection.

[0162] The following abbreviations and definitions are used in the attached examples:

[0163] Abbreviation Description DMEM Dulbecco's Modified Eagle Medium ELISA Enzyme-Linked Immunosorbent Assay FBS Fetal Bovine Serum IFNλ1 Interferon Lambda 1 PBS Phosphate Buffered Saline qPCR Quantitative Polymerase Chain Reaction IFIT1 / 3 Interferon-Induced Tetratricopeptide Repeat Protein 1 / 3 OAS3 2'-5'-Oligoadenylate Synthetase 3 ISG15 Interferon-Stimulated Gene 15 MX1 MX Dynamin Like GTPase 1 IL-6 / 8 Interleukin 6 / 8 MCP-1 C-C Motif Chemokine Ligand 2 CXCL9 / 10 / 11 C-X-C Motif Chemokine Ligand 9 / 10 / 11 CXCL10 C-X-C Motif Chemokine Ligand 10

[0164] In the attached examples, the following materials and methods were used.

[0165] 1. Materials

[0166]

[0167] TaqMan Probe Supplier Catalog Number IFIT3 Thermo Fisher Scientific Hs01922752_s1 IFIT1 Thermo Fisher Scientific Hs03027069_s1 OAS3 Thermo Fisher Scientific Hs00196324_m1 ISG15 Thermo Fisher Scientific Hs01921425_s1

[0168]

[0169] 2. Methods

[0170] 2.1 Cell Culture

[0171] At 37 °C, in a humid atmosphere with 5% CO2, A-549 cells were cultured in MEM supplemented with 10% heat-inactivated FBS and 1% P / S. Twenty thousand cells per well were seeded in 96-well plates with a total volume of 100 μL 24 hours before transfection.

[0172] 2.2 In Vitro Transcription

[0173] To generate a template for in vitro transcription, circular plasmids were linearized by Bsp119I restriction digestion and further purified by chloroform-ethanol precipitation.

[0174] mRNA was generated using a standard in vitro transcription mixture containing T7 RNA polymerase, inorganic pyrophosphatase, and RNase inhibitor (including specified modified nucleoside triphosphates). Co-transcriptional capping was achieved by adding an ARCA cap analogue. For in vitro transcription of chemically modified RNA, respectively, 25% of cytidine-5′-triphosphate was replaced by 5-methylcytidine-5′-triphosphate and 25% of uridine-5′-triphosphate was replaced by 2-thiouridine-5′-triphosphate (Jena Biosciences) (refer to, for example, SEQ ID NO:1). Residual template DNA was digested using DNaseI. Subsequently, the mRNA was purified by a proprietary tangential flow filtration process (reference to our patent).

[0175] The residual uncapped mRNA was dephosphorylated using a phosphatase (Quick cip) and then purified via a proprietary tangential flow filtration process (reference to our patent).

[0176] The mRNA was further polyadenylated using poly(A) polymerase and again purified by a proprietary tangential flow filtration process (reference to our patent). Finally, the mRNA was filtered using a 0.22 μm membrane. In subsequent mRNA quality control, key quality attributes were measured, which included the length of the poly(A) tail, integrity, proportion of cap, and incorporation of modified nucleotides.

[0177] 2.3 Transfection

[0178] The mRNA encoding IFNλ1 (SEQ ID NO:13) (produced as described in Section 2.2 above) was transfected using MessengerMAX TM such that the ratio of RNA to Lipofectamine was 1:1.5 (w / v). To form the liposome complex, the mRNA was diluted in dH2O. MessengerMAX TM was diluted in serum-free medium and mixed by pipetting. After incubation at RT for 10 minutes, the RNA solution was added to MessengerMAX TMIn solution, mix and incubate again at RT for 5 minutes. A dose titration is performed, ranging from 500 to 0.98 ng mRNA / well. Subsequently, 25 μL of liposome complex solution at 15.6, 3.9, 1.95, and 0.98 ng mRNA / well is added to the respective wells.

[0179] 2.4 Collection

[0180] At 6, 10, 24, 48, 72, 120, and 168 hours post-transfection, the supernatants are collected and stored in a fresh 96-well storage plate at -80 °C until ELISA. Before ELISA, the supernatants are centrifuged at 500 × g for 2 minutes to pellet cell debris.

[0181] For qPCR, after collecting the supernatants, the cells are washed with 150 μL of D-PBS per well and frozen at -80 °C.

[0182] 2.5 IFNλ1 ELISA

[0183] The protocol for IFNλ ELISA is carried out as established according to the kit protocol, with the exception that the TMB incubation is shortened to 15 minutes.

[0184] Example 1: Expression of IFNλ1 in Supernatant

[0185] The presence of IFNλ1 in the supernatants of cells transfected with mRNA or treated with rec.hIL-29 is measured via hIL-29 ELISA. The doses used for treatment with recombinant hIL-29 are 2.9, 0.6, 0.3, and 0.1 ng / well. These doses correspond to 23, 5, 2.5, and 1 ng / mL in the supernatants. At 6 hours post-treatment, the concentrations between 0.3 and 8 ng / mL in the supernatants were quantified by ELISA. 70% of the added protein was consumed or degraded by the cells (see Figure 1 ).

[0186] In the supernatants of cells transfected with mRNA encoding IFNλ1, up to 48 hours, increasing concentrations of IFNλ1 could be detected for each dose. From 48 hours to 168 hours, IFNλ1 could still be detected, just with a slight decrease (see Figure 2 ).

[0187] Example 2: Activation of Downstream Targets

[0188] After treatment with recombinant IFNλ1 or mRNA encoding IFNλ1, the activation of downstream targets of IFIT1, IFIT3, OAS3, and ISG15 is evaluated via qPCR.

[0189] High induction of IFIT1, IFIT3, and ISG15 was observed for all doses of mRNA transfection. Depending on the target and dose, the peak of induction was reached between 24 and 48 hours. After mRNA transfection, the target genes remained upregulated for up to 120 hours (see Figures 3 to 6 ). For OAS3, the peak of induction was reached at 120 hours after all transfection doses.

[0190] Treatment with recombinant protein showed comparable target induction to mRNA transfection at 6 hours after treatment. Downstream activation rapidly declined at all subsequent time points after changing the medium and the protein was no longer available to the cells (see Figures 3 to 6 ).

[0191] Six hours after treatment with recombinant IFNλ1 or mRNA encoding IFNλ1, downstream target activation of IFIT1, IFIT3, OAS3, and ISG15 was evaluated by qPCR. Downstream target activation was plotted against the measured IFNλ1 levels. The activation of IFIT1, IFIT3, and ISG15 provided by transfection of IFNλ1 mRNA was higher at low IFNλ1 levels compared to incubation with recombinant IFNλ1 protein (see Figure 7 ).

[0192] Summary of Examples 1 and 2

[0193] A-549 cells were transfected with mRNA encoding IFNλ1 and the medium was changed 6 hours after transfection. IFNλ1 could be detected in the supernatant of these cells up to 168 hours, with a peak at 48 hours. Downstream targets were also highly induced at low doses of mRNA transfection and remained upregulated for up to 120 hours after mRNA transfection.

[0194] Regarding treatment with recombinant hIL-29, downstream target activation was observed at 6 hours after treatment and rapidly declined after changing the medium.

[0195] For the examples described in the examples, the following materials and methods were used:

[0196] 1 Method

[0197] 1.1 In Vitro

[0198] 1.1.1 Cell Cultures

[0199] 1.1.1.1 Submerged Cells

[0200] HEK293, A-549, and 16HBE14o- cells were cultured in MEM supplemented with 10% heat-inactivated FBS and 1% P / S in a humidified atmosphere of 5% CO2 at 37°C. For 16HBE14o- cells, coated flasks were used. FreeStyle293-F cells were cultured in suspension in a 125 mL vented Erlenmeyer flask with FreeStyle F17 expression medium. Twenty-four hours before transfection, cells were seeded in 96-well plates at a total volume of 100 μL at the following densities:

[0201] HEK293: 25,000 cells / well

[0202] FreeStyle293-F: 25,000 cells / well

[0203] 16HBE14o-: 25,000 cells / well

[0204] A-549: 20,000 cells / well

[0205] 1.1.1.2 ALI (air-liquid interface) cultures

[0206] For ALI cultures of 16HBE14o and A-549, 6×10 4 submerged cells (at 80 - 90% confluence) were seeded into coated 24-well inserts. For 16HBE14o-ALI, inserts were coated with 50 μg / mL type I collagen diluted in 20 mM acetic acid. Cells were seeded on top of 250 μL of 16HBE14o- or A-549 medium. For 16HBE14o-, 500 μL of medium and for A-549, 700 μL of medium were added to the basolateral side. Cells were incubated for 72 hours, attaching to the membrane with medium on both the apical and basolateral sides. Twenty-four hours before transfection, the basal medium was replaced with fresh medium, and the apical seeding medium was carefully aspirated (air-lift). Cells were maintained as ALI cultures with no liquid on the apical side.

[0207] MucilAir TM inserts were purchased from Epithelix and cultured as ALI (air-liquid interface) cultures in 700 μL of MucilAir TM medium in a humidified atmosphere of 5% CO2 at 37°C. Cells were allowed to rest for 2 - 3 days after arrival before transfection. To maintain the culture, the medium was changed every 2 - 3 days.

[0208] 1.1.2 Transfection

[0209] 1.1.2.1 Submerged Cultures

[0210] Use MessengerMAX TM Transfect mRNA at an RNA to Lipofectamine ratio of 1:1.5 (w / v). Perform a dose titration ranging from 500 to 0.98 ng mRNA / well. To form the liposome complex, dilute the mRNA in dH2O and MessengerMAX TM dilute in serum-free medium and mix by pipetting. After incubating Lipofectamine / MMax at RT for 10 minutes, add the RNA solution to MessengerMAX TM the solution, mix and incubate at RT for an additional 5 minutes. Then, add 25 μL of the liposome complex solution at the desired concentration to each well.

[0211] 1.1.2.2 ALI Cultures

[0212] Before transfecting Epithelix primary human ALI, perform a mucus wash. Add 200 μL of PBS (w / o Mg / Ca) to the apical side and incubate at 27 °C for 20 minutes. The total time for apical washing should not exceed 30 minutes. To detach the mucus from the apical surface, use a P200 pipette to move back and forth 100 μL three times from the apical liquid. Without damaging the epithelial cells, remove the PBS from the apical surface of the ALI culture by gentle aspiration. To remove traces of PBS, perform a WFI wash with 200 μL of WFI. Only use WFI to wash 16HBE14o- and A-549 ALI.

[0213] Subsequently, transfect the cells with 0.1, 0.3, 1, 3, and 6 μg of mRNA in the LNP / insert. Thaw the formulation at RT and keep it on ice until further use. The detailed calculations are shown in Table 1.

[0214] Table 1: Calculations for ALI Transfection

[0215]

[0216] Six hours after transfection, aspirate the LNP.

[0217] 1.1.3 Collection

[0218] 1.1.3.1 Submerged Cultures

[0219] At each time point after transfection, the supernatant of the cells was collected and stored in a fresh 96-well storage plate at -80 °C until ELISA. Before ELISA, the supernatant was centrifuged at 500 × g for 2 minutes to pellet cell debris.

[0220] For qPCR, after collecting the supernatant, the submerged cells were washed with 150 μL of D-PBS per well and the cell pellet was frozen at -80 °C.

[0221] 1.1.3.2 ALI cultures

[0222] Twenty-four hours after transfection, the apical side of the insert was washed with 200 μL of PBS and pipetted up and down three times. The washings were collected in a 96-well storage plate. 200 μL of the basal medium was also collected in the storage plate. Samples were stored at -80 °C until ELISA.

[0223] For qPCR, the medium was completely removed from the insert and no PBS wash was required. 175 μL of RLT buffer supplemented with DTT (40 μL / mL) from the RNease MiniKit (Qiagen, 74104) was added onto the insert. The cells were loosened from the insert using a micro cell scraper. The RLT buffer was transferred to a QIAshredder column. To ensure that all cells were transferred, the insert was washed with another 175 μL of RLT buffer. To complete cell lysis, the column was centrifuged at maximum speed for 2.5 minutes. The cell lysate could be frozen at -80 °C or used immediately for RNA isolation.

[0224] 1.1.4 IFNλ1 ELISA

[0225] The IFNλ ELISA was performed according to the kit instructions (IL-29 Human ELISA Kit, Abcam, ab100568), with the exception that the TMB incubation was for 10 minutes instead of 30 minutes.

[0226] 1.1.5 RNA isolation

[0227] 1.1.5.1 Submerged cells

[0228] For submerged cells, RNA isolation was performed using the SingleShot TM Cell Lysis Kit (BioRad, Art.Nr.: 1725080).

[0229] SingleShot TM The preparation of the cell lysis buffer was completed according to Table 2. The preparation was always kept fresh and on ice. The lysis buffer was thoroughly mixed, centrifuged, and used within 2 hours.

[0230] Table 2: Lysis buffer

[0231]

[0232] Add 50 μL of lysis buffer for RNA isolation to the frozen samples and incubate for 10 minutes at RT without agitation. Samples are processed within 20 minutes. Subsequently, transfer the cell lysate to a PCR plate. Digest proteins and DNA using the "BioDNA" program with the following conditions (see Table 3): Thermal cycler protocol for cell lysis

[0233] Table 3: Thermal cycler protocol for cell lysis

[0234] Time Temperature 5 minutes 37℃ 5 minutes 75℃

[0235] Cell lysates can be stored on ice for 4 hours, at -20 °C for up to 2 months, or at -80 °C for up to 12 months.

[0236] 1.1.5.2 ALI cultures

[0237] Isolate RNA using the RNeasy Micro Kit (Qiagen, 74104) according to the manufacturer's protocol. Elute using 30 μL of RNase-free water.

[0238] 1.1.6 Synthesis of cDNA

[0239] 1.1.6.1 For submerged cells

[0240] Use the iScript TM Select cDNA Synthesis Kit (BioRad, Art.Nr.: 1708897). Plates with cell lysates are thawed on ice. All kit components except the iScript TM Reverse Transcriptase are thawed on ice, mixed well and briefly centrifuged. Use the OligodT primer for cDNA synthesis. Add the following components to a 2 mL tube, with the iScript Reverse Transcriptase added after the other components (see Table 4).

[0241] Table 4: Master Mix iScript TM Select cDNA Synthesis

[0242] Component Volume per Well [μL] Volume of 96-Well Plate [μL] Nuclease-Free Water 9 900 <![CDATA[5×iScript TM Reaction mixture]]> 4 400 OligodT 2 200 iScript Reverse Transcriptase 1 400 Total 16 1600

[0243] Transfer 4 μL of cell lysate into a new PCR plate using a multi-channel pipette, and then add 16 μL of the master mix on it. Seal the plate with a covering foil, mix gently at 400 rpm, and then briefly spin down the plate. Using a thermal cycler, perform cDNA synthesis using the following protocol (“ISCRIPT2”).

[0244] Table 5: Thermal cycler protocol for cell lysis

[0245] Time Temperature Step 60 minutes 42℃ cDNA Synthesis 5 minutes 85℃ Heat Inactivation

[0246] The cDNA can be stored at -20 °C until qPCR is performed.

[0247] 1.1.6.2 ALI cultures

[0248] For cDNA synthesis of ALI cultures, use the Transcriptor First Strand cDNA Synthesis Kit (Roche, 4896866001). According to the manufacturer's protocol, RNA is transcribed into cDNA. For two-step cDNA synthesis, 1 μg of total RNA and 1 μL of Oligo(dT) primer are required in a total volume of 13 μL to prepare the first step. An example of preparing the template-prime mixture is given in Table 6:

[0249] Table 6: Template-prime mixture

[0250]

[0251] The optional denaturation step is carried out in a thermal block cycler at 65 °C for 10 minutes. After that, all remaining reagents except the enzymes, reverse transcriptase, and RNase inhibitor are thawed on ice and briefly centrifuged. To prepare the master mix, add the following components listed in Table 7 into a new tube.

[0252] Table 7: Master mix

[0253]

[0254]

[0255] Finally, add the enzymes to the reagents listed in Table 7. Adjust the volume of the master mix according to the number of samples. Add 7 μL of the master mix containing the template-prime mixture into each tube to obtain a final volume of 20 μL in each tube, as shown in Table 6. Mix the tubes carefully and briefly centrifuge. Place the tubes back into the thermal block cycler and perform reverse transcription (the second step of cDNA synthesis here) using the following program:

[0256] Table 8: Procedure for Reverse Transcription Using Oligo(dT) Primer

[0257] Steps in Thermal Block Cycler Duration [minutes] Temperature [°C] 1 30 55 2 5 85

[0258] The cDNA can be stored at -20 °C until qPCR is performed.

[0259] 1.1.7 qPCR Using TaqMan Probe

[0260] Combine the following components shown in Table 9 and vortex briefly. To bring the reaction mixture to the bottom of the tube and eliminate air bubbles, centrifuge the mixture briefly. Transfer 18 μL of TaqMan master mix to an optical 96-well qPCR reaction plate. Add 2 μL of cDNA template (cDNA and nuclease-free water) to the optical 96-well qPCR reaction plate as shown in Table 10 to obtain a final volume of 20 μL. Seal the optical 96-well qPCR reaction plate with an optical adhesive film and centrifuge briefly.

[0261] Table 9: Master Mix for qPCR TaqMan

[0262]

[0263] Table 10: Preparation of cDNA Template

[0264] Component Volume per Well [μL] Volume of 96-Well Plate [μL] cDNA 1 96 Nuclease-Free Water 1 96 Total 2 192

[0265] Perform TaqMan assay using the following parameters

[0266]

[0267]

[0268] 1.2 In Vivo

[0269] 1.2.1 Animal Housing

[0270] Mice were housed under specific pathogen-free conditions (negative for any FELASA-listed pathogens in the testing facility according to the annual health and hygiene survey in 2017), in individually ventilated cages under a circadian light cycle (lights on from 7 am to 7 pm). Food and drinking water were provided ad libitum. After the animals arrived, there was an adaptation period of at least 7 days until they entered the study.

[0271] 1.2.2 Intratracheal Application

[0272] Animals were anesthetized by inhalation of pure oxygen containing 4% isoflurane (Isothesia, Henry Shine, Germany). Unconscious animals were intubated using a 20-gauge catheter shortened to 37 mm. The test article with a final volume of 50 μL was applied as a single drop at the proximal tip of the tube (tubus) and aspirated during the physiological inspiratory movement of the animal. Finally, 150 μL of air was applied to ensure no liquid residue remained in the catheter.

[0273] 1.2.3 Clinical examination

[0274] Before and 24 hours after application of the test article, animals were clinically examined using the clinical mouse scoring system. The clinical examination consisted of 4 different categories, which were scored separately. The scores for each of the 4 categories were summed to give the clinical total score. A total score of more than 4 or a score of more than 1 in a single category was considered moderate distress and thus a humane end point.

[0275] 1.2.4 Postmortem examination

[0276] Animals were placed under total anesthesia by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). Subsequently, the mice were killed by cervical dislocation.

[0277] 1.2.5 BALF and lung extraction

[0278] The thorax and abdomen were opened and an 18G catheter was placed into the trachea. 0.5 mL of PBS was injected and extracted from the lungs, centrifuged at 300×g for 10 minutes at 4 °C. The supernatant was removed and stored at -80 °C until further processing. The cell pellet was biobanked at -80 °C. Next, the lungs were excised and also stored at -80 °C until further processing.

[0279] 1.2.6 Lung homogenization

[0280] The samples were homogenized using liquid nitrogen. Thus, the organs were placed in a mortar, which was located in an ice box. Liquid nitrogen was added in a volume that completely covered the lungs. The lungs were ground to a powder in the mortar using a pestle (pistle). The stapula was immersed in nitrogen to divide the organ powder into two halves. Both halves were weighed in empty tared tubes. After each sample, the mortar, pestle, and stapula were washed with ethanol.

[0281] For ELISA, lysis was performed in 250 μL of Triton X-100 lysis buffer (0.25 M triethanolamine, 0.1% Triton X-100, pH 7.7) supplemented with protease inhibitor. For qPCR, lysis was performed with 350 μL of lysis buffer per 30 mg of organ. Lysis buffer RLT was provided by the kit and supplemented with 40 μL / mL DTT. For qPCR, additional homogenization was performed in the lysis tube. Thus, as described above, a 3 × 20 s program was performed in a tissue homogenizer (MP FastPrep-24 tissue and cell homogenizer).

[0282] The samples were incubated on ice for 10 min and centrifuged at maximum speed for 10 min at 4 °C in a Mikro 22R centrifuge (Hettich Zentrifugen). The supernatant was transferred to a new tube and stored at -80 °C until further analysis.

[0283]

[0284] 1.2.7 Cell lysis and cDNA synthesis for qPCR

[0285] RNA isolation was performed using the RNA kit (Macherey & Nagel, 740984.50) according to the manufacturer's protocol.

[0286] Synthesis of cDNA was completed using the Transcriptor First Strand cDNA Synthesis Kit (Roche, 4896866001). According to the manufacturer's protocol, RNA was transcribed into cDNA. For two-step cDNA synthesis, 1 μg of total RNA and 1 μL of OligoDT primer were required for a total volume of 13 μL to prepare the first step. An example of preparing the template-prime mixture is given in Table 11:

[0287] Table 11: Template-prime mixture

[0288]

[0289] The denaturation step was performed at 65 °C in a thermal block cycler for 10 min. After that, all remaining reagents except the enzymes, reverse transcriptase, and RNase inhibitor were thawed on ice and briefly centrifuged. To prepare the master mixture, the following components listed in Table 12 were added to a new tube:

[0290] Table 12: Master mixture

[0291] Name 1x [μL] 5x Reaction Buffer 4 RNAse Inhibitor 0.5 dNTPs 2 Reverse Transcriptase 0.5 Total Volume [μL] 7

[0292] Finally, add the enzyme to the reagents listed in Table 12. Adjust the volume of the master mixture according to the number of samples. Add 7 μL of the master mixture, which contains the template-prime mixture, to each tube to obtain a final volume of 20 μL per tube. Mix the tubes carefully and perform a brief centrifugation. Place the tubes back into the thermal block cycler and initiate the following program for reverse transcription:

[0293] Steps in Thermal Block Cycler Duration [minutes] Temperature [°C] Reverse Transcription 30 55 Enzyme Denaturation 5 85

[0294] The cDNA can be stored at -20 °C until qPCR is performed.

[0295] 1.2.8 For downstream targets, real-time PCR using TaqMan probes is described in 1.1.7.

[0296] TaqMan Probe Supplier Catalog Number IFIT3 ThermoFisher Mm01704846_s1(ifit3, IFIT1 ThermoFisher mM07295796_m1 OAS3 ThermoFisher Mm00460944_m1 ISG15 ThermoFisher Mm01705338_s1 IFNλ ThermoFisher Mm00558035_m1

[0297] 1.2.9 qPCR using UPL for RNA quantification

[0298] To quantify ETH061T02 SNIM RNA in the mouse lungs, qPCR was performed. Therefore, 1 μg of IFNλ1 SNIM RNA was used for cDNA synthesis and synthesized as described in Section 1.1.6. The cDNA of IFNλ1 mRNA was diluted in RNase-free water at the following dilutions: 1:10 1 、1:10 2 、1:10 3 、1:10 4 、1:10 5 、1:10 6 to form a standard curve. Importantly, the cDNA dilution series was prepared in a larger volume (such as 20 μL) to avoid inaccuracies during pipetting. 0.25 μL of the cDNA of the mouse lung samples or the respective standard curve samples was mixed with 3.75 μL of RNase-free water and pipetted into a 480-well 96-well plate. The qPCR master mixture was prepared according to Table 13.

[0299] Table 13: UPL master mixture

[0300]

[0301] In a 480-well 96-well plate, 4 μL of the diluted cDNA samples or standards of the master mixture was added to each well using a multi-channel pipette. The plate was covered with a 480 sealing foil and rotated briefly. qPCR was performed using the UniversalProbes program on a 96-well system.

[0302] Example 3: Comparison of the Effects of mRNA Encoding IFNλ1 and Recombinant IFNλ1 in A-549 Cells Expressing ACE2

[0303] Treatment of A549 or A549-ACE2 cells with recombinant IFNλ1 ( Figure 8a ) or mRNA encoding IFNλ1 ( Figure 8b ) for 48 hours was followed by assessment of downstream target activation of IFIT1, IFIT3, OAS3, and ISG15 via qPCR. Transfection with mRNA encoding IFNλ1 led to a similar induction of IFIT1, IFIT3, OAS3, and ISG15, and the induction of the same downstream targets after treatment with recombinant IFNλ1 was reduced on A549-ACE2 cells compared to A459 cells. Transfection of A549-ACE2 cells with mRNA encoding IFNλ1 led to dose-dependent production of IFNλ1 ( Figure 8c ).

[0304] Example 4: Translation of mRNA Encoding IFNλ1 in Multiple Cell Types

[0305] Transfection with mRNA encoding IFNλ1 led to time- and dose-dependent production of IFNλ1 in HEK293, A549, 16HBE14o-, and FreeStyle293-F cells, as measured by IFNλ1 ELISA ( Figure 9 ).

[0306] Example 5: In A549 and 16HBE14o- Cells in Submerged Cultures after Transfection with mRNA Encoding IFNλ1 Time- and Dose-Dependent Induction of Downstream Targets

[0307] Transfection with mRNA encoding IFNλ1 led to time- and dose-dependent induction of IFIT1, IFIT3, OAS3, and ISG15, as assessed via qPCR ( Figure 10a and b).

[0308] Example 6: Dose-Dependent Production of IFNλ1 and Induction of Downstream Targets in Air-Liquid Interface (ALI) Cultures from A549, 16HBE14o- or Primary Human Lung Cells (Epithelix) Figure 11a

[0309] Transfection with mRNA encoding IFNλ1 in LF92 led to dose-dependent production of IFNλ1 ( Figure 11b ) and induction of IFIT1, IFIT3, OAS3, and ISG15 as assessed via qPCR 24 hours after treatment ( Figure 11c ). The endogenous levels of IFIT1, IFIT3, OAS3, and ISG15 were elevated in ALI cultures derived from 16HBE14o- or primary human lung cells compared to A459-derived ALI cultures ( Example 7: Dose-Dependent Production of IFNλ1 and Induction of Downstream Targets in Mouse Lungs Perfused with mRNA Encoding IFNλ1 ).

[0310] Figure 12a Figure 12b

[0311] Delivery of mRNA encoding IFNλ1 formulated in LF92 resulted in dose- and time-dependent pulmonary deposition of IFNλ1 mRNA ( Figure 12c ), production of IFNλ1 in lung tissue and bronchoalveolar lavage fluid (BALF) ( Example 8: Comparison of hIFNλ1 mRNA Transfection with Recombinant Protein ), and induction of IFIT1, IFIT3, OAS3, and ISG15 as assessed by qPCR 5 and 24 h post-treatment ( Figure 13 ).

[0312] Figure 13

[0313] Single apical transfection of primary bronchial epithelial air-liquid interface (ALI) cultures with mRNA encoding hIFNλ1 enhanced target gene activation compared to apical treatment with recombinant protein. Due to the expression of basolateral receptors, inhalation (apical) administration of mRNA encoding hIFNλ1 and subsequent secretion of more type III IFN basolaterally than apically is expected to be more effective in humans than inhalation of recombinant protein.

[0314] Twenty-four hours after transfection with hIFNλ1 mRNA, when the transfection mixture was aspirated 6 h post-transfection, there was 30 - 40 pg of total protein in the apical compartment ( Figure 13 a). This corresponds to a concentration of 90 ng / mL in airway surface lining fluid (ASL), assuming a volume of 0.33 μl of ASL in the ALI cultures (0.33 cm² chamber surface area × 0.001 cm ciliated layer height). For this reason, target gene activation after transfection was compared to treatment with 100 ng / mL of recombinant protein.

[0315] After apical mRNA transfection, expression of the target gene was 4-fold higher compared to the termination (Stop) mRNA control ( Figure 13 b). In contrast, after apical administration of recombinant hIFNλ1 protein at a concentration of 100 ng / mL, induction of the target gene was lower compared to mRNA transfection and did not exceed 2-fold induction relative to the termination mRNA control ( Example 9: hIFNλ ELISA in Supernatants from Transfected A-549 Cells: Comparison of LF92 with Commercially Available Transfection Reagents b). This effect may be due to a longer exposure of hIFNλ after mRNA transfection (mRNA translation continued after medium change at 6 h), and thus potential accumulation in the apical and basolateral compartments compared to recombinant protein treatment, and thus higher protein levels. These observations highlight the potential of mRNA treatment to increase the PK / PD benefits compared to recombinant protein treatment ( Figure 14 ).

[0316] Example 10: Target Gene Induction by mRNA Formulated with LF92 Figure 15

[0317] At 6 and 24 hours post-transfection, the medium was changed on each plate that was not harvested at these time points. Thus, the 24-hour time point reflects translation between 6 and 24 hours, and the 48- and 72-hour time points reflect translation after 24 hours. Translation after mRNA transfection occurred in a dose- and time-dependent manner, and mRNA formulated with LF92 was similar in extent to that when using a commercially available transfection reagent ( Example 11: In Vitro Tolerance of mRNA Encoding hIFNλ1 Formulated with LF92 ).

[0318] Figure 16

[0319] At 6 and 24 hours post-transfection, the medium was changed on each plate that was not harvested at these time points. Thus, the 24-hour time point reflects translation between 6 and 24 hours, and the 48- and 72-hour time points reflect translation after 24 hours. After single transfection of A549 lung cells with mRNA encoding hIFNλ1 formulated with LF92, dose-dependent and sustained activation of hIFNλ1 target genes was observed ( Example 12: Correlation between mRNA Translation and Target Gene Induction ).

[0320] Example 13: Evaluation of Virus Inhibition In Vitro by qPCR

[0321] At 6 and 24 hours post-transfection, the medium was changed on each plate that was not harvested at these time points. Thus, the 24-hour time point reflects translation between 6 and 24 hours, and the 48- and 72-hour time points reflect translation after 24 hours. After single transfection of A549 lung cells with mRNA encoding hIFNλ1 formulated with LF92, induction of cytokine mRNA expression was observed only at high doses related to the plateau of target gene induction ( Figure 18 ).

[0322] Figure 18

[0323] At 6 and 24 hours post-transfection, the medium was changed on each plate that was not harvested at these time points. Thus, the 24-hour time point reflects translation between 6 and 24 hours, and the 48- and 72-hour time points reflect translation after 24 hours. The amount of hIFNλ1 measured in the supernatant was correlated with the extent of target gene induction (Figure 17).

[0324] Example 14: Detection of hIFNλ1 mRNA in Lung Homogenates

[0325] Prophylactic treatment with hIFNλ1 mRNA reduced SARS-CoV-2 and IAV viral loads, while termination of the mRNA did not ( Figure 19 ). A dose-dependent decrease in viral load was observed with recombinant hIFNλ1, but this decrease was smaller with the recombinant protein compared to mRNA treatment ( Example 15: Detection of hIFNλ1 Protein in Lung Homogenates)。The treatment was carried out 24 hours before infection. Samples were taken 48 hours after infection.

[0326] Figure 20

[0327] Five hours after a single nasal administration in mice, dose-dependent deposition of mRNA encoding human IFNλ1 was observed ( Example 16: Target Gene Activation in Lung Tissue after Application of hIFNλ1 mRNA ). Three animals were evaluated per group.

[0328] Figure 21d

[0329] After a single intranasal treatment with mRNA encoding human IFNλ1 protein, quantification of human IFNλ1 in lung homogenates showed dose- and time-dependent protein translation ( Example 17: Detection of Chemokines in Plasma after Single Nasal Application of hIFNλ1 mRNA ). Three animals were evaluated per group.

[0330] Figure 22

[0331] After a single nasal administration in mice, the application of hIFNλ1 mRNA was well tolerated and effectively induced lung target gene expression at low doses (Figure 21).

[0332] The analyzed target genes OAS3, ISG15, IFIT1, and IFIT3 showed dose-dependent activation at all dose levels at the 5-hour time point (Figure 21). Only OAS3 showed dose-dependent activation up to 24 hours after application ( Example 18: Target Gene Activation in Lung Tissue after Treatment with hIFNλ1 mRNA ). Three animals were evaluated per group.

[0333] Figure 23

[0334] After a single nasal administration of mRNA encoding hIFNλ1 or a control mRNA in mice, the plasma concentrations of the measured chemokines did not change at all dose levels compared to the vehicle ( Figure 23 ). Three animals were evaluated per group.

[0335] Figure 23

[0336] After multiple nasal administrations in mice, hIFNλ mRNA formulated with LF92 was well tolerated and effectively induced lung target gene expression at low doses ( Figure 23 ).

[0337] Three doses were administered at 48-hour intervals, and samples were collected 24 hours after the last application. The expression of hIFNλ target genes in lung homogenates increased in a dose-dependent manner ( Example 19: Detection of hIFNλ1 mRNA Deposited in the Lungs after Nasal Application in Mice ). At the dose level of 1 μg hIFNλ mRNA, all analyzed target genes were activated up to 15-fold ( Figure 24)。The lack of target gene activation in the termination group and the vehicle group indicates that the observed effect is target-induced ( Example 20: Body Weight during Repeated Administration of hIFNλ1 mRNA )。Six animals were evaluated per group.

[0338] Figure 25

[0339] Three doses were administered at 48-hour intervals, and samples were collected 24 hours after the last application. Dose-dependent deposition of mRNA encoding human IFNλ1 was observed ( Example 21: Quantification of hIFNλ1 mRNA in Ferret Lung Homogenates )。Six animals were evaluated per group.

[0340] Figure 26

[0341] By nasal application in mice, three doses were administered at 48-hour intervals, and body weight was measured daily. No change in body weight was recorded ( Example 22: Target Gene Activation in Ferret Lung Homogenates )。Six animals were evaluated per group.

[0342] Figure 27

[0343] After single nasal administration in ferrets, hIFNλ1 mRNA was deposited in all lung lobes ( Example 23: Quantification of IFN mRNA, Target Gene Activation, and Cytokine Induction in Ferret Lung Homogenates )。Three animals were evaluated per group.

[0344] Figure 28

[0345] After single nasal administration in ferrets, hIFNλ1 treatment led to the induction of ISG15, MX1, and OAS3 ( Figure 28 )。Three animals were evaluated per group.

[0346] Example 24: Reduction of IAV Replication by mRNA Encoding IFN

[0347] Single nasal administration of mRNA encoding hIFNλ1, hIFNβ, or both led to mRNA deposition in all lung lobes ( Figure 29 )。All three treatments induced Mx-1, and none of the cytokines analyzed were induced ( Figure 29 )。Three animals were evaluated per group.

[0348] Figure 29

[0349] In a ferret influenza model, intranasal administration of mRNA encoding hIFNλ1 ( Figure 29 a), hIFNβ ( Example 25: Reduction of SARS-CoV2 Replication by mRNA Encoding hIFNλ1 b), or both ( Figure 30 c) was well tolerated and reduced early viral replication and clinical symptoms ( Figure 30 )。Treatments were performed on days -1, 1, and 3 of the study, and infection was performed on day 0. Ten animals were evaluated per group.

[0350] Figure 30

[0351] Intranasal administration of the mRNA encoding hIFNλ1 was well tolerated and resulted in reduced viral replication and less weight loss in the hACE2-TG mouse model challenged with SARS-CoV-2α compared to vehicle-treated animals( Figure 30 ). Viral replication was assessed by measuring genomic viral RNA via RT-qPCR (60% reduction compared to vehicle)( Components a) and infectious viral particles by the TCID 50 method (97% reduction compared to vehicle)( Volume per Well [μL] b). Weight was shown as the percentage change in weight on day 3 post-viral inoculation( Nuclease-Free Water c). Two to five animals were evaluated per group. The following controls were employed: mock-treated mice, mice with hIFNλ1 mRNA but no virus treatment, and mice with vehicle but no virus treatment.

[0352] In Examples 8 to 25, the following materials were used.

[0353] 2.1 Materials

[0354]

[0355]

[0356]

[0357] 2.2 Methods

[0358] 2.2.1 Cell cultures

[0359] 2.2.1.1 ALI cultures

[0360] MucilAir TM inserts were purchased from Epithelix and cultured as air-liquid-interface (ALI) cultures in 700 μL of MucilAir TM medium at 37 °C in a humid atmosphere with 5% CO2. Cells were allowed to rest for 2 - 3 days after arrival before transfection. To maintain the culture, the medium was changed every 2 - 3 days.

[0361] 2.2.1.2 A-549 cell culture

[0362] A-549 cells were cultured as described in 2.1 above.

[0363] 2.2.1.3 A549-ACE2 cell culture

[0364] A549-ACE2 cells were cultured in DMEM containing 10% FBS, 100 μg / mL streptomycin, and 100 IU / mL penicillin. Twenty-four hours before treatment, 10,000 cells were seeded in a 96-well plate with a total volume of 100 μL.

[0365] 2.2.2 Transfection / Treatment

[0366] Before transfection, mucus washing was performed. Thus, 200 μL of PBS (w / o Mg / Ca) was added to the apical side and incubated at 37 °C for 20 minutes. The total time for apical washing should not exceed 30 minutes. To separate mucus from the apical surface, a P200 pipette was used to aspirate 100 μL of the apical liquid three times in a back-and-forth motion. Without damaging the epithelial cells, PBS was removed from the apical surface of the ALI culture by gentle aspiration. To remove traces of PBS, WFI washing was performed using 200 μL of WFI.

[0367] Subsequently, the cells were transfected / treated with the required dose. The preparation was thawed at RT and kept on ice until further use. The recombinant protein was diluted in the medium.

[0368] Six hours after transfection, the mRNA and recombinant protein were removed from the apical side. In the case of the recombinant protein, the basal medium was also updated. Twenty-four hours after transfection, the apical side of the insert was washed with 200 μL of PBS by pipetting up and down three times. The wash solution was collected in a 96-well storage plate for ELISA analysis. 200 μL of the basal medium was also collected in the storage plate. The samples were stored at -80 °C until ELISA was performed.

[0369] For qPCR, 175 μL of RLT buffer supplemented with DTT (40 μL / mL) from the RNease Mini Kit was added to the insert. The cells were loosened from the insert using a micro cell scraper. The RLT buffer was transferred to a QIAshredder column. To ensure that all cells were transferred, the insert was washed with another 175 μL of RLT buffer. To complete cell lysis, the column was centrifuged at maximum speed for 2.5 minutes. The column was removed, and the cell lysate in the tube could be frozen at -80 °C or immediately used for RNA isolation.

[0370] 2.2.2.1 Transfection Using Lipofectamine MMax in Examples 9 to 12

[0371] Transfection was performed using Lipofectamine MMax as described in 2.3 above, except that a dose titration ranging from 0.005 to 100 ng mRNA / well was performed. Subsequently, 25 μL of the liposome complex solution was added to each well, and the medium was replaced with 100 μL of fresh complete medium.

[0372] 2.2.2.2 Transfection using Lipofectamine MMax in Example 13

[0373] Transfection was performed using Lipofectamine MMax as described in 2.3 above, except that a dose titration from 15 ng / 25 μL down to the desired concentration was performed. The medium of the cells was replaced with 100 μL of fresh medium.

[0374] Subsequently, 25 μL of the liposome complex solution was added to each well.

[0375] For the treatment of recombinant proteins, the proteins were pre-diluted in the medium and added to the cells at the desired concentration in 25 μL.

[0376] 2.2.2.3 Transfection of mRNA formulated with LF92

[0377] The mRNA formulated with LF92 was diluted to the desired concentration in a carrier (10% (w / v) sucrose, 50 mM NaCl and proprietary excipients). 25 μL of each dilution was added to each well, and the medium was replaced with 100 μL of fresh complete medium.

[0378] 2.2.3 RNA isolation

[0379] The isolation of RNA was performed as described in 1.1.5.2 above.

[0380] 2.2.4 cDNA synthesis

[0381] The synthesis of cDNA was performed as described in 1.1.6 above.

[0382] 2.2.5 qPCR using TaqMan probes

[0383] qPCR was performed using TaqMan probes as described in 1.1.7 above. The analysis of the qPCR results was performed using the ΔΔCt method. For this purpose, the ΔCt value of each sample was first calculated. This was done by subtracting the average Ct value of the housekeeping gene (RPLP0) from the target Ct value. Then, ΔΔCt was calculated by subtracting the average ΔCt value of the reference sample (vector control) from the target ΔCt value. Finally, the fold change was calculated using the formula: 2 -ΔΔCt .

[0384] 2.2.6 hIFNλ1 ELISA (IL - 29 ELISA)

[0385] The hIFNλ1 ELISA was performed as described in 1.1.4 above. Interpolation was performed using a 4 - PL standard curve. Analysis was performed using GraphPad Prism software and Excel.

[0386] 2.2.7 Collection

[0387] Collection was performed at 3, 6, 24, 48, and 72 hours post - transfection. For each plate, the medium was changed at 6 and 24 hours post - transfection.

[0388] For ELISA, the supernatant of the cells was collected in a 96 - well storage plate and frozen at - 80 °C. Since two different ELISAs were performed, the supernatant was split onto two plates to allow for separate thawing. For qPCR, 150 μL of PBS was used - / - to wash the cells, and the cells were frozen without liquid at - 80 °C.

[0389] 2.2.8 RNA isolation using the SingleShot TM Cell Lysis Kit

[0390] As described in 2.2.5, RNA isolation was performed using the SingleShot TM Cell Lysis Kit.

[0391] 2.2.9 Preparation of virus stock

[0392] The SARS - CoV - 2 - MUC - IMB - 1, SARS - CoV - 2 - GFP strain, wild - type influenza A virus (IAV - WT) (SC35M), and IAV (SC35M) NS1 - GFP were generated by infecting Vero E6 cells cultured in DMEM medium (10% FCS, 100 μg / ml streptomycin, 100 IU / ml penicillin) for 2 days (MOI 0.01). Before storage at - 80 °C, the virus stock was collected and centrifuged twice (1000 g / 10 minutes).

[0393] The titer of the virus stock was determined by plaque assay. For this, confluent monolayers of Vero E6 cells were infected with serial five - fold dilutions of the virus supernatant at 37 °C for 1 hour. The inoculum was removed and replaced with serum - free MEM containing 0.5% carboxymethyl cellulose. Two days after infection, the cells were fixed for 20 minutes at room temperature by directly adding formaldehyde to the medium to a final concentration of 5%.

[0394] The fixed cells were extensively washed with PBS and then stained with H2O containing 1% crystal violet and 10% ethanol for 20 minutes. After rinsing with PBS, the number of plaques was counted and the virus titer was calculated.

[0395] 2.2.10 Virus infection

[0396] Cells were infected 24 hours after transfection with SARS-CoV-2 (MOI 3) or IAV (MOI 0.5). The virus was directly added to the cell culture in 25 μL of medium. To analyze the infection kinetics under a live imaging system, SARS-CoV-2-GFP and IAV-GFP were used.

[0397] 2.2.11 Cell monitoring in IncuCyte

[0398] After infection, the plates were placed in an IncuCyte S3 live cell analysis system, and whole-well real-time images of mock (phase channel) and infected (GFP and phase channel) cells were acquired every 4 hours for 48 hours. Using IncuCyte S3 software (Essen Bioscience; version 2019B Rev2), cell viability (mock) and virus growth (mock and infected) were evaluated as the cell confluence (phase area) per well and the cumulative GFP intensity normalized to the cell confluence per well (cumulative GFP intensity / phase area), respectively.

[0399] 2.2.12 qPCR for SARS-CoV-2 and IAV mRNA

[0400] Relative transcript quantification was performed using PowerUp SYBR Green. All steps were carried out according to the manufacturer's instructions. RPLP0 was used as the housekeeping gene.

[0401] 2.2.13 Animal housing

[0402] All animals were housed as described in 1.2.1 above. All procedures were approved by the local animal welfare agency (Regierung von Oberbayern) with the file number Az. 2532.Vet_03-17-114 and were conducted in accordance with the German Animal Protection Law (Tierschutzgesetz).

[0403] 2.2.14 Nasal application in Examples 14 to 17

[0404] The animals were anesthetized by inhaling pure oxygen at a flow rate of 2 L / min in the inhalation chamber, supplemented with approximately 4% of the anesthetic gas isoflurane. Using a laboratory pipette, hIFNλ1 mRNA was applied in two 25 μL boluses to both nostrils, such that the liquid was actively inhaled by the animals through the nose during physiological inspiration movements. During this procedure, the animals were kept in a vertical position and subsequently placed in a supine position until recovery from anesthesia.

[0405] 2.2.15 Clinical examinations in Examples 14 to 17

[0406] Clinical examinations were performed as described above in 1.2.3, with the exception that the animals were clinically examined before treatment, 5 hours after treatment, and daily until the day of autopsy. In addition, body weight was measured before application and daily until the last day of the experiment.

[0407] 2.2.16 Autopsy

[0408] Predetermined autopsy time points were selected at 5, 24, or 48 hours after application. In A01, an additional 72 h time point was also included for autopsy. In A02, Group 2, additional autopsies were performed at 72 and 96 hours after hIFNλ1 mRNA application. The animals were placed under general anesthesia by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). Capillary blood was drawn from the retrobulbar venous plexus using a non-heparinized 0.8 mm capillary and collected in an EDTA tube. The blood samples were centrifuged at 2,000 × g for 5 minutes at 4°C. Subsequently, the mice were killed by cervical dislocation.

[0409] The thorax and abdomen were opened, and the unrinsed lungs were removed in their entirety, quickly frozen on dry ice, and stored at -80°C until further processing.

[0410] 2.2.17 Lung homogenization 2.2.17.1

[0412] The samples were homogenized using liquid nitrogen. Therefore, the organs were placed in a mortar, which was located in an ice box. Liquid nitrogen was added in a volume that completely covered the lungs. The lungs were ground into powder in the mortar using a pestle. Always ensure that the organs were covered with liquid nitrogen. The spatula was immersed in nitrogen and used to divide the organ powder into three parts. The organ powder was placed in empty, balanced Eppendorf tubes. Approximately 5 mg of the powder was taken for bDNA determination, and the remaining powder was divided in half, one part for ELISA and one part for qPCR. The weight of each organ was recorded.

[0413] After each sample, the mortar, pestle, and spatula were washed with ethanol. 2.2.17.2

[0415] For ELISA, lysis was performed in Triton X-100 lysis buffer (0.25 M triethanolamine, 0.1% Triton X-100, pH 7.7). Lysis was carried out on ice for at least 10 minutes. After every six samples, the lysate was centrifuged at 14,000 rpm for 10 minutes. The supernatant was collected in a new tube and stored at -80 °C until further processing. 2.2.17.3

[0417] For qPCR, 600 μL of lysis buffer was added to the tube containing the organ powder. Lysis buffer RLT was provided by the kit and supplemented with 40 μL / mL DTT. The solution was then transferred to Lysing Matrix D tube and homogenized in a tissue homogenizer for 3 × 20 seconds. The lysate was transferred to a new Eppendorf tube. The volume of the homogenate equivalent to 10 mg of lung was calculated, transferred to a new Eppendorf tube, and mixed with lysis buffer to a final volume of 350 μL. These samples were used directly for RNA isolation without freezing. The remaining lung homogenate was stored at -80 °C.

[0418] 2.2.18 RNA Isolation and cDNA Synthesis for qPCR in Examples 14 to 17 and 18 to 20

[0419] RNA was isolated from the lung lysate using 10 mg of lysed lung homogenate and the RNeasy Micro Kit from Qiagen according to the manufacturer's protocol.

[0420] Synthesis of cDNA was carried out as described in 1.1.6.1 above. For two-step cDNA synthesis, 1 μg of total RNA and 1 μL of OligoDT primer were used in a total volume of 13 μL to prepare the first step, herein referred to as the template primer mixture.

[0421] 2.2.19 Preparation of Standard Curve for Quantifying hIFNλ1 mRNA

[0422] To accurately calculate the amount of mRNA encoding human IFNλ1 in the samples, a standard curve was required. Therefore, 1 μg of hIFNλ1 mRNA was reverse-transcribed. The cDNA was then serially diluted in nuclease-free water with the following dilutions: 1:10 1 、1:10 2 、1:10 3 、1:10 4 、1:10 5 、1:10 6 、1:10 7。These dilutions were prepared independently. This means that for example a 1:10 2 dilution was not made from the 1:10 1 dilution used in the test, but from a separate 1:10 1 dilution. 2 μL of each dilution was added to 8 μL of master mix for qPCR.

[0423] 2.2.20 qPCR using UPL probes

[0424] To quantify the mRNA encoding human IFNλ1, including the standard curve, Universal Probe Library (UPL) probes were used.

[0425] The following components shown in Table 14 were combined and vortexed briefly. To bring the reaction mixture to the bottom of the tube and eliminate air bubbles, the mixture was centrifuged briefly at 3200 g for 2 minutes.

[0426] 8 μL of TaqMan master mix was transferred to a 96-well optical qPCR reaction plate. 2 μL of cDNA template was added to the optical 96-well qPCR reaction plate to give a final volume of 10 μL. The optical 96-well qPCR reaction plate was sealed with an optical adhesive film and centrifuged briefly at 3200 g for 2 minutes.

[0427] On the LightCycler96, the run mode of "New experiment based on Roche template" was selected, and "Hydrolysis probe" was selected.

[0428] Table 14: Master mix qPCR UPL

[0429] Primer 1 [20 μM] Primer 2 [20 μM] UPL [Stock Solution] 2.625 Fast Start Essential DNA Probe Master 0.150 Total 0.150 ​ 0.075 ​ 5 ​ 8

[0430] 2.2.21 Calculation of hIFNλ1 mRNA content

[0431] The amount of mRNA encoding human IFNλ1 in the sample can be determined using a standard curve. A standard curve was made with the logarithm (amount of hIFNλ1 mRNA) on the x-axis and the ct value on the y-axis of the standard curve.

[0432] Exemplary equation of the standard curve

[0433] Y = -3.2449X + 9.1445

[0434] From this, the amount of IFNλ1 mRNA in the sample was determined (X: logarithm of the concentration) (Y: ct value of the sample).

[0435] Table 15: Example calculation: Calculation of the total amount of IFNλ1 mRNA in each lung

[0436]

[0437] 2.2.22 CXCL9 and CXCL11 ELISA in Plasma

[0438] The plasma samples of this study were measured according to the manufacturer's instructions. The changes in the protocol can be found in Table 16.

[0439] Table 16: Parameters of the CXCL9+10 ELISA protocol in plasma not included in the manufacturer's instructions

[0440]

[0441] 2.2.23 CXCL9 and CXCL11 ELISA in Lung Homogenates

[0442] The lung homogenates of this study were measured according to the manufacturer's instructions. The changes in the protocol can be found in Table 17.

[0443] Table 17: Parameters of the CXCL9-11 ELISA protocol in plasma not included in the manufacturer's instructions

[0444]

[0445] 2.2.24 Intranasal Application in Examples 18 to 20

[0446] The animals were anesthetized by inhaling pure oxygen at a flow rate of 2 L / min in an inhalation chamber supplemented with approximately 3% of the anesthetic gas isoflurane. hIFNλ1 mRNA was applied as a single drop with a volume of 50 μL on the tip of the nose, and then actively inhaled through both nostrils during the next physiological inspiration movement. During this procedure, the animals were kept in a vertical position and then placed in a supine position until they recovered from anesthesia. The treatment was performed every other day, and the drug was administered a total of 3 times. Autopsy was performed 24 hours after the last application.

[0447] 2.2.25 Clinical Examinations in Examples 18 to 20

[0448] Clinical examinations were performed as described in 1.2.3 above, except that the animals were clinically examined before the first treatment and 3 hours after the treatment, and then examined daily until the day of autopsy. In addition, the body weight was measured before application and daily until the last day of the experiment.

[0449] 2.2.26 Autopsy in Examples 18 to 20

[0450] Animals were placed under general anesthesia by intraperitoneal injection of fentanyl / midazolam / medetomidine (0.05 / 5.0 / 0.5 mg / kg body weight). Capillary blood was drawn from the retroorbital venous plexus using a non-heparinized 0.8 mm capillary and collected in EDTA tubes. Subsequently, the mice were killed by cervical dislocation. The thorax and abdomen were opened, and the unrinsed lungs were removed in their entirety.

[0451] The right main bronchus was ligated, the right lung was removed, snap-frozen on dry ice, and stored at -80 °C until further processing. The left lung was perfused with 0.4 mL of fixative (4% paraformaldehyde solution) via the trachea. Subsequently, the left bronchus was ligated, and the perfused left lung including the trachea was transferred to 4% paraformaldehyde solution for diffusion fixation for approximately 24 hours. After the fixation time was completed, the lung samples were transferred to 70% ethanol.

[0452] 2.2.27 Preparation of plasma

[0453] The EDTA-blood samples were centrifuged at 2,000 × g for 5 minutes at 4 °C. The supernatant was frozen on dry ice and subsequently stored at -80 °C until further processing.

[0454] 2.2.28 Lung homogenization in Examples 18 to 20

[0455] Lung homogenization was performed as described in 2.2.17.3 above.

[0456] 2.2.29 Test system in Examples 21 to 24

[0457] Species: Mustela putorius furo (ferret)

[0458] Breed: Sable

[0459] Source of supply: Triple F Farms (Gillett, PA)

[0460] Ferrets were 20 to 24 weeks old at the time of administration of hIFN mRNA formulated in LF92. In Example 24, ferrets were five months old at the time of administration of hIFN mRNA formulated in LF92. The body weights of the animals ranged from 0.7 kg to 1.1 kg on the day before dosing (-1 day). After receiving the animals, each animal was permanently identified at the NLS by a unique ear tag.

[0461] 2.2.30 Housing of the test system in Examples 21 to 24

[0462] Before the start of the study, the animals were acclimated for 10 to 12 days. During the acclimation period, the technicians evaluated the health status of the animals daily for clinical manifestations and behavioral signs indicating normality or illness. During the acclimation period and throughout the life stages of the study, three animals were housed together in stainless-steel cages with wire bottoms.

[0463] 2.2.31 Test doses in Examples 21 to 23

[0464] The animals were administered 1 mL of hIFN mRNA formulated with LF92 by nasal instillation using a pipette (0.5 mL / nostril). Human IFNλ1 or the stop mRNA formulated with LF92 was applied at an mRNA concentration of 0.07 mg / mL. In Example 23, an mRNA concentration of 1.25 mg / mL was applied, and in the case of the combination of human IFNλ1 and human IFNβ, the total mRNA concentration was 2.5 mg / mL.

[0465] 2.2.32 Test doses in Example 24

[0466] On days -1, 1, and 3 of the study, the animals were administered hIFN mRNA formulated with LF92 by nasal instillation using a pipette (0.125 or 0.25 mg / mL solution at 0.5 mL / nostril). The mRNA formulated with LF92 encoding human IFNλ1, human IFNβ, or a combination of both was applied at an mRNA concentration of 1.25 mg / mL, and in the case of the combination, the total mRNA concentration was 2.5 mg / mL. A vehicle was applied as a control.

[0467] On day 0 of the study, the animals in all groups were administered 1 mL of freshly diluted H1N1 A / California / 04 / 09 virus by nasal instillation until a titer of 2×10 2 TCID 50 / ml. The virus titer (retitration) was confirmed on the same day.

[0468] 2.2.33 Postmortem examination in Examples 21 to 23

[0469] All animals were humanely euthanized under heavy sedation 6 hours after dosing. Lung tissue specimens were collected from the upper, middle, and lower regions of the upper left (left cranial), upper right (right cranial), lower left (left caudal), and lower right (right caudal) lung lobes. The tissue specimens were weighed, cut into 3 pieces, placed in cryotubes containing 1 mL of RNAlater, and stored at 4 °C overnight to allow RNAlater to penetrate the tissue. The RNAlater solution was removed from the tubes, and the tissue was quickly frozen and stored at -80 °C until shipment to ethris.

[0470] 2.2.34 Lung homogenization in Examples 21 to 23

[0471] Add 600 μL of lysis buffer to the lysis D tube and store on ice. The lysis buffer RLT is provided by the kit and supplemented with 40 μL / mL DTT. Weigh the frozen organ and transfer it to a lysis tube according to the weight, or cut it into pieces and transfer it to several lysis tubes. 300 - 350 mg in 600 μL of lysis buffer is determined as the maximum tissue amount and the volume of lysis buffer per lysis tube. When processing further samples, the organs in the lysis buffer are kept on ice. Homogenize for 3 × 20 s in a tissue homogenizer. Then centrifuge the lysate at maximum speed (14,000 rpm) for 3 minutes. Transfer the supernatant to a new Eppendorf tube. Transfer the homogenate volume equivalent to 10 mg of lung to another new Eppendorf tube. Add lysis buffer to this tube to a final volume of 600 μL. These samples as well as the residual lysate are frozen at -80 °C before separating RNA.

[0472] 2.2.35 Clinical observations in Example 24

[0473] The ferrets are observed twice a day and the clinical symptoms of the disease are scored, including sneezing, nasal discharge, and activity. The score for the absence or presence of sneezing or nasal discharge is 0 or 1. The activity score is 0 = normal activity, 1 = reduced activity, and 2 = inactivity. The daily scores are reported for each ferret, showing the specific clinical signs on a given day. The scores are also reported as the number of ferrets in each group showing one or more signs of infection on a given day.

[0474] 2.2.36 Body weight and body temperature in Example 24

[0475] The body weight is measured at the time of receipt, before the first administration of hIFN mRNA formulated with LF92, and on each day of the study.

[0476] The body temperature is measured daily using a transponder implanted subcutaneously in the ferret on day -1.

[0477] 2.2.37 Virus titer in nasal washings

[0478] On days 1, 2, 3, 4, 5, and 6 after virus challenge, collect nasal washings by rinsing the nasal cavity with 2 mL of sterile PBS containing 0.5% bovine serum albumin (BSA), penicillin, streptomycin, and amphotericin B. Collect the washings on days 1 and 3 before the administration of hIFN mRNA formulated with LF92. Collect the nasal washings and aliquot them into sterile 1.5 mL Eppendorf tubes, and immediately freeze them on dry ice, then store at -80 °C until used to determine the virus titer of TCID 50 of.

[0479] Prepare serial 10 -1 to 10 -10 -fold 1 / 2-log 10 dilutions of nasal washes in virus growth medium (DMEM supplemented with 0.3% BSA) without TPCK-trypsin. Add 25 μL (25 μl) of each 10 1 / 2-log 10 dilution of nasal wash to MDCK cells in a 96-well microtiter plate (four (4) replicates for each dilution), and incubate for 60 minutes at 37 °C, 5% CO2. After 60 minutes of incubation, add one hundred seventy-five microliters (175 μl) of virus growth medium (DMEM supplemented with 0.3% BSA and 1 μg / ml TPCK-trypsin) to each well. Then incubate the cells for 48 hours at 37 °C, 5% CO2. Test the hemagglutination of the contents of each well by incubating 50 μl of tissue culture supernatant with 50 μl of 0.5% turkey red blood cells in 1× PBS at room temperature for 30 minutes. Calculate the TCID 50 by the Reed and Muench method. Briefly, the presence of influenza virus causes the agglutination of red blood cells. Determine the number of positive (wells with hemagglutination) and negative wells for each dilution. Calculate the "cumulative positive", "cumulative negative", ratio and percentage of positive. Then calculate the "proportional distance" between the dilution showing >50% positive and the dilution to the dilution showing <50% positive using the following formula:

[0480] Proportional distance = ((% of positive values above 50%) - 50) / (% of positive values above 50% - % of positive values below 50%) × 0.5 ( 1 correction factor for 1 / 2-log dilution). The viral TCID 50 of each specimen is calculated by adding the proportional distance to the dilution showing >50% positive.

[0481] 2.2.38 Autopsy in Example 24

[0482] Euthanize the animals humanely on day 6 and collect lung tissues from all four lung lobes. Take pictures of the lungs and weigh them separately. Collect three sections from each lung lobe. Place two of the sections into pre-weighed tubes containing RNAlater (or equivalent) and weigh them, and place the third section of lung into 10% buffered formalin.

[0483] 2.2.39 Quantification of viral RNA in the lungs

[0484] In an Applied Biosystems QuantStudio 6-flex thermocycler (Applied Biosystems, Foster City, CA, USA), the quantification of influenza virus in ferret lung tissue was determined by one-step RT-qPCR. Viral RNA was extracted from lung tissue specimens collected from the left upper lobe using the Zymo Research Quick-RNA Miniprep Plus kit (Santa Ana, CA), and 60 μL of eluted viral RNA was obtained. This RNA was aliquoted and stored at -80 °C until used for quantification. Five microliters (5 μL) of the extracted RNA was used to program a 20-μL one-step RT-qPCR reaction mixture containing qScript XLT One-Step RT-qPCR ToughMix plus Rox (QuantBio) and 0.2 μM each of primers M+24F (5'-AGATGAGTC TTCTAA CCG AGG TCG-3') and Rev-mod (5'-TGC AAA GAC ACT TTC CAG TCT CTG-3') and the TaqMan probe M+64 (5'6-FAM / TC AGG CCC C / ZEN / C TCA AAG CCG A-3'BkFQ), for amplification of the sequence on viral gene segment 7 encoding the viral matrix protein. Amplification was performed in a 96-well plate, with a single cycle at 50 °C for 10 min for reverse transcription, followed by 3 min at 95 °C and then 45 cycles of 95 °C for 10 s and 60 °C for 30 s for DNA amplification. The quantity of viral RNA in each sample was interpolated from a standard curve generated from serial dilutions of a cell culture stock of influenza A / California / 04 / 2009pdmH1N1 (8 × 10 6Generated by amplification of serial dilutions of viral RNA extracted from ferret lung homogenates (10⁶ pfu / mL). The total viral RNA in each sample was normalized to the relative amount of ferret GAPDH RNA in one milligram of total RNA. Three microliters (3 μL) of the extracted RNA was used to program a 20 μL one-step RT-qPCR reaction containing qScript XLT One-Step RT-qPCR ToughMix plus Rox (QuantBio) and 0.2 μM each of the primers Fer_GAPDH FWD (5'-CAACGGATT TGGCCGTATTG-3') and Fer_GAPDH REV (5'-CTGGAA CATGTAGACCATGTAGT-3') and the TaqMan probe Fer_GAPDH PRB (5Cy5 / AGGGTCATT / TAO / GATGGCGACAATATCCAC / 3IAbRQSp / ) for amplification of the GAPDH sequence. Amplification was performed with a single cycle of 50 °C for 10 min for reverse transcription, followed by 3 min at 95 °C for DNA amplification and 45 cycles of 95 °C for 10 s and 60 °C for 30 s. The amount of GAPDH in the samples was interpolated from a standard curve generated by amplification of serial dilutions of pooled extracted ferret lung RNA (250 ng / μL). Results were processed by the 21 CFR Part 11 software module of the QuantStudio TM 6 and 7 systems and data from the RT-qPCR analysis were imported into GraphPad Prism for analysis.

[0485] 2.2.40 Quantification of virus propagation in Example 25

[0486] 2.2.40.1 Study approval

[0487] All animal experiments were approved in advance by the Animal Ethics Committee of the Danish Veterinary and Food Administration (Stationsparken 31-33, 2600 Glostrup, Denmark) and were conducted in accordance with the Danish Animal Welfare Act for the Care and Use of Animals for Scientific Purposes.

[0488] 2.2.40.2 Biosafety

[0489] All aspects of this study were approved by the Danish Working Environment Authority's office before the start of the study, located at Landskronagade 33, 2100 Copenhagen Work with SARS-CoV-2 was conducted in a biosafety level 2+ laboratory, and the staff were equipped with powered air-purifying respirators.

[0490] 2.2.40.3 Propagation of SARS-CoV-2

[0491] B.1.1.7 SARS-CoV2 (Kent, UK, isolate) was provided by Professor Arvind Patel from the University of Glasgow under an MTA. The virus used was a clinical isolate. The B.1.1.7 variant is MZ314997 in the database. The virus was propagated in VeroE6 cells expressing human TMPRSS2 (VeroE6-hTMPRSS2) (kindly provided by Professor Stefan from the University of Göttingen) (Hoffmann et al., 2020). Briefly, VeroE6-hTMPRSS2 cells were infected at a multiplicity of infection (MOI) of 0.05 in DMEM (Gibco) + 2% FCS (Sigma-aldrich) + 1% penicillin / streptomycin (Gibco) + L-glutamine (Sigma-Aldrich) (from here on, complete medium). At 72 hours post-infection, the supernatant containing the new virus progeny was collected and concentrated on a 100 kDa Amicon ultrafiltration column (Merck) by centrifugation at 4000×g for 30 minutes. The virus titer was determined by TCID50% assay and calculated using the Reed-Muench method. To convert to the average number of plaque-forming units (pfu) / mL, multiply the TCID50 / mL by a factor of 0.7 (ATCC - converting TCID

[50] to plaque-forming units (PFU)).

[0492] 2.2.40.4 Animal housing

[0493] K18-hACE c57BL / 6J mice (strain: 2B6.Cg-Tg(K18-ACE2)2Prlmn / J) were obtained from The Jackson Laboratory. Hemizygous offspring were used in the experiments. Age-matched male and female mice and a group fed a standard diet were fed a standard diet and housed in a pathogen-free facility. Mice were weighed at the same time each day until 3 days post-infection (post-infection), and the animals were killed when they lost 20% of their body weight or when they reached the humane endpoint.

[0494] Treatment of 2.2.40.5 mice

[0495] Under isoflurane anesthesia, mice were treated intranasally on the day before infection and on the day after infection with 15 μL of a prepared human IFNλ1 mRNA (7.5 μg mRNA, equivalent to 3 μg deposited in the lungs) inoculum.

[0496] 2.2.40.6 Infected mice

[0497] SARS-CoV-2 was inoculated in the same manner as the application of mRNA (15 μL aliquots were applied intranasally under isoflurane inhalation anesthesia).

[0498] 2.2.40.7 RNA isolation, real-time qPCR

[0499] Lungs were homogenized using a Tissuelyser (II) (Qiagen) with steel beads (Qiagen) in PBS and immediately used for RNA isolation. RNA was isolated using a High Pure RNA Isolation Kit (Roche), and equal amounts of RNA were used for standard one-step RT-PCR (Applied Biosystems TaqMan RNA to CT One StepKit). For SARS-CoV-2 N gene qPCR, primers AAATTTTGGGGACCAGGAAC and TGGCACCTGTGTAGGTCAAC and probe FAM-ATGTCGCGCATTGGCATGGA-BHQ were used. For IFN-β, Mx1, and β-Actin, Taqman gene expression assays (Applied Biosystems) were used. The RNA levels of the SARS-CoV-2 N gene, IFNβ, or Mx1 were normalized to the mouse housekeeping gene β-Actin using the formula 2^(Ct(18S-rRNA)-Ct(Sars-CoV-2RNA)).

[0500] 2.2.40.8 TCID50 assay

[0501] To determine the amount of infectious virus in cell culture supernatants or generated virus stocks, a limiting dilution assay was performed. 2×10 490 μL of DMEM5 was inoculated with VeroE6-TMPRRS2 cells in a 96-well plate. The next day, the sample was thawed and serially diluted 10-fold, followed by a 10-fold serial dilution using DMEM. 10 μL of each dilution was added to the cells, with 8 replicates. The cells were incubated in a humidified CO2 incubator at 37 °C with 5% CO2 for 72 hours. After fixation with 5% formalin (Sigma-Aldrich) and staining with crystal violet (Sigma-Aldrich), the cytopathic effect (CPE) was scored using an optical microscope (Leica DMi1), and the tissue culture infectious dose 50 (TCID50 / mL) was calculated using the Reed and Muench method.

Claims

1. A pharmaceutical composition comprising mRNA encoding an IFN-λ polypeptide for treating or preventing virus-induced diseases, wherein the mRNA is administered by delivery to the respiratory system, and wherein the virus-induced disease is a virus-induced respiratory disease.

2. The pharmaceutical composition according to claim 1, wherein the virus causing the virus-induced respiratory disease is selected from rhinovirus, influenza virus, parainfluenza virus, metapneumovirus, respiratory syncytial virus, adenovirus, and coronavirus.

3. The pharmaceutical composition according to claim 1 or 2, wherein the virus causing the virus-induced respiratory disease is a virus that enters cells via the ACE2 receptor.

4. The pharmaceutical composition according to claim 3, wherein the virus is SARS-CoV, SARS-CoV-2, or HCoV-NL63.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the delivery to the respiratory system is by instillation or inhalation.

6. The pharmaceutical composition according to claim 5, wherein the inhalation is inhalation of an aerosol comprising the mRNA.

7. The pharmaceutical composition according to any one of claims 1 to 6, wherein the mRNA comprises a combination of unmodified and modified nucleotides.

8. The pharmaceutical composition according to claim 7, wherein 5 to 50% of the uridine nucleotides and 5 to 50% of the cytidine nucleotides are modified uridine nucleotides and modified cytidine nucleotides, respectively, and wherein preferably the modified uridine nucleotide is 2-thiouridine and the modified cytidine nucleotide is 5-methylcytidine.

9. The pharmaceutical composition according to claim 7, wherein the modified nucleotides are selected from the following list based on their respective nucleoside residues: pseudouridine, N1-methyl-pseudouridine, 2'-fluoro-2'-deoxycytidine, 5-iodocytidine, 5-methylcytidine, 2-thiouridine, 5-iodouridine, and / or 5-methyl-uridine.

10. The pharmaceutical composition according to any one of claims 1 to 9, wherein the IFN-λ polypeptide is selected from IFNλ1, IFNλ2, and IFNλ3, or a combination thereof.

11. The pharmaceutical composition according to claim 10, wherein the coding region of the mRNA encoding IFNλ1 is as shown in SEQ ID NO:1, wherein the coding region of the mRNA encoding IFNλ2 is as shown in SEQ ID NO:3, or wherein the coding region of the mRNA encoding IFNλ3 is as shown in SEQ ID NO:

5.

12. The pharmaceutical composition according to claim 10 or 11, wherein the mRNA encoding IFNλ1 has the sequence as shown in SEQ ID NO:13, wherein the mRNA encoding IFNλ2 has the sequence as shown in SEQ ID NO:14, or wherein the mRNA encoding IFNλ3 has the sequence as shown in SEQ ID NO:

15.

13. The pharmaceutical composition used according to any one of claims 1 to 12 further comprises mRNA encoding type I interferon and / or mRNA encoding type II interferon.

14. The pharmaceutical composition used according to claim 13, wherein the type I interferon is selected from IFN-α and IFN-β, the IFN-α is preferably IFN-α16, and wherein the type II interferon is IFNγ.

15. The pharmaceutical composition used according to claim 1, wherein the virus-induced diseases include diseases caused by viruses belonging to the families Pneumoviridae, Orthomyxoviridae, Adenoviridae, Arenaviridae, Paramyxoviridae, Flaviviridae, Retroviridae, Caliciviridae, Picornaviridae, Coronaviridae, Parvoviridae, Reoviridae, Herpesviridae or Hepadnaviridae. Viruses belonging to the family Pneumoviridae include human metapneumovirus; viruses belonging to the family Orthomyxoviridae include influenza viruses; viruses belonging to the family Adenoviridae include adenoviruses; viruses belonging to the family Arenaviridae include lymphocytic choriomeningitis virus; viruses belonging to the family Paramyxoviridae include respiratory syncytial virus; viruses belonging to the family Flaviviridae include dengue virus, hepatitis C virus, Zika virus and West Nile virus; viruses belonging to the family Retroviridae include human immunodeficiency virus; viruses belonging to the family Caliciviridae include Norwalk virus; viruses belonging to the family Picornaviridae include rhinoviruses; viruses belonging to the family Coronaviridae include SARS-CoV, SARS-CoV2, MERS and HCoV-NL63, -OC43, -229E and HKU1; viruses belonging to the family Parvoviridae include bocavirus; viruses belonging to the family Reoviridae include reovirus and rotavirus; viruses belonging to the family Herpesviridae include cytomegalovirus and herpes simplex virus, such as herpes simplex virus 1 and 2; and viruses belonging to the family Hepadnaviridae include hepatitis B virus.

16. The pharmaceutical composition used according to claim 7, wherein the total percentage of modified nucleotides contained in the mRNA molecules to be purified is 0%, 2.5%, 5%, 7.5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 100%.

17. The pharmaceutical composition used according to claim 1, wherein the coding region contained in the mRNA and encoding the IFNλ protein can be a partially or fully codon-optimized sequence.

Citation Information

Patent Citations

  • RNA containing composition for treatment of tumor diseases

    CN108064176A

  • Anti-virus therapy for respiratory diseases

    US20130209399A1

  • Therapeutic RNA

    US20200147176A1

  • Interferon lambda therapy for treatment of respiratory diseases

    WO2007029041A2

  • Treatment of ciliopathies

    WO2020165352A1