Application of StTRM5 gene in improving potato tuber quality

Abstract

The present invention relates to the field of biotechnology, specifically to StTRM5 The application of genes in improving the quality of potato tubers. This invention first reveals a gene that can regulate potato tuber shape. StTRM5 Gene, targeted knockout in potato C65 StTRM5 Genes can significantly cause changes in potato shape, so StTRM5 Genes have potential application value in controlling potato shape and can be utilized in production using molecular improvement technology, providing more options for potato variety improvement.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, specifically to StTRM5 Application of genes in improving potato tuber quality. Background Art

[0002] Potatoes are the third largest food crop in the world and the fourth largest in my country. They are widely cultivated worldwide due to their cold-resistant, drought-resistant, high and stable yields, wide adaptability, and comprehensive nutrition. They are of great significance for ensuring food security in my country and the world. Tuber shape, or tuber shape, is one of the important agronomic traits of potatoes and an important basis for identifying cultivar characteristics. Existing cultivated varieties have relatively regular tuber shapes, generally round, oval, or long. Different consumer habits and processed products have different requirements for tuber shape. For example, consumers in Northeast China prefer round potato varieties, while consumers in the Central Plains and southern China prefer long potato varieties. Generally, long potato varieties are required for fried strips, while round potato varieties are required for fried chips. Therefore, breeding varieties with specific tuber shapes to meet the needs of different consumers and processing needs is of great significance for promoting the comprehensive development of the potato industry. Summary of the Invention

[0003] In view of the deficiencies of the prior art, the present invention provides a method for regulating the quality of potato tubers. StTRM5 Genes and

[0004] The protein it encodes has been shown to significantly change the shape of potatoes and can be used in potato variety improvement, providing more options for potato shape breeding.

[0005] To achieve the above object, the present invention provides a method for regulating the quality of potato tubers. StTRM5 A protein encoded by a gene, wherein the amino acid sequence of the protein is (a) or (b);

[0006] (a) a protein consisting of the amino acids shown in SEQ ID NO. 1;

[0007] (b) a derivative protein having the same function as the amino acid sequence shown in SEQ ID NO. 1, wherein one or more amino acid residues are substituted and / or deleted and / or added;

[0008] In some specific embodiments, the present invention provides a protein having an amino acid sequence that is 80% identical to the sequence shown in SEQ ID NO. 1 and has an amino acid sequence that regulates potato tuber quality; preferably, it has 85% identity, more preferably, it has 90% identity, more preferably, it has 95% identity, and most preferably, it has 99% identity.

[0009] The present invention also provides a gene encoding the above-mentioned protein, wherein the nucleotide sequence of the gene is (a), (b) or (c);

[0010] (a) the nucleotide sequence shown in SEQ ID NO. 2;

[0011] (b) a nucleotide sequence that hybridizes with and encodes the nucleotide sequence shown in SEQ ID NO. 2 under stringent conditions;

[0012] (c) a nucleotide sequence encoding a gene that has 80% or more homology to the nucleotide sequence shown in SEQ ID NO. 2.

[0013] In some specific embodiments, StTRM5 Genes can regulate changes in potato shape.

[0014] It is well known to those skilled in the art that there may be multiple different codons for the same amino acid.

[0015] Therefore, the nucleotide sequence encoding the above-mentioned protein is not limited to one type. It can be a nucleotide sequence encoding the mutant amino acid sequence of the present invention obtained by mutating one or more nucleotides of the mutant nucleotide sequence shown in SEQ ID NO. 2 to form a synonymous mutation. It can also be a nucleotide sequence encoding the mutant amino acid sequence of the present invention designed based on codon optimization.

[0016] In the present invention, the nucleic acid may be optimized or not optimized, and the present invention does not limit this.

[0017] As used herein, stringent conditions refer to conditions under which a probe hybridizes to its target sequence to a detectable degree, exceeding hybridization to other sequences. Stringent conditions are sequence-dependent and vary depending on the environment. By strictly controlling hybridization or washing conditions, target sequences that are 100% complementary to the probe can be identified. Stringent conditions can be selectively adjusted to allow for some sequence mismatches, thereby enabling detection of lower degrees of similarity.

[0018] In some specific embodiments, the present invention provides a protein whose gene nucleotide sequence has 80% identity with the sequence shown in SEQ ID NO. 2; preferably, it has 85% identity, more preferably, it has 90% identity, more preferably, it has 95% identity, and most preferably, it has 99% identity.

[0019] Recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria containing the above genes also fall within the scope of protection of the present invention.

[0020] The use of any of the above proteins, genes, recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria in potato tuber improvement and breeding also falls within the scope of protection of the present invention.

[0021] Furthermore, by knocking out StTRM5 Genes that significantly change the shape of potatoes.

[0022] Furthermore, the knockout is achieved by targeted knockout of the gene using the Crispr / Cas9 method to obtain a knockout mutant plant.

[0023] Furthermore, the target site sequences for targeted knockout are shown in the sequence listing SEQ ID NO.3 and SEQ ID NO.4.

[0024] Beneficial effect: This invention discloses for the first time a method for regulating potato shape. StTRM5 Gene, targeted knockout in potato C65 StTRM5 Genes can significantly cause changes in potato shape, so StTRM5 Genes have potential application value in controlling potato shape and can be utilized in production using molecular improvement technology, providing more options for potato variety improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 for StTRM5 Targeted knockout obtained the gene sequences of two independent deletion mutants;

[0026] Figure 2 for Sttrm5 Diagram showing the difference in tuber shape phenotype of deletion mutants;

[0027] Figure 3 for StTRM5 Detection of expression levels of transgenic lines. DETAILED DESCRIPTION

[0028] In order to enable those skilled in the art to better understand the technical solution of the present invention, the following is a detailed description of the embodiments of the present invention.

[0029] The present invention is described in detail. The experimental methods in the following examples, for which specific conditions are not specified, are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer. The test materials used in the following examples, unless otherwise specified, were purchased from conventional biochemical reagent stores. Unless otherwise specified, percentages and parts are calculated by weight. Unless otherwise defined, all professional and scientific terms used in the text have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred implementation methods and materials described herein are for demonstration purposes only.

[0030] The wild potato material C65 used in the present invention comes from the potato planting resource library of the Potato Science Research Institute of Yunnan Normal University.

[0031] Example 1 StTRM5 Construction of gene-targeted knockout mutants

[0032] Created using the CRISPR-Cas9 system in the potato material C65 background Sttrm5 mutant.

[0033] According to target gene StTRM5 The target site for knockout was designed using the cDNA of SEQ ID NO. 2. The website used was: http: / / crispr.hzau.edu.cn / cgi-bin / CRISPR2 / CRISPR; the target site sequence is as follows:

[0034] StTRM5 -F(SEQIDNO.3):5'-GGGAAACCACAGCCAAGTC-3'

[0035] StTRM5 -R(SEQIDNO.4):5'-GCTGTTCCTGTCTCGGTAG-3'

[0036] Add adapters, synthesize by a primer synthesis company, and then amplify the fragments. Use PCBC-DT1T2 as a template to amplify a terminator and promoter.

[0037] Amplification primers are:

[0038] 65-TRM-F:TCGAAGTAGTGATTGGGGAAACCACAGCCAAGTCGTTTTAGAGCTAGAAATAGC

[0039] 65-TRM-R:TTCTAGCTCTAAAACCTACCGAGACAGGAACAGCCAATCTCTTAGTCGACTCTAC

[0040] The reaction system is as follows:

[0041]

[0042] The reaction procedure is as follows:

[0043]

[0044] Will Bsa I enzyme digested the PKSE402 vector plasmid containing the Cas9 expression cassette, and the reaction system was as follows:

[0045]

[0046] The reaction procedure is:

[0047]

[0048] PCR products a and the vector plasmid after enzyme digestion b Purify and use In-Fusion ligase to ligate according to the instructions. The specific steps are as follows:

[0049] The following connection system is configured on ice:

[0050]

[0051] The reaction procedure is:

[0052]

[0053] E. coli transformation was performed using the instructions for the Weidi Bio DH5α Chemically Competent Cell product. The specific steps are as follows:

[0054] a. Remove the DH5α competent cells from −80°C and quickly place them on ice. After 5 minutes, allow the cells to thaw. Add 2.5 μL of the ligation product and gently mix by tapping the bottom of the EP tube. Place the cells on ice for 25 minutes.

[0055] b. Heat shock in a 42°C water bath for 45 seconds, then quickly return to ice and let stand for 5 minutes (shaking will reduce transformation efficiency).

[0056] c. Add 700 μL of LB without antibiotics, mix thoroughly, and incubate at 37°C, 200 rpm for 60 minutes.

[0057] d. Centrifuge at 5000 rpm for 1 min to collect the cells. Take approximately 100 μL of the supernatant, gently pipette to resuspend the cells, and spread onto an LB plate containing Kan.

[0058] e. Place the plate upside down in a 37°C incubator and incubate overnight.

[0059] Initial identification of positive clones: Use the specific primers Cas9-909F / Cas9-2450R on the vector to amplify and sequence the positive clones. Extract plasmids from the positive clones with correct sequencing and set aside.

[0060] Cas9-909F: 5'- GCAGCTCTCCAAGGACACAT-3'

[0061] Cas9-2450R: 5'-CGTGAGTCTTCTGGCCCTT-3'

[0062] Example 2 Agrobacterium-mediated genetic transformation of potato

[0063] 1. Agrobacterium Transformation

[0064] The positive plasmid was transformed into Agrobacterium using the instructions of the product of Weidi Biotechnology GV3101 (Weidi Biotechnology, AC1001). The specific operation is as follows:

[0065] (1) Thaw GV3101 competent Agrobacterium cells stored at −80°C on ice;

[0066] (2) Add 1 μL of the plasmid DNA to be transformed into every 50 μL of competent cells, mix gently, and place on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min;

[0067] (3) Add 700 μL of antibiotic-free LB liquid medium and culture at 28°C with shaking for 2 hours;

[0068] (4) Pipette about 100 μL of bacterial solution, spread it on an LB plate containing Kan, invert the plate, and culture at 28°C for 2-3 days.

[0069] (5) Colony PCR identification.

[0070] 2. Agrobacterium-mediated genetic transformation of potato

[0071] The recipient material for genetic transformation was potato C65, and the following process was involved:

[0072] (1) Pre-culture: C65 explants with axillary buds were cut and grown on MS30 (MS powder 4.3 g + sucrose 30 g + G3251 3 g) medium for 4 weeks. The stems of C65 plants grown for 4 weeks were cut into pieces of about 1 cm in size (without axillary buds). The stem segments were placed on Z1N2 (MS powder 4.3 g + sucrose 20 g + G3251 3 g + ZT 1 mg / mL + NAA 2 mg / mL, pH = 5.8) solid medium and pre-cultured under light conditions for 48 h.

[0073] (2) Co-cultivation: Activate the transformed Agrobacterium on LB solid medium and shake the culture to OD 600= 0.5, centrifuged at 4000 rpm for 10 min to collect the cells, then resuspended in MS20 liquid, and AS (40 mg / mL) was added at a dilution of 1:1000. The pre-cultured stem segments were placed in the liquid for infection for 10 min. After the bacterial liquid was drained, the stem segments were placed on Z1N2AS medium (MS powder 4.3 g + sucrose 20 g + G3251 3 g + ZT 1 mg / mL + NAA 2 mg / mL + AS 40 mg / mL) and co-cultured in the dark for 48 h.

[0074] (3) Regeneration culture: The stem segments were transplanted into differentiation medium Z2N0.01 (MS powder 4.3 g + sucrose 20 g + G32513 g + ZT 2 mg / mL + NAA 0.01 mg / mL + TMT 200 mg / mL + Kana 100 mg / mL) for differentiation culture. The culture medium was replaced every two weeks until differentiated regenerated seedlings were obtained.

[0075] 3. Sttrm5 Identification of mutants

[0076] Place leaves from rooted plants in a 2 mL centrifuge tube, add steel balls, and quickly freeze in liquid nitrogen for 2 minutes. Remove and shake vigorously in a foam box until the leaves are broken into pieces. Add 500 μL of 2x CTAB and place in a 65°C waterbath for 1 hour, shaking 2-3 times. Then, cool in a 4°C refrigerator for approximately 5 minutes, add 500 μL of chloroform, mix by inversion, and centrifuge at 12,000 rpm for 10 minutes. Pipette the supernatant into a new 1.5 mL centrifuge tube and add 500 μL of pre-chilled anhydrous ethanol. Mix by inversion, freeze in a -20°C refrigerator for 1-2 hours, centrifuge at 12,000 rpm for 10 minutes, discard the supernatant, and wash with 75% ethanol 2-3 times. Allow the resulting white precipitate to air-dry for approximately 1 hour, then add an appropriate amount of water to re-dissolve the DNA for later use.

[0077] The extracted DNA was used as a template and amplified using the following primer pairs:

[0078] TRM-test-F:TCGTAATCACATTTTAGCCGGG

[0079] TRM-test-R: GGTGACTTTGGCGGTGTC

[0080] The PCR reaction system is as follows:

[0081]

[0082] PCR amplification conditions are as follows:

[0083]

[0084] Perform gene detection on PCR products, compare sequencing results with reference sequences, and analyze target site mutations ( Figure 1 ).exist Sttrm5-cr #1 In the mutant, target site 1 had a deletion of 5 bases and an insertion of 1 base, and target site 2 had a deletion of 5 bases. Sttrm5-cr #2 In the mutant, target site 1 had an insertion of 1 base and a deletion of 2 bases, while target site 2 remained unchanged. Protein sequence analysis table

[0085] The insertion or deletion of the base pair leads to the premature occurrence of the stop codon, resulting in a small peptide of 79-81 amino acids.

[0086] Example 3 Identification of tuber shape of transgenic plants

[0087] The control group WT 、Sttrm5-cr #1 and Sttrm5-cr #2 Plant them in greenhouses and harvest tender tubers after about 2 months. Figure 2 As can be seen in Sttrm5-cr #1 and Sttrm5-cr #2 The length of the potato was significantly shortened. The length and width of the young tubers were measured. The results showed that the length-to-width ratio of the wild-type potato C65 was about 2.3. Sttrm5 The aspect ratio of the mutant is about 1.6, which is a significant difference;

[0088] Leaves of wild type WT (non-transgenic) and transgenic lines were taken respectively, and total RNA was extracted using the method of Example 2, and reverse transcribed to generate cDNA. qPCR was used to identify the transgenic lines. StTRM5 expression level.

[0089] Figure 3 As can be seen in Sttrm5-cr #1 and Sttrm5-cr #2 of StTRM5 The expression of WT was significantly decreased compared with that of wild type.

[0090] Finally, it should be noted that the above description is only a preferred embodiment of the present invention. Under the guidance of the present invention, those skilled in the art can make various similar expressions without violating the purpose and claims of the present invention. Such changes fall within the scope of protection of the present invention.

Claims

1. StTRM5 The application of a gene in changing the shape of a potato is characterized in that: Knockout as shown in SEQ ID NO. 2 StTRM5 A gene that shortens potato tuber length.

2. Application of the protein represented by SEQ ID NO. 1 in changing potato shape, characterized in that: Reducing the expression of the protein represented by SEQ ID NO. 1 shortens the length of potato tubers.

3. The use according to claim 1, characterized in that The knockout is achieved by targeted knockout of the gene using the Crispr / Cas9 method to obtain a knockout mutant plant.

4. The use according to claim 3, characterized in that The target site sequences for targeted knockout are shown in the sequence listing as SEQ ID NO.3 and SEQ ID NO.4.

Images