Recombinant Escherichia coli for fully biosynthesizing malonic acid through fumaric acid pathway and application of recombinant Escherichia coli

By expressing specific enzyme genes in E. coli in modules and optimizing fermentation conditions, the problem of low biosynthesis of malonic acid is solved, and efficient green production of malonic acid is achieved, and the yield is significantly improved.

CN120290441APending Publication Date: 2025-07-11JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510366370.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-26
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

In the prior art, the biosynthesis efficiency of malonic acid is insufficient and cannot compete with chemical synthesis methods. In addition, chemical synthesis methods have problems with raw material and environmental pollution, so green and efficient biosynthesis methods need to be developed.

Method used

By overexpressing aspartic acid aminolytic enzymes, succinate semialdehyde dehydrogenase, β-alanine pyruvate transaminase and malonyl Coenzyme A reductase genes in Escherichia coli, malonic acid is synthesized using the fumaric acid-malonic acid semialdehyde pathway, and fermentation conditions, including culture medium and induction conditions are optimized.

Benefits of technology

High-efficiency biosynthesis of malonic acid was achieved, the fermentation yield of shake flask increased by 2.21 times, and the accumulated amount in the 5L fermentation tank reached 17.8g/L, which significantly improved the biosynthesis efficiency.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290441A_ABST
    Figure CN120290441A_ABST
Patent Text Reader

Abstract

The invention discloses recombinant escherichia coli for full biosynthesis of malonic acid through a fumaric acid pathway and application, and belongs to the field of bioengineering. The method comprises the following steps: by taking escherichia coli BL21 (DE3) as a host, co-expressing an aspartic acid ammonialyase gene aspA from escherichia coli and an aspartic acid-alpha-decarboxylase gene panD from corynebacterium glutamicum; the preparation method comprises the following steps: co-expressing a succinate semialdehyde dehydrogenase gene yneI derived from escherichia coli and a heterologous gene beta-alanine pyruvate transaminase gene pa0132 derived from pseudomonas aeruginosa, and co-expressing a beta-alanine pyruvate transaminase gene bauA derived from pseudomonas aeruginosa and a malonyl-coenzyme A reductase gene mcr-C derived from orange filamentous bacteria; a malonic acid full-biosynthesis pathway of fumaric acid-malonic semialdehyde is constructed, so that the yield of malonic acid reaches 1414 mg / L after the constructed recombinant escherichia coli is fermented for 48 hours at a shake flask level.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to a recombinant Escherichia coli for the whole biosynthesis of malonic acid through the fumaric acid pathway and its application, belonging to the field of bioengineering. Background Art

[0002] Malonic acid, also known as carrot acid, malic acid or beet acid, has two functional groups, active methylene and carboxyl, in its molecular structure, so it can participate in various chemical reactions and is a very important organic synthesis intermediate. Malonic acid is one of the top 30 chemicals that can be produced from biomass announced by the US Department of Energy.

[0003] With the rapid development of the chemical industry, the output and quality of malonic acid are increasing day by day, and the uses and downstream products of malonic acid have been vigorously developed. According to statistics, the global market size of malonic acid in 2022 was about 330 million yuan, and it is expected to continue to maintain a stable growth trend in the future, reaching a market size of nearly 390 million yuan in 2029. Since the synthesis efficiency of the biological synthesis method of malonic acid is not sufficient to compete with the traditional chemical synthesis method, at present, the large-scale production of malonic acid is achieved by chemical methods. However, the chemical synthesis method faces problems such as raw materials, energy consumption, and environmental pollution, which are not conducive to sustainable development. Therefore, green and efficient production through industrial biotechnology has greater competitive advantages. Renewable raw materials are used for the biocatalysis / whole biosynthesis of malonic acid for the production and preparation of downstream chemicals and products.

[0004] The natural biosynthetic pathway of malonic acid is still unknown. The known methods are through the malonyl-CoA pathway and the oxaloacetate pathway. However, the metabolite production efficiency of the malonyl-CoA pathway and the oxaloacetate pathway is lower than that of the fumaric acid pathway. Therefore, using the fumaric acid pathway to produce malonic acid is a more efficient method. Summary of the Invention

[0005] The present invention provides a recombinant Escherichia coli that can synthesize malonic acid through the fumaric acid - malonic semialdehyde pathway under the condition of adding exogenous fumaric acid; the recombinant Escherichia coli overexpresses, in modules, aspartate ammonia-lyase (aspA), succinic semialdehyde dehydrogenase (yneI), and aspartate-α-decarboxylase (panD) from Escherichia coli, two β-alanine pyruvate transaminases (pa0132, bauA) from Pseudomonas aeruginosa, and malonyl-CoA reductase (mcr-C) from Aspergillus nidulans.

[0006] In one embodiment, the modular expression is to express the genes aspA and panD on a common plasmid, express the genes yneI and pa0132 on a common plasmid, and express the genes bauA and mcr-C on a common plasmid.

[0007] In one embodiment, the modular expression is to express genes aspA and panD using pTrc99a as the expression vector, to express genes yneI and pa0132 using pRSFDuet-1 as the expression vector, and to express genes bauA and mcr-C using pACYCDuet-1 as the expression vector.

[0008] In one embodiment, the nucleotide sequence of gene aspA is as shown in SEQ ID NO.1; the nucleotide sequence of gene panD is as shown in SEQ ID NO.2; the nucleotide sequence of gene yneI is as shown in SEQ ID NO.3; the nucleotide sequence of gene pa0132 is as shown in SEQ ID NO.4; the nucleotide sequence of gene bauA is as shown in SEQ ID NO.5; the nucleotide sequence of gene mcr-C is as shown in SEQ ID NO.6.

[0009] In one embodiment, the recombinant Escherichia coli also knocks out the ydfG gene and the ptsG gene.

[0010] In one embodiment, the nucleotide sequence of the ydfG gene is as shown in SEQ ID NO.7; the nucleotide sequence of the ptsG gene is as shown in SEQ ID NO.8.

[0011] In one embodiment, Escherichia coli BL21(DE3) is used as the host.

[0012] The present invention also provides a method for constructing the recombinant Escherichia coli, comprising the following steps:

[0013] (1) Using plasmid pTrc99a as the backbone vector, ligating the gene fragments aspA and panD to obtain the recombinant plasmid pTrc99a-aspA-panD;

[0014] (2) Using plasmid pRSFDuet-1 as the backbone vector, ligating the gene fragments yneI and pa0123 to obtain the recombinant plasmid pRSF-pa0123-yneI;

[0015] (3) Using plasmid pACYCDuet-1 as the backbone vector, ligating the gene fragments bauA and mac-C to obtain the recombinant plasmid pACYC-bauA-mcr-C;

[0016] (4) Co-transforming the plasmids pTrc99a-aspA-panD, pRSF-yneI-pa0123 and pACYC-bauA-mcr-C into the host to obtain the recombinant Escherichia coli.

[0017] In one embodiment, Escherichia coli BL21(DE3) is used as the host.

[0018] The present invention also provides a method for fermenting and producing malonic acid by using the recombinant Escherichia coli. Glucose is used as the carbon source, and fumaric acid is used as the precursor, and the recombinant Escherichia coli is cultured in an aerobic environment.

[0019] In one embodiment, the fermentation uses SOB medium as the fermentation medium, and the recombinant Escherichia coli is cultured at 35-37 °C and 200-280 rpm for a period of time, then IPTG is added, and induction culture is carried out at 28-30 °C for at least 48 h.

[0020] In one embodiment, the SOB medium contains tryptone, yeast extract, NaCl, KCl, MgCl2, and glucose.

[0021] In one embodiment, the composition of the SOB medium is: 20 g / L tryptone, 5 g / L yeast extract, 0.5 g / L NaCl, 2.5 mM KCl, 10 mM MgCl2, 8 g / L glucose.

[0022] In one embodiment, the fermentation is carried out by inoculating the recombinant Escherichia coli seed liquid.

[0023] In one embodiment, the preparation method of the seed liquid is: culturing the recombinant Escherichia coli in LB medium at 37 °C and 250 rpm for 16 h, then transferring it to LB liquid medium and culturing it at 37 °C and 250 rpm until the OD 600 reaches 0.8-1.0 to obtain the seed liquid.

[0024] In one embodiment, feeding is carried out during the fermentation process.

[0025] In one embodiment, the feeding includes adding fumaric acid and glucose.

[0026] In one embodiment, the feeding rate of fumaric acid is controlled to be 0.5-1 g / L / h.

[0027] The present invention also claims the application of the genetically engineered bacterium for biosynthesis of malonic acid through the fumaric acid pathway of Escherichia coli or the method in the preparation of malonic acid and its derivative products.

[0028] In one embodiment, the derivative products include but are not limited to diethyl malonate or diethyl malonate.

[0029] In one embodiment, the derivative products include but are not limited to barbiturates, vitamin B1 or vitamin B6.

[0030] Beneficial effects:

[0031] 1. The present invention provides a recombinant Escherichia coli that can utilize glucose to ferment and produce malonic acid via the fumarate-malonate semialdehyde pathway under the condition of adding exogenous fumaric acid. By introducing three exogenous genes into Escherichia coli, two β-alanine pyruvate transaminase genes (pa0132, bauA) from Pseudomonas aeruginosa and a malonyl-CoA reductase gene (mcr-C) from Mycobacterium aurum, and then overexpressing three genes of Escherichia coli's own aspartate ammonia-lyase (aspA), aspartate-α-decarboxylase (panD) and succinic semialdehyde dehydrogenase gene (yneI), the biosynthesis of malonic acid with higher yield is achieved. This method is simple and convenient to operate, and the malonic acid production can reach 1050 mg / L after 48 hours of fermentation at the shake flask level, which is 2.21 times higher than the highest malonic acid production of 440 mg / L of the previously constructed recombinant Escherichia coli.

[0032] 2. The present invention optimized the shake flask fermentation of the recombinant Escherichia coli, including the optimization of fumaric acid concentration gradient, medium optimization, and induction conditions (cell concentration and IPTG concentration), so that the malonic acid production reached 1414 mg / L.

[0033] 3. The present invention fermented the constructed recombinant Escherichia coli in a 5 L fermentor, and further increased the malonic acid accumulation to 17.8 g / L. Description of the Drawings

[0034] Figure 1 Results of the malonic acid accumulation during the shake flask fermentation of the recombinant strain A2BM in SOB medium in Example 2.

[0035] Figure 2 Results of the shake flask fermentation of the recombinant strain YA2BM in Example 3.

[0036] Figure 3 Results of the shake flask fermentation of the recombinant strain PA2BM in Example 3.

[0037] Figure 4 Results of the shake flask fermentation of the recombinant strain YA2BM in different media in Example 4.

[0038] Figure 5 Results of the shake flask fermentation of the recombinant strain YA2BM under different fumaric acid concentration conditions in Example 5.

[0039] Figure 6 Results of the shake flask fermentation of the recombinant strain YA2BM when it grows to different concentrations in Example 6.

[0040] Figure 7 Results of the shake flask fermentation of the recombinant strain YA2BM under different inducer concentration conditions in Example 6.

[0041] Figure 8Fermentation results of recombinant strain PA2BM at the 5L fermentor level in Example 7.

[0042] Figure 9 Fermentation results of recombinant strain YA2BM at the 5L fermentor level in Example 7.

[0043] Figure 10 Fermentation results of recombinant strains constructed using aspartate-α-decarboxylase genes from Corynebacterium glutamicum and Tribolium castaneum in the shake flask as a comparative example. Detailed implementation manners

[0044] Liquid-phase detection of malonic acid and result analysis:

[0045] Pretreatment: Centrifuge the fermentation sample at 12,000 rpm for 2 min to separate the fermentation broth from the cells, and treat the fermentation broth with a 0.22-μm filter membrane for liquid-phase detection.

[0046] HPLC detection:

[0047] Analyze the results using a differential detector of high-performance liquid chromatography. The mobile phase used for detection is 5 mM H2SO4, and the flow rate of the mobile phase is 0.6 mL·min -1 , the chromatographic column is a Bio-Rad HPX-87H (Bio-rad, USA) chromatographic column, the column temperature is 35 °C, and the injection volume is 10 μL.

[0048] Table 1 Primers and sequences involved in the examples

[0049]

[0050]

[0051] Example 1: Construction of recombinant Escherichia coli

[0052] Construction of pTrc99a-aspA-panD: The aspA gene fragment (shown in SEQ ID NO.1) was amplified using PT-ASPA-F and PT-ASPA-R primers, the panD gene fragment (SEQ ID NO.2) was amplified using PAND-F and PAND-R primers, and the pTrc99A vector was linearized using PTRC-F and PTRC-R primers. First, the aspA fragment was homologously recombined with the linearized pTrc99A vector using a homologous recombinase, and the recombinant product was transformed into competent E. coli JM109 cells to obtain the recombinant plasmid pTrc99a-aspA. Then, the pTrc99a-aspA plasmid was linearized using PT-AS-PAND-GR and PAC-BA-MCRC-GF primers, and the panD fragment was homologously recombined with the linearized pTrc99a-aspA plasmid using a homologous recombinase. The recombinant product was transformed into competent E. coli JM109 cells to obtain the recombinant plasmid pTrc99a-aspA-panD.

[0053] Construction of pRSF-pa0132-yneI: The yneI gene fragment (SEQ ID NO.3) was amplified using YNE1-F and YNE1-R primers, the pa0132 gene fragment (SEQ ID NO.4) was amplified using PA0132-F and PA0132-R primers, and the pRSFDuet-1 vector was linearized using PR-PA0132-GF and PR-PA0132-GR primers. First, the pa0132 fragment was homologously recombined with the linearized pRSFDuet-1 vector using a homologous recombinase, and the recombinant product was transformed into competent E. coli JM109 cells to obtain the recombinant plasmid pRSF-pa0132. Then, the pRSF-pa0132 plasmid was linearized using PYNE1-R and PYNE1-F primers, and the yneI fragment was homologously recombined with the linearized pRSF-pa0132 plasmid using a homologous recombinase. The recombinant product was transformed into competent E. coli JM109 cells to obtain the recombinant plasmid pRSF-pa0132-yneI.

[0054] Construction of pACYC-bauA-mcr-C: The bauA gene fragment (SEQ ID NO.5) was amplified using PAC-BAUA-MC-F and PAC-BAUA-MC-R primers, the mcr-C gene fragment (SEQ ID NO.6) was amplified using PAC-BA-MCRC-R and PAC-BA-MCRC-F primers, and the pACYCDuet-1 vector was linearized using PAC-BAUA-MC-GF and PAC-BAUA-MC-GR primers. First, the bauA fragment was homologously recombined with the linearized pACYCDuet-1 vector using a homologous recombinase, and the recombinant product was transferred into competent E. coli JM109 cells to obtain the recombinant plasmid pACYC-bauA. Then, the pACYC-bauA plasmid was linearized using PAC-BA-MCRC-GF and PAC-BA-MCRC-GR primers, the mcr-C fragment was homologously recombined with the linearized pACYC-bauA plasmid using a homologous recombinase, and the recombinant product was transferred into competent E. coli JM109 cells to obtain the recombinant plasmid pACYC-bauA-mcr-C.

[0055] pRSF-pa0132-yneI, pTrc99a-aspa-panD, and pACYC-bauA-mcr-C were co-transformed into competent E. coli BL21(DE3) cells to prepare recombinant E. coli A2BM.

[0056] Example 2: Shake flask fermentation of recombinant E. coli

[0057] SOB medium (g / L): Peptone 20, Yeast extract 5, MgCl2·6H2O 2.03, NaCl 0.5, KCl 0.186;

[0058] Seed culture preparation: A single colony of recombinant E. coli A2BM on the plate was picked and inoculated into a 50 mL conical flask containing 10 mL of LB liquid medium, and shaken overnight at 37 °C and 250 rpm / min.

[0059] Fermentation conditions: The seed culture was inoculated into SOB medium containing 4 g / L glucose at an inoculation amount of 2% to make the initial OD 600 be 0.1. Cultured at 37 °C and 250 r / min for 4 - 5 h until the OD 600 reached 0.8 - 1.0, then 1.0 mM IPTG was added to induce the recombinant bacteria, and 4 g / L sodium fumarate was added during induction, and the temperature was adjusted to 30 °C and continued to culture.

[0060] Result analysis: Samples were taken every 12 h during the fermentation process for a total of 72 h. The samples were centrifuged at 12,000 r / min for 3 min to separate the fermentation broth from the bacteria. The fermentation broth was treated with a 0.22-μm filter membrane and used for HPLC (High Performance Liquid Chromatography, Aminex HPX-87H organic acid column from Bio-Rad, USA) detection. In the HPLC detection, the mobile phase was 5 mM H2SO4, the column temperature was 50 °C, and a differential refractive index detector was used. According to the liquid phase results, the malonic acid accumulation in recombinant Escherichia coli A2BM reached 960 mg / L at 48 h.

[0061] Example 3: Gene knockout of recombinant Escherichia coli

[0062] The operation method is as follows: First, a 20-bp sgRNA sequence was integrated into the pTarget plasmid by whole plasmid PCR. Then, the pCas plasmid containing the Cas9 coding gene was electrotransformed into the strain to be knocked out. Next, the host strain containing the pCas plasmid was prepared for electrotransformation competent cells. Finally, the pTarget plasmid and the fragment obtained by PCR fusion of the 500-bp homologous arm fragments upstream and downstream of the target gene on the strain genome were co-electrotransformed into the strain to be knocked out containing the pCas plasmid to achieve gene knockout. Arabinose was added during knockout to induce the synthesis of recombinase. After successful knockout was verified by PCR, IPTG was added to induce the sgRNA on the pTarget plasmid located by the pCas plasmid, thereby eliminating the pTarget plasmid. Since the pCas plasmid is a temperature-sensitive plasmid, the strain was cultured at 42 °C to eliminate the pCas plasmid.

[0063] (1) Knockout of gene ydfG

[0064] 1.4 g / L of 3-hydroxypropionic acid was detected in the shake flask fermentation broth of recombinant Escherichia coli A2BM in Example 2. By knocking out ydfG (nucleotide sequence shown in SEQ ID NO.7), the 3-HP production pathway was weakened, and the accumulation of malonic acid was increased. The BL21△ydfG strain was constructed by knocking out the gene of Escherichia coli BL21(DE3) according to the aforementioned method (the sgRNA sequence was TGGCATCGCTTCCTGCCGAG).

[0065] According to the method of Example 1, the plasmids pTrc99a-aspA-panD, pRSF-yneI-pa0132, and pACYC-bauA-mcr-C were transferred into the strain BL21△ydfG to construct the recombinant strain YA2BM.

[0066] The recombinant strain YA2BM was inoculated into SOB medium containing 4 g / L of glucose after being activated twice in LB medium and cultured at 37 °C and 250 r / min for 4 - 5 h until OD 600When it is 0.8 - 1.0, add 1 mM IPTG for induction. Add 8 g / L sodium fumarate during induction, and lower the temperature to 30 °C for continuous cultivation.

[0067] The results showed that the malonic acid accumulation reached 1260 mg / L after 48 h of fermentation, which was 31.3% higher than that of strain A2BM, and no 3-HP was detected.

[0068] (2) Knockout of gene ptsG

[0069] 2.18 g / L of acetic acid was detected in the flask fermentation of strain A2BM. By knocking out ptsG, the acetic acid production pathway was weakened and the accumulation of malonic acid was increased. According to the aforementioned method, the ptsG gene was knocked out in Escherichia coli BL21(DE3) and BL21△ydfG (the sgRNA sequence was TCTAAACACCTGGCGGATAC) to construct strains BL21△ptsG and BL21△ydfG△ptsG.

[0070] According to the method of Example 1, plasmids pTrc99a-aspA-panD, pRSF-yneI-pa0132 and pACYC-bauA-mcr-C were transferred into strains BL21△ptsG and BL21△ydfG△ptsG to construct recombinant strains PA2BM and YPA2BM.

[0071] The recombinant strains PA2BM and YPA2BM were respectively activated twice in LB medium and then inoculated into SOB medium containing 4 g / L glucose and cultured at 37 °C and 250 r / min for 4 - 5 h until OD 600 When it was 0.8 - 1.0, add 1 mM IPTG to induce the recombinant bacteria. Add 8 g / L sodium fumarate during induction, and lower the temperature to 30 °C for continuous cultivation.

[0072] The results showed that after 48 h of fermentation, the highest malonic acid accumulation of strain PA2BM was 1150 mg / L, which was 19.8% higher than that of strain A2BM, and the acetic acid accumulation decreased to 540 mg / L, with a decrease amplitude of 75.2%. The highest malonic acid accumulation of strain YPA2BM was 766 mg / L, which was lower than that of strain A2BM.

[0073] Example 4: Optimization of the flask fermentation medium of recombinant Escherichia coli

[0074] LB medium (g / L): Peptone 10, Yeast extract 5, NaCl 10.

[0075] SOB medium (g / L): Peptone 20, Yeast extract 5, MgCl2·6H2O 2.03, NaCl 0.5, KCl 0.186.

[0076] TB medium (g / L): peptone 12, yeast powder 24, K2HPO4·3H2O 16.34, KH2PO4 2.31.

[0077] TBG medium (g / L): peptone 12, yeast powder 24, K2HPO4·3H2O 16.34, KH2PO4 2.31, glycerol 4 g / L.

[0078] M9 medium (g / L): peptone 8, yeast powder 2, Na2HPO4 6.78, NaH2PO4 3, NH4Cl 1, NaCl 0.5, MgSO4 0.24 (sterilized separately), CaCl2 0.115 (sterilized separately);

[0079] The recombinant strain YA2BM constructed in Example 3 was activated twice in LB medium and then inoculated into different media (LB, M9, SOB, TB, and TBG media) containing 4 g / L glucose at an inoculation amount of 2% for shake flask fermentation. When the strain grew for 4 - 5 h to an OD 600 of 0.8 - 1.0, IPTG with a final concentration of 1 mM was added for induction, and the temperature was lowered to 30 °C for the expression of the target gene. At the same time, 8 g / L sodium fumarate was added. Samples were taken every 12 h during the fermentation process for a total of 72 h. The samples were centrifuged at 12,000 r / min for 3 min to separate the fermentation broth from the cells, and the fermentation broth was treated with a 0.22 μm filter membrane for HPLC detection. According to the liquid phase results, the malonic acid accumulation amount was the highest in the SOB medium at 1260 mg / L when the fermentation was carried out for 48 h.

[0080] Example 5: Optimization of fumaric acid concentration in shake flask fermentation of recombinant Escherichia coli

[0081] The recombinant strain YA2BM was activated twice in LB medium and then inoculated into SOB medium containing 4 g / L glucose for shake flask fermentation at 37 °C. When the strain grew for 4 - 5 h to an OD 600 of 0.8 - 1.0, 1 mM IPTG was added to induce the expression of the target gene, and 2, 4, 6, 8, and 10 g / L fumaric acid were added respectively at this time. The results showed that the malonic acid accumulation amount was the highest at 1268 mg / L when the fumaric acid concentration was 8 g / L after 48 h of fermentation.

[0082] Example 6: Optimization of induction conditions for shake flask fermentation of recombinant Escherichia coli

[0083] 1) Optimization of induction concentration

[0084] The recombinant strain YA2BM constructed in Example 3 was activated twice in LB medium and then inoculated into SOB medium containing 4 g / L glucose for shake flask fermentation at 37°C. When the strain grew to OD 600 which were 0.7, 1.5, 2, 2.5, 3, and 3.5 respectively, 1 mM IPTG was added, and the temperature was lowered to 30°C for induction. The results showed that after 48 h of fermentation, when the cell density OD 600 at induction was 2.5, the malonic acid production was 1310 mg / L.

[0085] (2) Optimization of inducer concentration

[0086] The recombinant strain YA2BM constructed in Example 3 was activated twice in LB medium and then inoculated into SOB medium containing 4 g / L glucose for shake flask fermentation at 37°C. When the strain grew to OD 600 of 2.5, IPTG concentrations of 0.5, 0.75, 1, 1.2, 1.6, and 2 mM were used respectively, and the temperature was lowered to 30°C for induction. The results after 48 h of fermentation showed that when the inducer concentration was 1.2 mM, the malonic acid production was 1414 mg / L.

[0087] Example 7: Fermentation production of malonic acid in a fermenter

[0088] The recombinant strains PA2BM and YA2BM constructed in Example 3 were respectively activated twice in LB medium and then inoculated into SOB medium containing 25 g / L glucose for 5 L fermenter fermentation. After the strain grew for 12 h, 1.2 mM IPTG was added for induction, and at the same time, fumaric acid was fed. The feeding rate of fumaric acid was controlled within 0.5 - 1 g / L / h and adjusted according to the cell concentration. For example, the fumaric acid feeding rate was controlled at 0.5 g / l / h within 12 - 60 h, at 1 g / L / h from 60 - 90 h, and the fumaric acid feeding rate was reduced to 0.5 g / L / h after 90 h, and the glucose concentration was controlled at 20 g / L.

[0089] The results showed that after 108 h of fermentation, the highest malonic acid accumulation of the strain PA2BM was 17.8 g / L, and the highest OD 600 was 55; after 120 h of fermentation, the malonic acid accumulation of the YA2BM strain reached 16.1 g / L, and the highest OD 600 was 54.16.

[0090] Control example:

[0091] The specific implementation manner is the same as that of Example 1, except that recombinant plasmids pTrc-aspA-CqpanD and pTrc-aspA-tcpanD expressing aspartate-α-decarboxylase genes cqpanD (nucleotide sequence as SEQ ID NO.9) and tcpanD (nucleotide sequence as SEQ ID NO.10) derived from Corynebacterium glutamicum and Tribolium castaneum, respectively, were also constructed. According to the method of Example 1, the recombinant plasmids pTrc-aspA-CqpanD and pTrc-aspA-tcpanD were co-transformed into Escherichia coli BL21(DE3) together with the recombinant plasmids pRSF-yneI-pa0132 and pACYC-bauA-mcrC. Fermentation was carried out with reference to the method of Example 2. The results showed that the recombinant strain constructed using the aspartate-α-decarboxylase gene cqpanD derived from Corynebacterium glutamicum had a malonic acid yield of 746 mg / L after 48 h of fermentation, and the recombinant strain constructed using the aspartate-α-decarboxylase gene tcpanD derived from Tribolium castaneum had a malonic acid yield of 335 mg / L after 48 h of fermentation.

[0092] Although the present invention has been disclosed above with preferred embodiments, it is not intended to limit the present invention. Any person familiar with this technology can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention should be defined by the claims.

Claims

1. Recombinant Escherichia coli, characterized in that, Overexpress the genes panD (aspartate-α-decarboxylase) and aspA (aspartate ammonia-lyase) in modules, the genes pa0132 (β-alanine-pyruvate transaminase) and yneI (succinate-semialdehyde dehydrogenase), the genes bauA (β-alanine-pyruvate transaminase) and mcr-C (malonyl-CoA reductase).

2. The recombinant Escherichia coli according to claim 1, characterized in that, Use pTrc99a as the expression vector to express the genes aspA and panD, use pRSFDuet-1 as the expression vector to express the genes yneI and pa0132, and use pACYCDuet-1 as the expression vector to express the genes bauA and mcr-C.

3. The recombinant Escherichia coli according to claim 1 or 2, characterized in that, The nucleotide sequence of the gene aspA is shown as SEQ ID NO.1; the nucleotide sequence of the gene panD is shown as SEQ ID NO.2; the nucleotide sequence of the gene yneI is shown as SEQ ID NO.3; the nucleotide sequence of the gene pa0132 is shown as SEQ ID NO.4; the nucleotide sequence of the gene bauA is shown as SEQ ID NO.5; the nucleotide sequence of the gene mcr-C is shown as SEQ ID NO.

6.

4. The recombinant Escherichia coli according to any one of claims 1 to 3, characterized in that, The recombinant Escherichia coli also knocked out the ydfG gene and the ptsG gene.

5. The recombinant Escherichia coli according to any one of claims 1 to 4, characterized in that, Use Escherichia coli BL21(DE3) as the host.

6. A method for preparing malonic acid, characterized in that, Using glucose as the carbon source and fumaric acid as the precursor, culture the recombinant Escherichia coli according to any one of claims 1 to 4 in an aerobic environment.

7. The method according to claim 6, characterized in that, Use SOB medium as the fermentation medium, culture the recombinant Escherichia coli at 35 - 37 °C and 200 - 280 rpm for a period of time, and induce the culture with IPTG at 28 - 30 °C for at least 48 h.

8. The method according to claim 7, wherein Feed supplements are carried out during the fermentation process; the feed supplements include adding fumaric acid and glucose.

9. Use of the recombinant Escherichia coli according to any one of claims 1 to 5 or the method according to any one of claims 6 to 9 in the preparation of malonic acid or its derivative products.

10. The application according to claim 9, characterized in that, The derivative products include but are not limited to diethyl malonate, diethyl malonate, barbiturates, vitamin B1 or vitamin B6.