Lactobacillus reuteri HuYan with eye protection effect and application of lactobacillus reuteri HuYan

Abstract

The invention belongs to the technical field of probiotics, and particularly relates to lactobacillus reuteri HuYan with an eye protection effect and application of the lactobacillus reuteri HuYan. According to the invention, a novel lactobacillus reuteri HuYan strain is separated from feces of a healthy infant in Guangzhou city, Guangdong province, and the lactobacillus reuteri HuYan strain can significantly reduce vascular hyperplasia and cell apoptosis of eyes, inhibit eye shrinkage, reduce the number of neutrophils in the eyes, reduce the content of levodopa and increase the content of levo5-hydroxytryptamine. Therefore, the strain can be applied to prevention and treatment of eye vascular dysplasia related diseases, protection of intraocular cells to avoid apoptosis, improvement or prevention of eye shrinkage and alleviation of eye inflammation, has positive significance in protection of eye tissues and maintenance of normal physiological status of eyes, is expected to be used in the fields related to prevention and treatment of eye diseases, and has wide application prospects. Wide application prospects are realized in the field of treating and preventing eye diseases.

Description

Technical Field

[0001] The invention belongs to the technical field of probiotics, and particularly relates to a strain of Lactobacillus reuteri HuYan with eye protection effect and application thereof. Background Art

[0002] The word probiotics originated from Greek. As people's understanding of probiotics deepens, keywords such as regulating intestinal flora, native bacteria, live microorganisms, and the number of live bacteria have also been incorporated into the concept of probiotics. At present, the widely accepted definition of probiotics is the United Nations Food and Agriculture Organization / World Health Organization, that is, active microorganisms that have a beneficial effect on the host when administered in sufficient quantities. Probiotics and their lysates have also been proven to provide beneficial effects to the human body in recent years.

[0003] Visual fatigue, or eye fatigue, is a common eye disease. The dry eyes, sore eyes, blurred vision and even decreased vision caused by it directly affect people's work and life. Eye fatigue is mainly caused by the fact that when people concentrate on watching TV, computer or mobile phone screens, the number of blinks decreases, resulting in a corresponding decrease in tear secretion, and the flickering screen strongly stimulates the eyes. Eye fatigue can also cause and aggravate various eye diseases. Modern people's work, life and leisure style have brought about the problem of excessive eye use, and visual fatigue often troubles students and office workers. The best way to relieve eye fatigue is to let the eyes rest. However, intense study and work usually do not allow the eyes to get enough rest. A series of products that protect the eyes and relieve visual fatigue have emerged. However, most products that relieve visual fatigue are eye drops and eye patches, which only bring short-term relief to visual fatigue, while probiotics can colonize in the intestines and have a lasting effect. However, probiotics are strain-specific, and not all probiotic strains have the effect of relieving visual fatigue and preventing eye cell apoptosis.

[0004] Limosilactobacillus reuteri belongs to the family Lactobacillaceae and is a Gram-positive bacterium that exists widely in nature, such as in the human gastrointestinal tract, oral cavity, breast milk, and various fermented foods. In recent years, the research on Limosilactobacillus reuteri has gradually increased, and it has been found to have a variety of unique biological characteristics and probiotic functions. For example, Limosilactobacillus reuteri can produce a unique antibacterial substance - reuterin, which has broad-spectrum antibacterial activity and can inhibit a variety of pathogenic bacteria such as Escherichia coli and Staphylococcus aureus, helping to maintain the balance of the intestinal microecology. At the same time, studies have shown that Limosilactobacillus reuteri also has potential probiotic effects in regulating the immune system, improving intestinal barrier function, and reducing cholesterol levels. However, the current research on Limosilactobacillus reuteri is still in a relatively preliminary stage, and there is currently no research on the application of Limosilactobacillus reuteri in relieving eye fatigue.

[0005] In summary, based on the current difficult-to-cure problem of eye fatigue, and the probiotic characteristics vary at the strain level, and there are differences in the efficacy and mechanism of action of different strains of the same species of probiotics, screening for probiotic strains with outstanding eye protection effects and clear mechanisms of action is still the difficulty and focus of current research. Summary of the Invention

[0006] In order to overcome the deficiencies of the above-mentioned prior art, the present invention isolates a strain of Limosilactobacillus reuteri HuYan from the feces of a healthy infant in Guangzhou City, Guangdong Province. This strain has the effect of protecting eyesight and has broad application prospects in the field of treating and preventing eye diseases.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a strain of Limosilactobacillus reuteri HuYan, which is isolated from the feces of a healthy infant in Guangzhou City, Guangdong Province, and its deposit number is CCTCC NO: M 20242200.

[0009] Preferably, the 16S rDNA of the Limosilactobacillus reuteri HuYan strain is as shown in SEQ ID No: 1.

[0010] The second aspect of the present invention provides the use of the Limosilactobacillus reuteri HuYan strain in the preparation of eye care products.

[0011] Preferably, the eye care products are applicable to eye damage diseases caused by apoptosis of eye cells.

[0012] Preferably, the eye care is to reduce eye vascular hyperplasia, apoptosis, inhibit eye shrinkage, reduce the number of neutrophils in the eyes, reduce the content of levodopa, and increase the content of 5-hydroxytryptamine.

[0013] Preferably, the product includes pharmaceuticals or health foods.

[0014] The third aspect of the present invention provides a probiotic agent, which uses the Limosilactobacillus reuteri HuYan strain as the main active ingredient.

[0015] Preferably, in the agent, the number of HuYan strains is not less than 10 6 CFU / mL.

[0016] Preferably, the agent further includes excipients acceptable in the pharmaceutical or food field.

[0017] Preferably, the agent of the present invention can be a liquid agent or a solid agent, and can be prepared by adding excipients allowed in the field of microbial agents using conventional technical means.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] A new Limosilactobacillus reuteri HuYan strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. Through the construction of a zebrafish eye injury model by DBP, it was found that this bacterium could significantly reduce eye vascular hyperplasia, cell apoptosis, inhibit eye shrinkage, reduce the number of neutrophils in the eyes, lower the content of levodopa, and increase the content of left 5-hydroxytryptamine. It shows that the Limosilactobacillus reuteri HuYan strain can be applied to the prevention and treatment of diseases related to abnormal hyperplasia of eye blood vessels, protect intraocular cells from apoptosis, improve or prevent eye shrinkage problems, and reduce ocular inflammation. At the same time, this strain can lower the content of levodopa, avoid its excessive conversion into dopamine and interfere with the normal function of the retina, and maintain the stability of physiological activities in the retina. It can also increase the content of left 5-hydroxytryptamine, enhance the stability and anti-injury ability of retinal nerve cells, facilitate the normal regulation of intraocular pressure, reduce the risk of eye diseases, thus playing a role in protecting the eyes, which has a positive significance for protecting eye tissues and maintaining the normal physiological state of the eyes, and is expected to be used in the fields of prevention and treatment of eye diseases, such as developing probiotic functional products related to eye protection, and has broad application prospects in the fields of treatment and prevention of eye diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the phylogenetic tree of Limosilactobacillus reuteri HuYan strain (the tree-building strains are from the Genome database of NCBI);

[0021] Figure 2 It is the intuitive diagram (A) and statistical chart (B) of the effect of Limosilactobacillus reuteri HuYan on zebrafish eye angiogenesis (n = 6);

[0022] Figure 3 It is the intuitive diagram (A) and statistical chart (B) of the effect of Limosilactobacillus reuteri HuYan on zebrafish eye cell apoptosis (n = 6);

[0023] Figure 4 It is the intuitive diagram (A) and statistical chart (B) of the effect of Limosilactobacillus reuteri HuYan on zebrafish eye size (n = 6);

[0024] Figure 5 It is the intuitive diagram (A) and statistical chart (B) of the effect of Limosilactobacillus reuteri HuYan on the number of neutrophils in zebrafish eyes (n = 6);

[0025] Figure 6 It is the effect of Limosilactobacillus reuteri HuYan on the content of levodopa (A) and 5-HT (B) in zebrafish. DETAILED DESCRIPTION OF THE INVENTION

[0026] The following further describes the specific embodiments of the present invention. It should be noted here that the description of these embodiments is used to help understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] In the following experimental methods of the examples, unless otherwise specified, they are all conventional methods. The test materials used in the following examples, unless otherwise specified, can all be obtained through conventional commercial channels.

[0028] In the following examples, the E3 culture water was prepared as follows: Weigh 11.7 g of sodium chloride, 0.506 g of potassium chloride, 1.465 g of anhydrous magnesium sulfate, and 1.584 g of anhydrous calcium chloride and mix them. Then add an appropriate amount of pure water and stir evenly, and then add an appropriate amount of pure water to dilute to 4 L to obtain 10×E3 culture water. Store at room temperature for no more than 7 days (the reagents used for preparation are all analytical pure reagents, all purchased from Macklin, and the conductivity of pure water should be less than or equal to 10 us / cm). When in use, measure 400 mL of the 10×E3 culture water prepared in the previous step into a suitable container, and add 3.6 L of pure water and stir evenly.

[0029] In the following examples, the bacterial liquid, the drugs used in the positive group, and the drugs used to establish the model were all diluted to the corresponding concentrations with E3 culture water.

[0030] Example 1: Obtaining of Limosilactobacillus reuteri HuYan

[0031] The Limosilactobacillus reuteri HuYan strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province. The specific method is as follows:

[0032] Collect fresh feces using a 50 mL sterile centrifuge tube, transport them to the laboratory under cold chain, and after surface disinfection, transfer the sample to a biosafety cabinet. Add an appropriate amount of sterile water according to the feces quality for sufficient dissolution (usually 100 mg of feces plus 800 uL - 1 mL of sterile water). Take an appropriate amount of the sample and spread it on an MRS culture plate, and culture it at 37°C in an anaerobic workstation. After 48 h, pick a single colony and inoculate it onto a new MRS culture plate, and culture it in the anaerobic workstation for 24 h. Refer to "Bergey's Manual of Determinative Bacteriology" (Eighth Edition) and "Manual of Fungal Taxonomic Identification" to observe the colony growth status. Name the purified and isolated strain, numbered HuYan. The growth status of this strain is that the colony is round, with a smooth surface, neat edges, and is milky white and opaque.

[0033] The isolated HuYan strain was cultured on a large scale and molecularly identified by using 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGACTT). Then, 16S sequencing was performed by GenScript Biotech Corporation, and the obtained 16S rDNA sequence (SEQ ID No: 1) was subjected to BLAST alignment in the Genome database of NCBI. The results showed that the homology of the HuYan strain with the 16S rDNA sequence of the known Limosilactobacillus reuteri was >99%, and a phylogenetic tree was constructed with homologous strains for analysis ( Figure 1 ), confirming that HuYan was a different strain of Limosilactobacillus reuteri of the same species.

[0034] Finally, the HuYan strain was preserved, and the preservation information was as follows: Preservation time: October 14, 2024; Name of the preservation unit: China Center for Type Culture Collection (CCTCC); Preservation number: CCTCC NO: M 20242200; Address of the preservation unit: Wuhan University, Wuhan, China; Taxonomic name: Limosilactobacillus reuteri.

[0035] Limosilactobacillus reuteri HuYan 16S rDNA sequence (1459bp, SEQ ID No: 1):

[0036]

[0037]

[0038] Example 2: Study on the probiotic function of Limosilactobacillus reuteri HuYan

[0039] Dibutyl phthalate (DBP), as a typical plasticizer, exerts toxic effects on the eyes through pathways such as oxidative damage, abnormal gene expression regulation, and mitochondrial dysfunction.

[0040] Zebrafish has a genome similarity of up to 87% with humans and has advantages such as in vitro fertilization, embryonic development, and a large egg production, making it a commonly used model organism. DBP exposure in zebrafish embryos has been confirmed to be related to the impairment of eye morphogenesis during the embryonic development stage. Herein, this example used DBP to construct a zebrafish eye injury model (an eye injury disease caused by apoptosis of eye cells) to evaluate the eye protection efficacy of the test substance.

[0041] 1. Test Materials

[0042] 1.1 Test System

[0043] The zebrafish used in this example for testing are wild-type AB strain zebrafish (purchased from Nanjing Yishulihua Biotechnology Co., Ltd.), transgenic fluorescent zebrafish Tg(fli1:EGFP) for labeling blood vessels (constructed by Nanjing Yishulihua Biotechnology Co., Ltd.), and transgenic fluorescent zebrafish Tg(mpx:EGFP) for labeling neutrophils (constructed by Nanjing Yaoshunyu Biotechnology Co., Ltd.).

[0044] 1.2 Reagents

[0045] Table 1 Reagents and Materials

[0046]

[0047]

[0048] 1.3 Main Equipment

[0049] Table 2 Instruments and Equipment

[0050]

[0051] 1.4 Test Article Information

[0052] For this detection, there is a total of 1 test article, and the details are shown in Table 3.

[0053] Table 3 Test Article Information

[0054]

[0055] 2. Test Methods

[0056] 2.1 Effect of Lactobacillus reuteri HuYan on Ocular Angiogenesis

[0057] (1) Experimental Grouping: Normal Group, Model Group, Lactobacillus reuteri HuYan Groups with 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL.

[0058] (2) Model Construction and Intervention: Select transgenic fluorescent zebrafish Tg(fli1:EGFP) at 2 dpf for labeling blood vessels and place them in a cell culture plate. Add E3 culture water to the normal group, add DBP to the model group, and add the bacterial solution containing DBP at the corresponding concentration to the Lactobacillus reuteri HuYan groups, and place them in an incubator at 28.5°C for 24 h of intervention.

[0059] (3) Eye blood vessels: After the intervention, the zebrafish were placed under a fluorescence microscope for photographing and observation of the eye blood vessels, and the fluorescence area was calculated using Image J software.

[0060] 2.2 Effects of Lactobacillus reuteri HuYan on eye size and apoptosis

[0061] (1) Experimental grouping: Normal group, model group, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus reuteri HuYan group.

[0062] (2) Model construction and intervention: Select wild-type AB strain zebrafish at 2 dpf and place them in a cell culture plate. The normal group was added with E3 culture water, the model group was added with DBP, and the Lactobacillus reuteri HuYan group was added with the bacterial solution containing DBP at the corresponding concentration, and they were placed in an incubator at 28.5 °C for 24 h of intervention.

[0063] (3) Eye size: After the intervention, the zebrafish were placed under a stereomicroscope for photographing and observation of the eye size, and the eye area was calculated using Image J software.

[0064] (4) Eye cell apoptosis: After the intervention, discard the solution in the well, add acridine orange staining solution and incubate for 30 min. After staining, wash twice with E3 culture water. The zebrafish were placed under a fluorescence microscope for photographing and observation of the eye cell apoptosis, and the fluorescence intensity was calculated using Image J software.

[0065] 2.3 Effects of Lactobacillus reuteri HuYan on eye inflammation

[0066] (1) Experimental grouping: Normal group, model group, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus reuteri HuYan group.

[0067] (2) Model construction and intervention: Select Tg(mpx:EGFP) transgenic fluorescent zebrafish labeled with neutrophils at 2 dpf and place them in a cell culture plate. The normal group was added with E3 culture water, the model group was added with DBP, and the Lactobacillus reuteri HuYan group was added with the bacterial solution containing DBP at the corresponding concentration, and they were placed in an incubator at 28.5 °C for 24 h of intervention.

[0068] (3) Number of eye neutrophils: After the intervention, the zebrafish were placed under a fluorescence microscope for photographing and observation of the number of eye neutrophils.

[0069] 2.4. Effects of Lactobacillus mucosae HuYan on levodopa and left 5-hydroxytryptamine (5-HT)

[0070] (1) Experimental grouping: normal group, model group, 10 4 CFU / mL, 10 5 CFU / mL, 10 6 CFU / mL Lactobacillus mucosae HuYan group.

[0071] (2) Model construction and intervention: Select wild-type zebrafish at 3 dpf and place them in a 6-well cell culture plate. The normal group was added with E3 culture water, the model group was added with DBP, and the Lactobacillus mucosae HuYan group was added with the bacterial solution containing DBP at the corresponding concentration, and then intervened in an incubator at 28.5 °C for 24 h.

[0072] (3) Detection of levodopa and 5-HT contents: After the intervention, the zebrafish were collected into a centrifuge tube, added with PBS for homogenization, and after centrifugation, the supernatant was taken, and the contents of levodopa and 5-HT were detected by LC / MC method.

[0073] 2.5. Data analysis

[0074] All data were statistically analyzed using GraphPad Prism 10, and the experimental data were expressed as mean±SEM. Analyzed by T-test: compared with the normal group, # P<0.05, ## P<0.01, ### P<0.001; analyzed by one-way ANOVA, compared with the model group: * P<0.05, ** P<0.01, *** P<0.001.

[0075] 3. Experimental results

[0076] 3.1. Effects of Lactobacillus mucosae HuYan on angiogenesis in zebrafish eyes

[0077] Based on the above test methods, the effects of Lactobacillus mucosae HuYan on angiogenesis in zebrafish eyes are as Figure 2 shown in and Table 4.

[0078] As Figure 2 shown in and Table 4, compared with the normal group, the area of blood vessel distribution in the eyes of the model group increased extremely significantly (P<0.001), indicating that the zebrafish eye injury model was successfully constructed in this experiment. Compared with the model group, the area of blood vessel distribution in the eyes of the zebrafish in the 10 4 CFU / mL Lactobacillus mucosae HuYan group decreased but there was no statistical difference (P>0.05); 10 5CFU / mL and 10 6 The area of blood vessel distribution in the eyes of zebrafish in the HuYan group of Lactobacillus mucosae Roy was significantly reduced (P < 0.001).

[0079] Table 4 Statistical table of the effect of Lactobacillus mucosae Roy HuYan on angiogenesis in zebrafish eyes (n = 6)

[0080]

[0081] 3.2. Effect of Lactobacillus mucosae Roy HuYan on apoptosis of zebrafish eye cells

[0082] Based on the above test method, the effect of Lactobacillus mucosae Roy HuYan on apoptosis of zebrafish eye cells is as Figure 3 shown in and Table 5.

[0083] The fluorescence intensity of apoptotic cells in the eye is proportional to the number of apoptotic cells. From Figure 3 and Table 5, it can be seen that compared with the normal group, the number of apoptotic cells in the eyes of zebrafish in the model group increased extremely significantly (P < 0.001), indicating that the zebrafish eye injury model was successfully constructed. Compared with the model group, the number of apoptotic cells in the eyes of zebrafish in the 10 4 CFU / mL, 10 5 CFU / mL, and 10 6 CFU / mL Lactobacillus mucosae Roy HuYan groups decreased extremely significantly (P < 0.001).

[0084] Table 5 Statistical table of the effect of Lactobacillus mucosae Roy HuYan on apoptosis of zebrafish eye cells (n = 6)

[0085]

[0086] 3.3. Effect of Lactobacillus mucosae Roy HuYan on the size of zebrafish eyes

[0087] Based on the above test method, the effect of Lactobacillus mucosae Roy HuYan on the size of zebrafish eyes is as Figure 4 shown in and Table 6.

[0088] From Figure 4 and Table 6, it can be seen that compared with the normal group, the eyes of zebrafish in the model group were extremely significantly reduced (P < 0.001), indicating that the zebrafish eye injury model was successfully constructed. Compared with the model group, 10 4 CFU / mL and 10 5 CFU / mL Lactobacillus mucosae Roy HuYan groups inhibited the reduction of zebrafish eyes but there was no statistical difference (P > 0.5), 10 6The inhibition of Lactobacillus mucosae HuYan in CFU / mL on the eye shrinkage of zebrafish was statistically significant (P < 0.5).

[0089] Table 6 Statistical table of the effect of Lactobacillus mucosae HuYan on the eye size of zebrafish (n = 6)

[0090]

[0091] 3.4. Effect of Lactobacillus mucosae HuYan on the number of neutrophils in the eyes of zebrafish

[0092] Based on the above test method, the effect of Lactobacillus mucosae HuYan on the number of neutrophils in zebrafish is as Figure 5 shown in Table 7.

[0093] As Figure 5 and Table 7 show, compared with the normal group, the number of neutrophils in the eyes of zebrafish in the model group increased significantly (P < 0.01), indicating that the zebrafish eye injury model was successfully constructed. Compared with the model group, the number of neutrophils in the eyes of zebrafish in the 10 4 CFU / mL, 10 5 CFU / mL, and 10 6 CFU / mL Lactobacillus mucosae HuYan groups all decreased and were statistically significant (P < 0.05).

[0094] Table 7 Statistical table of the effect of Lactobacillus mucosae HuYan on the number of neutrophils in the eyes of zebrafish (n = 6)

[0095]

[0096] 3.5. Effect of Lactobacillus mucosae HuYan on the contents of levodopa and left 5-hydroxytryptamine (5-HT) in zebrafish

[0097] Based on the above test method, the effect of Lactobacillus mucosae HuYan on the contents of levodopa and 5-HT in zebrafish is as Figure 6 shown in Table 8.

[0098] As Figure 6As can be seen from Table 8, the levodopa content in the model group (26.270±0.131) was significantly higher than that in the normal group (6.637±0.380); while the levodopa content in the three Lactobacillus reuteri HuYan groups was lower than that in the model group, and with the increase of the bacterial concentration, the levodopa content gradually decreased, indicating that Lactobacillus reuteri HuYan has the effect of reducing the levodopa content. At the same time, the 5-HT content in the model group (6.290±0.500) was significantly lower than that in the normal group (20.050±0.624); the 5-HT content in the three Lactobacillus reuteri HuYan groups was higher than that in the model group, and with the increase of the bacterial concentration, the 5-HT content gradually increased, indicating that Lactobacillus reuteri HuYan has a positive effect on increasing the 5-HT content.

[0099] Table 8 Statistical table of the effects of Lactobacillus reuteri HuYan on the levodopa and 5-HT contents in zebrafish (n = 6)

[0100]

[0101] In summary, Lactobacillus reuteri HuYan at a concentration of 10 6 CFU / mL can significantly reduce the angiogenesis, apoptosis of cells in the eyes of zebrafish, inhibit the shrinkage of zebrafish eyes, reduce the number of neutrophils in zebrafish eyes, decrease the levodopa content, and increase the 5-hydroxytryptamine content. The above test results indicate that the newly screened Lactobacillus reuteri HuYan of the present invention has the effect of protecting eyes.

[0102] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principle and spirit of the present invention, various changes, modifications, substitutions and variations to these embodiments still fall within the protection scope of the present invention.

Claims

1. A Limosilactobacillus reuteri HuYan strain, characterized in that, The Limosilactobacillus reuteri HuYan strain was isolated from the feces of a healthy infant in Guangzhou, Guangdong Province, and its deposit number is CCTCC NO: M 20242200.

2. A strain of Limosilactobacillus reuteri HuYan according to claim 1, characterized in that, The 16S rDNA of the Limosilactobacillus reuteri HuYan strain is as shown in SEQ ID No:

1.

3. Use of the Limosilactobacillus reuteri HuYan strain according to claim 1 or 2 in the preparation of an eye care product.

4. The application according to claim 3, characterized in that The eye care product is applicable to eye damage diseases caused by apoptosis of eye cells.

5. The application according to claim 3, characterized in that The eye care is to reduce eye blood vessel hyperplasia, apoptosis of cells, inhibit eye shrinkage, reduce the number of neutrophils in the eyes, reduce the content of levodopa, and increase the content of 5-hydroxytryptamine.

6. The application according to claim 3, characterized in that, The product includes a medicament or a health food.

7. A probiotic agent, characterized in that, The bacterial agent uses the Limosilactobacillus reuteri HuYan strain according to claim 1 or 2 as the main active ingredient.

8. A probiotic agent according to claim 7, wherein In the said microbial agent, the number of HuYan strains is not less than 10 6 CFU / mL.

9. A probiotic agent according to claim 7, wherein The bacterial agent further includes excipients acceptable in the pharmaceutical or food field.

Images