Biocontrol strain HTBS01 for preventing and treating branch and trunk diseases of malus micromalus as well as screening method and application of biocontrol strain HTBS01

Abstract

The invention provides a biocontrol strain HTBS01 for preventing and treating malus micromalus branch and trunk diseases as well as a screening method and application of the biocontrol strain HTBS01. The biocontrol strain HTBS01 belongs to bacillus subtillis, the preservation number is CGMCC (China General Microbiological Culture Collection Center) No.24547, and the biocontrol strain HTBS01 can be used for preventing and treating malus micromalus branch and trunk diseases such as ring spot, rough skin disease, rot disease and the like. An indoor antagonism test proves that the inhibition rate of the biocontrol strain HTBS01 on malus micromalus ring spot and barks pathogenic bacteria reaches 90% or above, and the inhibition rate of the biocontrol strain HTBS01 on rot pathogenic bacteria is 66.67%; a woodland biocontrol test shows that the biocontrol strain HTBS01 has the control effect of 18%-38% on the malus micromalus of different tree ages and has the control effect of 47%-50% on the rot disease. The biocontrol strain HTBS01 provided by the invention can reduce pesticide use, is safe and non-toxic, and realizes dual purposes of prevention and treatment of malus micromalus branch and trunk diseases.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and particularly relates to a biocontrol strain HTBS01 for preventing and controlling the trunk diseases of Malus micromalus, and a screening method and application thereof. Background Art

[0002] Malus micromalus, a plant of Magnoliopsida, Rosaceae, and Malus, is a traditional famous flower unique to China. Its tree posture is upright, and its flower color is bright. It is an excellent early spring flower and occupies an important position in Chinese garden landscaping. Its application has been recorded as early as the Spring and Autumn Period and the Warring States Period. In China, the crabapple culture contains profound social, artistic, scientific and other connotations. The crabapple is widely used in literary masterpieces, ancient paintings, poems and plant landscaping, with a strong humanistic color. At present, in the daily maintenance of Malus micromalus, especially the trunk diseases are not easy to control, which is called the "cancer of crabapple". Diseases such as canker, ring rot, and rough bark disease are all weakly parasitic fungi, mainly damaging the trunk cortex. The pathogens spread and invade from places such as dead stumps, pruning saw cuts, wounds, and dead buds, causing diseases. The tree trunk is covered with scars, the crown is incomplete or even the tree dies, seriously affecting the landscape. In addition, since Malus micromalus is an excellent standard apple rootstock, as well as a good material for potted plants and cut flowers, it is widely planted and is one of the five major cultivated species of Malus. Therefore, strengthening the etiological research and prevention and control of the trunk diseases of Malus micromalus is beneficial to improving the overall health level and application effect of Malus plants.

[0003] The pathogen of the trunk canker of Malus micromalus is Valsa mali, belonging to the genus Valsa of Ascomycotina. Its anamorph is Cytospora of Deuteromycotina. It is a weakly parasitic fungus with the characteristic of latent infection. The crabapple branches that appear healthy may already have the pathogen invading and colonizing, but when the branches are healthy, the pathogen is in a latent state. Only when the bark loses its vitality, the pathogen spreads and causes the bark to rot. The canker disease occurs most severely during the dormancy period of crabapple. In early spring, as the temperature rises, the spread accelerates and enters the peak incidence period. The bark of the diseased part changes from the normal grayish green to reddish brown, slightly bulges, is water-soaked, slightly elastic, and then the cortex rots, exuding reddish brown mucus, showing a wet rot state. The pathogen of the trunk ring rot of Malus micromalus is Botryosphaeria. After infection, a large number of tumor-like protrusions often appear. These diseased spots are connected, resulting in rough bark and trunk necrosis. The trunk rough bark disease of Malus micromalus is a newly discovered trunk disease that occurs and spreads rapidly. It has been found on plants of different tree ages. This disease shows typical tumor protrusions on the trunk. As the number of disease tumors increases and cracks, it finally develops into a rough bark symptom, causing the tree vigor to decline, and the chemical control effect is not good.

[0004] In order to prevent and control the trunk diseases of Malus micromalus, chemical fungicides are mainly used in production, so a large amount of pesticides, funds and labor are required every year. Due to the long-term use of fungicides, the pathogenic bacteria have developed drug resistance, making it more difficult to control the diseases. Moreover, the long-term and large-scale use of chemical pesticides will inevitably cause environmental pollution and endanger human health. Therefore, it has become an urgent task to seek a new method that is safe, non-toxic and effective in controlling the trunk diseases of Malus micromalus. At present, the research reports on biocontrol bacteria, which are substitutes for chemical agents, in the academic community are increasing year by year. It is an inevitable trend to use biocontrol bacteria for biological control of diseases. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a biocontrol strain HTBS01 for preventing and controlling the trunk diseases of Malus micromalus, its screening method and application, aiming at the deficiencies of the above-mentioned existing technologies, so as to achieve the dual purposes of preventing and treating the trunk diseases of Malus micromalus.

[0006] To solve the above technical problem, the technical solution adopted by the present invention is: a biocontrol strain HTBS01 for preventing and controlling the trunk diseases of Malus micromalus, wherein the biocontrol strain HTBS01 belongs to Bacillus subtilis, and the preservation number is: CGMCC No. 24547.

[0007] The present invention also provides a screening method for the biocontrol strain HTBS01 for preventing and controlling the trunk diseases of Malus micromalus, and the method comprises the following steps:

[0008] S1. Surface disinfection of samples: Take the healthy tissue samples of the trunks of Malus micromalus in different seasons for surface disinfection respectively to obtain the disinfected samples;

[0009] S2. Sample grinding and separation: Put the disinfected samples obtained in S1 into a sterilized mortar, add sterilized quartz sand and sterile water for sufficient grinding, take the grinding juice, add sterile water and mix evenly, then let it stand to obtain a sample solution;

[0010] S3. Gradient dilution: Gradiently dilute the sample solution obtained in S2 with sterile water to obtain a dilution;

[0011] S4. Plate coating and culture: Take the dilution obtained in S3 and coat it on a nutrient agar plate, culture it under the condition of a temperature of 28°C - 30°C. After colonies grow on the plate, pick single colonies, and obtain the strain HTBS01 after streaking and purification.

[0012] Preferably, in S1, the surface disinfection is to disinfect with 75% (v / v) alcohol for 30s - 60s, then treat with 1.0% (m / m) NaClO solution for 10min - 15min, and finally rinse three times with sterile water.

[0013] Preferably, the gradient dilution concentration in S3 is 1×10 -2 ~1×10 -9 .

[0014] The present invention also provides an application of the biocontrol strain HTBS01 in controlling the trunk diseases of Malus micromalus Makino.

[0015] Preferably, the trunk diseases of Malus micromalus Makino include apple bark canker, apple valsa canker and apple ring rot.

[0016] Preferably, when the biocontrol strain HTBS01 is used to control the trunk diseases of Malus micromalus Makino, it is made into a spore suspension or powder.

[0017] Preferably, the spore suspension is prepared by the following method: inoculate the strain HTBS01 into a beef extract liquid medium, and shake and culture at a temperature of 30°C - 32°C and a rotation speed of 180 rpm - 200 rpm for 36 h - 48 h. After observing the formation of spores, centrifuge at 5000 rpm - 8000 rpm for 3 min - 5 min, collect the precipitate, and suspend the precipitate with sterile water to obtain a spore suspension with a spore concentration of not less than 1×10 9 CFU / mL.

[0018] Preferably, the powder is prepared by the following method: adsorb and dry the spore suspension with peat or calcium powder.

[0019] The present invention has remarkable technical effects compared with the prior art:

[0020] 1. The biocontrol strain HTBS01 isolated and purified from the healthy tissues of Malus micromalus Makino in the present invention belongs to Bacillus subtilis in the genus Bacillus, and can control trunk diseases of Malus micromalus Makino such as apple ring rot, apple bark canker and apple valsa canker. The indoor antagonism test proves that the inhibitory rate of the biocontrol strain HTBS01 against the pathogens of apple ring rot and apple bark canker of Malus micromalus Makino reaches more than 90%, and the inhibitory rate of the strain HTBS01 against the pathogen of apple valsa canker of Malus micromalus Makino is 66.67%; the results of the field biocontrol test show that the control effect of the biocontrol strain HTBS01 preparation on apple bark canker of Malus micromalus Makino with different tree ages is 18% - 38%, and the control effect on apple valsa canker of Malus micromalus Makino with different tree ages is 47% - 50%.

[0021] 2. The biocontrol strain HTBS01 provided by the present invention can reduce the use of pesticides, is safe and non-toxic, and realizes the dual purposes of preventing and treating the trunk diseases of Malus micromalus Makino.

[0022] The present invention will be further described in detail below with reference to the drawings and embodiments. Description of the Drawings

[0023] Figure 1 It is the phylogenetic tree constructed based on the gyrA gene sequence of strain HTBS01 and other Bacillus subtilis strains in Example 1 of the present invention;

[0024] Figure 2 It is the effect diagram of the inhibitory effect of the biocontrol strain HTBS01 on the pathogen of ring rot of Malus micromalus in Example 4 of the present invention. Among them, the left side is the blank control, and the right side is the inoculated strain HTBS01;

[0025] Figure 3 It is the effect diagram of the inhibitory effect of the biocontrol strain HTBS01 on the pathogen of rough bark disease of Malus micromalus in Example 4 of the present invention. Among them, the left side is the blank control, and the right side is the inoculated strain HTBS01;

[0026] Figure 4 It is the effect diagram of the inhibitory effect of the biocontrol strain HTBS01 on the pathogen of canker of Malus micromalus in Example 4 of the present invention. Among them, the left side is the blank control, and the right side is the inoculated strain HTBS01. Detailed implementation manners

[0027] Example 1

[0028] This example is for the acquisition and identification of strains.

[0029] (1) Acquisition of strains

[0030] Samples of healthy tissues of the branches of Malus micromalus in different seasons were collected in the Summer Palace. The samples were surface disinfected, disinfected with 75% (v / v) alcohol for 30 s, then treated with 1.0% (w / v) NaClO solution for 10 min, and finally rinsed three times with sterile water; 10 g of the surface-disinfected samples were put into a sterilized mortar, added with a small amount of sterilized quartz sand and 90 mL of sterile water, and ground thoroughly. 1 mL of the ground juice was taken and added to a centrifuge tube containing 9 mL of sterile water, mixed evenly and allowed to stand; after standing, it was diluted successively with sterile water according to the gradient concentrations of 1×10 -2 、1×10 -3 、1×10 -4 、1×10 -5 、1×10 -6 、1×10 -7 、1×10 -8 and 1×10 -9 . 100 μL of the diluted solutions with different concentrations were taken and spread on nutrient agar plates, 3 plates were spread for each concentration gradient, and cultured at 30 °C. After the colonies grew on the plates, single colonies were picked according to the morphological characteristics of the colonies, and after streaking and purification, biocontrol strains were obtained and stored in 25% glycerol tubes at -20 °C.

[0031] (2) Strain identification method

[0032] Using the genomic DNA of the biocontrol strain as a template, the gyrA gene fragment of the strain was amplified by PCR. The primer sequences were gyrA-42F: CAGTCAGGAAATGCGTACGTCCTT (SEQ ID NO.1) and gyrA-1066R: CAAGGTAATGCTCCAGGCATTGCT (SEQ ID NO.2).

[0033] The PCR reaction system was as follows:

[0034] Table 1 PCR reaction system

[0035] 2× TaqMix 12.5 μL Forward primer 63F 1 μL Reverse primer 1387R 1 μL DNA template 1 μL <![CDATA[ddH2O]]> 9.5 μL Total volume 25 μL

[0036] The PCR reaction procedure was as follows:

[0037] Table 2 PCR reaction procedure

[0038]

[0039] The size of the target band of the PCR amplification product was detected by 1% agarose gel electrophoresis to check if it was correct; the PCR amplification product was sent to Sangon Biotech Co., Ltd. for sequencing, and the gyrA gene fragment of the strain was obtained, with a length of 928 bp, and the sequence was as shown in SEQ ID NO.3.

[0040] SEQ ID NO.3:

[0041] TGTGTCTCGTGCTCTTCCAGATGTTCGTGACGGTTTAAAACCGGTTCACAGACGGATTTTATACGCAATGAATGATTTGGGCATGACAAGTGACAAACCTTATAAAAAATCCGCGCGTATCGTTGGAGAAGTTATCGGGAAATACCACCCGCACGGTGATTCAGCGGTATATGAATCCATGGTCAGAATGGCTCAGGATTTCAACTACCGTTATATGCTCGTTGACGGTCACGGAAACTTCGGTTCTGTTGACGGAGACTCAGCGGCGGCCATGCGTTATACAGAAGCAAGAATGTCTAAAATCTCAATGGAGATTCTTCGTGACATCACAAAAGACACAATCGATTACCAGGATAACTATGACGGGTCAGAAAGAGAACCTGTCGTTATGCCTTCAAGGTTCCCGAATCTGCTCGTGAACGGTGCTGCCGGCATTGCGGTAGGTATGGCAACAAACATTCCTCCGCACCAGCTGGGAGAAATCATTGACGGTGTACTTGCTGTCAGTGAGAATCCGGACATTACAATTCCAGAGCTTATGGAAGTCATTCCAGGGCCTGATTTCCCGACCGCGGGTCAAATCTTGGGACGCAGCGGTATCCGGAAAGCATACGAATCAGGCCGAGGCTCTATCACGATCCGGGCAAAAGCTGAGATCGAACAAACATCTTCGGGTAAAGAAAGAATTATCGTTACAGAGTTACCTTACCAAGTAAATAAGGCGAAATTAATTGAGAAAATTGCTGATCTCGTAAGGGACAAAAAGATAGAGGGTATCACAGATCTGCGTGATGAGTCAGATCGTACAGGTATGAGAATTGTCATTGAAATCAGACGCGATGCCAATGCGAATGTCATCTTAAACAATCTGTACAAACAAACTGCTCTACAAACATCTTTTGGCATCAACCTGCTTGCACTTGTTGAT。

[0042] The sequencing results were subjected to sequence homology alignment on the NCBI website (http: / / www.ncbi.nlm.nih.gov / ), and a phylogenetic tree was constructed using MEGA 5.0 software based on the neighbor-joining method ( Figure 1 ). The results of the phylogenetic tree showed that the biocontrol strain was on the same branch as Bacillus subtilis BZJN1 (MG018617.1), indicating that the biocontrol strain had the closest genetic relationship with Bacillus subtilis. The strain was identified as Bacillus subtilis and named HTBS01.

[0043] (3) Preservation of strain HTBS01

[0044] The biocontrol strain HTBS01, belonging to Bacillus subtilis, was deposited at the General Microbiology Center of the China Committee for Culture Collection of Microorganisms (abbreviated as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, postal code 100101) on March 18, 2022, with the deposit number CGMCC No. 24547.

[0045] Example 2

[0046] When the biocontrol strain HTBS01 is used to control the trunk diseases of Malus micromalus, the biocontrol strain HTBS01 needs to be made into a spore suspension or powder. This example is the preparation method of the spore suspension and powder of the biocontrol strain HTBS01.

[0047] (1) Preparation method of the spore suspension of the biocontrol strain HTBS01: Inoculate the biocontrol strain HTBS01 into a beef extract liquid medium (composed of 3 g of beef extract, 10 g of peptone, 5 g of NaCl, and 1000 mL of water, pH 7.2), and culture it with shaking at 32 °C and 180 rpm for 48 h. After observing the formation of spores, centrifuge at 8000 rpm for 5 min, collect the precipitate (spores), and suspend the precipitate with sterile water to obtain a spore suspension with a spore concentration of 1×10 9 CFU / mL.

[0048] (2) Preparation method of the powder of the biocontrol strain HTBS01: Adsorb the spore suspension with peat or calcium powder, and then dry it to obtain the powdered preparation of Bacillus subtilis HTBS01.

[0049] Example 3

[0050] This example is the preparation method of the spore suspension and powder of the biocontrol strain HTBS01.

[0051] (1) Preparation method of the spore suspension of biocontrol strain HTBS01: Inoculate biocontrol strain HTBS01 into the beef extract liquid medium (composed of 3 g of beef extract, 10 g of peptone, 5 g of NaCl and 1000 mL of water, pH 7.0), cultivate with shaking at 30 °C and 200 rpm for 36 h. After observing the formation of spores, centrifuge at 5000 rpm for 5 min, collect the precipitate (spores), and suspend the precipitate with sterile water to obtain a spore suspension with a spore concentration of 1.4×10 9 CFU / mL.

[0052] (2) Preparation method of the powder of biocontrol strain HTBS01: Adsorb the spore suspension with peat or calcium powder, and then dry it to obtain the powdery preparation of Bacillus subtilis HTBS01.

[0053] Example 4

[0054] This example is about the antagonistic effect of biocontrol strain HTBS01 against the pathogenic bacteria of the diseases on the branches of Malus micromalus.

[0055] Activate the pathogenic bacteria of Botryosphaeria berengeriana f. sp. piricola (Botryosphaeria) on the PDA plate. Use the pathogenic bacteria as the target bacteria, and use a 5-mm punch to punch 5-mm bacterial cakes on the pathogenic bacteria plate. Use the plate confrontation method to detect the antagonistic effect of the isolated bacteria. Inoculate a 5-mm pathogenic bacteria cake in the center of the PDA plate, and inoculate biocontrol strain HTBS01 2 cm above, below, left and right of the pathogenic bacteria cake as the center. Only inoculate the pathogenic bacteria on the blank control plate. Incubate in a constant temperature incubator at 28 °C for 4 - 7 days. When the blank control fills the entire petri dish, measure the control growth amount (colony radius) of the pathogenic bacteria and the treated growth amount (inhibited growth radius after inoculating the bacteria), and determine the inhibition rate of strain HTBS01 against the pathogenic bacteria of Botryosphaeria berengeriana f. sp. piricola on Malus micromalus. The inhibition rate (%) = (control growth amount - treated growth amount) / control growth amount × 100%.

[0056] The research methods for the antagonistic effects of strain HTBS01 against the pathogenic bacteria of the rough bark disease of Malus micromalus (Nothophoma quercina) and the pathogenic bacteria of the canker disease (Valsa mali Miyabe & G. Yamada) are the same as above.

[0057] The inhibitory effect of strain HTBS01 on the pathogenic bacteria of Botryosphaeria berengeriana f. sp. piricola on Malus micromalus is as Figure 2 , the inhibitory effect of strain HTBS01 on the pathogenic bacteria of the rough bark disease of Malus micromalus is as Figure 3 , the inhibitory effect of strain HTBS01 on the pathogenic bacteria of the canker disease of Malus micromalus is as Figure 4. The inhibition rate calculation results showed that the inhibition rate of strain HTBS01 against the pathogens of ring rot and rough bark disease of Malus micromalus reached over 90%, and the inhibition rate of strain HTBS01 against the pathogen of canker disease of Malus micromalus was 66.67%.

[0058] Example 5

[0059] This example was the evaluation of the forest biological control effect of Bacillus subtilis HTBS01 preparation.

[0060] 1. Test site

[0061] Site 1: The Water Drill School in the Summer Palace. There were 14 Malus micromalus trees with the same plant shape and tree age, all being 20 years old. Except for the tree basins, the ground around the trees was paved, and hosta plants were planted inside the tree basins. Due to being close to buildings and paved ground, the growth space was limited, the growth was weak, and branch diseases occurred from time to time, and rust and defoliation spot diseases occurred on the leaves from time to time.

[0062] Site 2: The Begonia plot in the Farming and Weaving Picture in the Summer Palace. There were 12 young Malus micromalus trees with the same plant shape. Cold-season lawns were planted under all the plants. The growth environment was relatively open, there was no obstruction around, and branch diseases, rust, and defoliation spot diseases often occurred.

[0063] 2. Test time

[0064] The forest control effect tests were continuously carried out on the same Malus micromalus plants for 2 years from 2019 to 2020 in the same method.

[0065] 3. Test method

[0066] The control group included 7 Malus micromalus trees in the Water Drill School and 6 Malus micromalus trees in the Begonia plot in the Farming and Weaving Picture. Each single tree was a replicate, and conventional management was carried out.

[0067] The treatment group included 7 Malus micromalus trees in the Water Drill School and 6 Malus micromalus trees in the Begonia plot in the Farming and Weaving Picture. Each single tree was a replicate. Treatment method: Each tree was treated with 400 g of the biological control strain HTBS01 powder each time. At two-thirds of the crown projection, holes with a depth of 40 cm were drilled at the four azimuths of east, south, west, and north. 100 g of HTBS01 powder was added to each hole and poured down with an appropriate amount of water, and then the holes were buried with soil; it was applied once in spring (March - April) and autumn (September - October) every year; during the growth period from April to September, a 1000-fold dilution solution of the biological control bacteria HTBS01 powder was sprayed once a month. All treatment groups used the biological control bacteria HTBS01 powder on the basis of conventional management measures, and other maintenance management measures were the same as those of the control group.

[0068] 4. Investigation on the occurrence of diseases:

[0069] (1) Investigation time: The occurrence of branch rough bark disease and branch canker disease was investigated in mid-April and mid-November.

[0070] (2) Investigation of Stem and Branch Rough Bark Disease

[0071] Adopt individual tree investigation. Each tree is divided into three parts: main trunk, central trunk and branches. Investigate the disease occurrence parts and degrees of the stems and branches. Classification method of disease occurrence parts: "Main trunk" refers to the part below the first branch of the tree body, the part above the first branch is the "central trunk", and "branches" refer to all levels of branches except the main trunk and central trunk.

[0072] The severity of rough bark disease is divided into six levels:

[0073] Level 0: The tree is disease-free;

[0074] Level 1: There are galls or the rough bark disease area on the main trunk and central trunk accounts for 1 - 15% of the total area of this part;

[0075] Level 3: There are galls or the rough bark disease area on the main trunk and central trunk accounts for 16 - 30% of the total area of this part, or the main branches are diseased;

[0076] Level 5: There are galls or the rough bark disease area on the main trunk and central trunk accounts for 31 - 45% of the total area of this part, or there are obvious galls on the lateral branches;

[0077] Level 7: There are galls or the rough bark disease area on the main trunk and central trunk accounts for 46 - 60% of the total area of this part, and there are obvious galls on the lateral branches; or there are galls or the rough bark disease area on the main trunk and central trunk accounts for more than 60% of the total area of this part, but the lateral branches are not diseased.

[0078] Level 9: The area of galls or rough bark disease on the main trunk, central trunk and main branches accounts for more than 60% of the total area of this part, and there are obvious galls on the lateral branches.

[0079] Calculation methods of the disease index and control effect of stem and branch rough bark disease:

[0080] Disease index = (∑(number of diseased plants at each level × severity at each level) / (highest disease level × total number of investigated plants)) × 100;

[0081] Control effect (%) = (disease index of control area - disease index of treatment area) / disease index of control area × 100.

[0082] (3) Investigation of Stem and Branch Rot Disease

[0083] For each disease scar, record the cause of disease (saw cut, frostbite / sunburn, branch junction, wound, others), disease occurrence part (main trunk, central trunk, main branch, lateral branch) and type of disease scar (recurrent disease scar, new disease scar, healed disease scar).

[0084] The severity of rot disease is divided into six levels:

[0085] Level 0: The tree is disease-free (Note: Diseased spots that have been cured are regarded as level 0 during calculation);

[0086] Level 1: There are diseased spots at the branching points of lateral branches or between lateral branches and main branches, and no diseased spots on the main branches.

[0087] Level 3: There are diseased spots at the branching points of main branches or between main branches and the trunk, and no diseased spots on the central trunk.

[0088] Level 5: There are 1 - 2 diseased spots on the trunk and the central trunk; the width of the diseased spots is less than half of the tree girth.

[0089] Level 7: There are more than 3 diseased spots on the trunk and the central trunk, or the width of the diseased spots reaches half or more of the tree girth.

[0090] Level 9: There are diseased spots on the trunk, the central trunk, and the main branches, or there are dead main branches and lateral branches.

[0091] Calculation methods for the disease index and control efficacy of apple canker:

[0092] Disease index = (∑(number of diseased plants at each level × severity at each level) / (highest disease level × total number of plants surveyed)) × 100;

[0093] Control efficacy (%) = (disease index in the control area - disease index in the treatment area) / disease index in the control area × 100.

[0094] (4) Data statistics

[0095] Use SAS software for statistical analysis and multiple comparisons of the data, and evaluate the effects of the microecological agents on the rejuvenation of Chinese flowering crabapple and disease control for two consecutive years. The results are shown in Table 3.

[0096] Table 3 Control efficacy of the biocontrol strain HTBS01 powder on apple canker and rough bark disease of Malus micromalus

[0097]

[0098] The results of the field biocontrol test of Bacillus subtilis HTBS01 powder show that the average control efficacy of HTBS01 powder on apple canker of Malus micromalus with a tree age of 20 - 30 years in Shuicao School is 47.13%, and the average control efficacy on apple canker of Malus micromalus with a tree age of 10 - 20 years in Gengzhi Map Apple Orchard is 50.32%; the average control efficacy of HTBS01 powder on rough bark disease of Malus micromalus with a tree age of 20 - 30 years in Shuicao School is 18.48%, and the average control efficacy on rough bark disease of Malus micromalus with a tree age of 10 - 20 years in Gengzhi Map Apple Orchard is 38.10%.

[0099] The present invention provides a biocontrol strain HTBS01 for controlling the branch diseases of Malus micromalus, its screening method and application, which can be used to control branch diseases of Malus micromalus such as ring rot disease, rough bark disease, and apple canker, can effectively reduce the use of pesticides, is safe and non-toxic, and realizes the dual purposes of preventing and treating branch diseases of Malus micromalus.

[0100] The above are only the preferred embodiments of the present invention, and do not impose any limitations on the present invention. Any simple modifications, changes, and equivalent variations made to the above embodiments based on the technical essence of the invention still fall within the protection scope of the technical solution of the present invention.

Claims

1. A biocontrol strain HTBS01 for preventing and controlling the trunk diseases of Malus micromalus, characterized in that, The biocontrol strain HTBS01 belongs to Bacillus subtilis, and the preservation number is: CGMCC No. 24547.

2. A screening method for the biocontrol strain HTBS01 against the trunk diseases of Malus micromalus Makino as described in claim 1, characterized in that, It includes the following steps: S1. Surface disinfection of the sample: Take the healthy tissue samples of the branches of Malus micromalus in different seasons for surface disinfection respectively to obtain the disinfected samples; S2. Sample grinding and separation: Put the disinfected samples obtained in S1 into a sterilized mortar, add sterilized quartz sand and sterile water for thorough grinding, take the grinding juice, add sterile water and mix evenly, then let it stand to obtain a sample solution; S3. Gradient dilution: Gradiently dilute the sample solution obtained in S2 with sterile water to obtain a dilution; S4. Plate coating and culture: Take the dilution obtained in S3 and coat it on a beef extract plate, culture it under the condition of a temperature of 28°C - 30°C. After colonies grow on the plate, pick a single colony, and obtain the strain HTBS01 after streaking and purification.

3. The method according to claim 2, characterized in that, The surface disinfection described in S1 is to disinfect with 75% (volume fraction) alcohol for 30 s - 60 s, then treat with 1.0% (mass fraction) NaClO solution for 10 min - 15 min, and finally rinse three times with sterile water.

4. The method according to claim 2, wherein The gradient dilution concentration described in S3 is 1×10 -2 ~1×10 -9 .

5. Application of the biocontrol strain HTBS01 as described in claim 1 in preventing and controlling the diseases of the branches of Malus micromalus.

6. The application according to claim 5, wherein The diseases of the branches of Malus micromalus include rough bark disease of Malus, canker disease of Malus, and ring rot disease of Malus.

7. The application according to claim 5, wherein When the biocontrol strain HTBS01 is used to prevent and control the diseases of the branches of Malus, it is made into a spore suspension or powder.

8. The application according to claim 7, wherein The spore suspension is prepared by the following method: inoculate the strain HTBS01 into a beef extract liquid medium, shake and culture it at a temperature of 30°C - 32°C and a rotation speed of 180 rpm - 200 rpm for 36 h - 48 h. After observing the formation of spores, centrifuge at 5000 rpm - 8000 rpm for 3 min - 5 min, collect the precipitate, and suspend the precipitate with sterile water to obtain a spore suspension with a spore concentration of not less than 1×10 9 CFU / mL.

9. The application according to claim 7, wherein The powder is prepared by the following method: Adsorb the spore suspension with peat or calcium powder and then dry it.

Images