Adenine deaminase, base editor fusion protein containing adenine deaminase, base editor system containing adenine deaminase and application of adenine deaminase

Abstract

The invention provides adenine deaminase, a base editor fusion protein containing the adenine deaminase, a base editor system containing the adenine deaminase and application of the adenine deaminase. The adenine deaminase comprises one or more of the following sequences: (a) an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; (b) an amino acid sequence having at least 80% identity with the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3; (c) an amino acid sequence obtained by adding, substituting, deleting or inserting one or more amino acid residues into the amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3; or (d) an amino acid sequence encoded by a nucleotide sequence which hybridizes with a polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 under strict conditions. According to the adenine base editor system disclosed by the invention, the editing window can be effectively narrowed, and meanwhile, relatively high editing activity is maintained; and a very low INDEL proportion is maintained, so that the safety is improved.

Description

Technical Field

[0001] The present invention belongs to the field of gene editing, and particularly relates to an adenine deaminase, an adenine base editor fusion protein containing the same, a base editor system and their applications. Background Art

[0002] Targeted editing of nucleic acid sequences, such as targeted cleavage or targeted editing of genomic DNA, is a promising method for gene function research and may also provide new treatment methods for human genetic diseases.

[0003] Currently, about 60% of known human genetic diseases are caused by single-base mutations. Among the known 32,000 pathogenic single-base mutations, the largest proportion is the G / C to A / T mutation, accounting for about 48%. The core components of current adenine base editors that can convert A / T to G / C in genomic DNA all contain the TadA protein.

[0004] By fusing TadA (adenine deaminase) derived from Escherichia coli with Cas9, and assisted by directed evolution and protein engineering technologies, adenine base editors (ABE series) that can act on DNA are finally obtained after multiple rounds of evolution (for example, ABE7.10 (Gaudelli NM, et al. Programmable base editing of A·T to G·C in genomic DNA without DNA cleavage. Nature, 2017), ABE8.20 (Gaudelli NM, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol, 2020, CN114072496 A), ABE8e (Richter MF, et al. Phage-assisted evolution of an adenine base editor with improved cas domain compatibility and activity. Nat Biotechnol, 2020), and other mutants generated by introducing 1 or 2 amino acid mutations on the basis of ABE8e (CN115772512 A)). The amino acid sequences of these TadA mutants are very highly consistent, and compared with wild-type TadA, the maximum difference only contains 14 amino acid sites.

[0005] There is still a need in the art to explore a larger protein space to obtain base editors with higher editing efficiency and specificity, as well as different editing window preferences, so as to enrich the types of base editors to better meet the application requirements of more indication scenarios. Summary of the Invention

[0006] Technical problem

[0007] The technical problem to be solved by the present invention is to provide a novel adenine deaminase with high precision and efficiency and a relatively small editing window, an adenine base editor containing the same, and their applications. The adenine base editor of the present invention can narrow the main editing window, maintain high editing efficiency, and has a low probability of insertion-deletion (INDEL) events, with high safety.

[0008] Technical solution

[0009] On the one hand, the present invention provides an adenine deaminase comprising one or more of the following sequences:

[0010] (a) an amino acid sequence as shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3;

[0011] (b) an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3;

[0012] (c) an amino acid sequence in which one or more amino acid residues are added, substituted, deleted or inserted in the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3; or,

[0013] (d) An amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions to a polynucleotide sequence encoding an amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and the amino acid sequence retains the deaminase activity of the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3, and the stringent conditions are moderate stringent conditions, medium-high stringent conditions, high stringent conditions or very high stringent conditions.

[0014] In the present invention, the expression "retains deaminase activity", such as "retains the deaminase activity of the amino acid sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3", may completely retain the deaminase activity of the adenine deaminase of the original sequence, or may partially retain the deaminase activity of the adenosine deaminase of the original sequence, for example, retain 50%, 60%, 70%, 80%, 90%, 95%, 99% of the deaminase activity. In some other embodiments, the adenine deaminase with the modified sequence may also have a deaminase activity higher than that of the adenosine deaminase of the original sequence.

[0015] In the present invention, "moderate stringent conditions", "medium-high stringent conditions", "high stringent conditions" or "very high stringent conditions" describe the conditions for nucleic acid hybridization and washing. Guidance for performing hybridization reactions can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6, which is incorporated herein by reference.

[0016] In some embodiments, the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 1 is as shown in SEQ ID NO: 4, the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 2 is as shown in SEQ ID NO: 5, and the polynucleotide sequence encoding the amino acid sequence as shown in SEQ ID NO: 3 is as shown in SEQ ID NO: 6.

[0017] In some embodiments, the adenine deaminase may comprise an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity to SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, the adenine deaminase may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more mutations compared to the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3. In some embodiments, compared to the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, the adenine deaminase may comprise at least 5, at least 10, at least 15, at least 20, at least 30, at least 40, at least 50 identical consecutive amino acid residues. The above amino acid sequences may have the same or similar functions or biological activities as the adenine deaminase.

[0018] The adenine deaminase provided by the present invention can act on any polynucleotide, including DNA, RNA and DNA-RNA hybrids. In some embodiments, the adenine deaminase can deaminate the target adenine (A) of a polynucleotide containing DNA. In some embodiments, the adenosine deaminase can deaminate the target adenine (A) of a polynucleotide containing RNA.

[0019] On the other hand, the present invention provides an adenine base editor fusion protein, which comprises a nuclease and at least one adenine deaminase of the present invention.

[0020] In some embodiments, the adenine base editor fusion protein may further comprise a nuclear localization signal sequence. The nuclear localization signal sequence can be conventionally used in the art, for example, the nuclear localization signal sequence shown in SEQ ID NO:7.

[0021] In some embodiments, the nuclear localization signal sequence can be located at the N-terminus, C-terminus, both ends of the base editor, or between the adenine deaminase and the nuclease. In some embodiments, the nuclear localization signal sequence can be directly fused into the base editor, or fused into the base editor through a linker.

[0022] In some embodiments, the nuclease can be a Cas protein and its variants, as well as proteins such as TnpB.

[0023] In some embodiments, the Cas protein can be a Cas9 protein, a Cas12a protein, for example, spCas9 from Saccharomyces cerevisiae, SaCas9 from Staphylococcus aureus, LbCas12a from Lachnospiraceae bacterium, or enAsCas12a from Acidaminococcus bacterium; the Cas protein variant can be VQRspCas9, VRERspCas9, spRY, spNG, SaCas9KKH or SaCas9NG.

[0024] In some embodiments, the Cas9 protein, that is, the Cas9 nuclease has a partially inactivated DNA cleavage domain, that is, Cas9 is a nickase, called the "nCas9" protein. The nuclease-inactivated Cas9 protein can be interchangeably called the "dCas9" protein. Methods for generating a Cas9 protein (or a fragment thereof) with an inactivated DNA cleavage domain are known (see, e.g., Jinek et al., Science. 337:816 - 821 (2012); Qi et al., "Repurposing CRISPR as an RNA Guided Platform for Sequence Specific Control of Gene Expression" (2013) Cell. 28; 152(5):1173 - 83, the entire contents of which are incorporated herein by reference). For example, it is known that the DNA cleavage domain of Cas9 includes two subdomains, the HNH nuclease subdomain and the RuvC1 subdomain. The HNH subdomain cleaves the strand complementary to the gRNA, while the RuvC1 subdomain cleaves the non-complementary strand. Mutations within these subdomains can silence the nuclease activity of Cas9. For example, the mutations D10A and H840A completely inactivate the nuclease activity of Streptococcus pyogenes Cas9 (Jinek et al., Science. 337:816 - 821 (2012); Qi et al., Cell. 28; 152(5):1173 - 83 (2013)).

[0025] In some embodiments, the nucleotide sequence encoding the adenine base editor fusion protein can sequentially include a promoter - adenine deaminase - nuclease - polyadenylation signal (polyA), as long as it can provide an A>G editing efficiency similar to or not lower than ABE8.20; wherein, the promoter and the polyA can be those conventionally used in the art.

[0026] In some embodiments, the promoter can be CMV, or other types of broad-spectrum promoters and tissue-specific promoters, such as CAG, PGK, EF1α; the muscle-specific promoter Ctsk; the liver-specific promoter Lp1, etc.

[0027] In some embodiments, the polyA can be the bovine growth hormone polyadenylation signal BGH polyA, or a polyadenylation signal from other biological sources.

[0028] In another aspect, the present invention provides a polynucleotide encoding the aforementioned adenine deaminase or encoding the aforementioned adenine base editor fusion protein.

[0029] In yet another aspect, the present invention provides a vector comprising the aforementioned polynucleotide.

[0030] In some embodiments, the vector is a mammalian expression vector. In some embodiments, the expression vector can be one or more selected from adeno-associated virus, retroviral vector, adenoviral vector, lentiviral vector, Sendai virus vector, and herpesvirus vector.

[0031] In still another aspect, the present invention provides a cell comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, and the aforementioned vector.

[0032] In some embodiments, the cell is a prokaryotic cell or a eukaryotic cell. For example, it can be a bacterial cell, a plant cell, an insect cell, a human cell, or a mammalian cell.

[0033] In still another aspect, the present invention provides an adenine base editing system, which comprises:

[0034] the aforementioned adenine deaminase; a nuclease; and an SgRNA, or

[0035] the aforementioned adenine base editor fusion protein; and an SgRNA.

[0036] The description of the nuclease is the same as the foregoing content.

[0037] The SgRNA is used to accurately identify the target gene sequence and can be designed by those skilled in the art based on the prior art by analyzing the target gene information to select the target region to design a reasonable and effective SgRNA. The design of the SgRNA is not an innovation of the present invention, so it is not described in detail to avoid obscuring the subject matter of the present invention.

[0038] In some embodiments, the SgRNA sequence is selected from the following sequences:

[0039] SgRNA name Sequence (5’ to 3’) Site2-sense GAACACAAAGCATAGACTGC(SEQ ID NO:10) Site4-sense GTCATCTTAGTCATTACCTG(SEQ ID NO:11) Site8-sense GGTCGTAGCCAGTCCGAACCC(SEQ ID NO:12)

[0040] In another aspect, the present invention provides a pharmaceutical composition comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, and the aforementioned adenine base editor system, and a pharmaceutically acceptable carrier.

[0041] In some embodiments, the pharmaceutically acceptable carrier may be a delivery carrier, such as a lipid, a cationic lipid, or other polymers having a drug delivery function.

[0042] On the other hand, the present invention provides a kit comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, and the aforementioned adenine base editor system.

[0043] In yet another aspect, the present invention provides a delivery system comprising one or more selected from the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, and the aforementioned adenine base editor system as described above; and a delivery medium.

[0044] In some embodiments, the delivery medium may be nanoparticles, liposomes, exosomes, microvesicles, cell-penetrating peptides, etc.

[0045] In yet another aspect, the present invention provides a base editing method, which comprises the following steps:

[0046] Expressing the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, or the aforementioned adenine base editing system in a target cell, and under the guidance of SgRNA, causing gene editing of the target cell.

[0047] In some embodiments, the target cell may refer to a cell cultured in vitro or an in vivo cell, and examples thereof include but are not limited to HEK293T cells, embryonic stem cells, T cells, etc.

[0048] In yet another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit, or the aforementioned delivery system in the preparation of a base editing drug or tool.

[0049] In yet another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit, or the aforementioned delivery system in the preparation of a gene therapy drug.

[0050] In yet another aspect, the present invention provides the use of the aforementioned adenine deaminase, the aforementioned adenine base editor fusion protein, the aforementioned polynucleotide, the aforementioned vector, the aforementioned cell, the aforementioned adenine base editor system, the aforementioned pharmaceutical composition, the aforementioned kit, or the aforementioned delivery system in the construction of animal models and crop breeding.

[0051] Beneficial effect

[0052] The amino acid sequence of the adenine deaminase of the present invention has a low sequence identity with the amino acid sequences of existing adenine deaminases, greatly expanding the sequence diversity space of adenine deaminases and enriching the adenine base editor toolbox. The adenine base editor of the present invention can effectively narrow the editing window while maintaining a high editing activity; and maintain a very low INDEL ratio, improving safety, and can promote its applications in precision medicine, animal disease model production, crop genetic breeding, etc., and has great application value. Description of the Drawings

[0053] Figure 1 It is the plasmid map of ABE8.20-m.

[0054] Figure 2 It is the plasmid map of pFYF1548.

[0055] Figure 3 It is a comparison chart of the A>G base editing results of each base editor at the endogenous target site site2 in HEK293T cells.

[0056] Figure 4 It is a comparison chart of the A>G base editing results of each base editor at the endogenous target site site4 in HEK293T cells.

[0057] Figure 5 It is a comparison chart of the A>G base editing results of each base editor at the endogenous target site site8 in HEK293T cells.

[0058] Figure 6 It is the A>G base editing result of the ABE10.3 base editor at the endogenous target site site2 in HEK293T cells. Detailed Embodiments

[0059] The present invention will be further illustrated below by way of examples, but the present invention is not limited to the scope of the described examples. The experimental methods without specific conditions in the following examples are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0060] The materials, reagents, etc. used in the following examples can be obtained from commercial channels without special instructions.

[0061] The ABE8.20-m plasmid was purchased from addgene (Plasmid#136300), and its plasmid map is shown in Figure 1 .

[0062] The pFYF1548 plasmid was purchased from addgene (Plasmid#47508), and its plasmid map is shown in Figure 2 .

[0063] The pUC-GW-Amp plasmid was purchased from Ascentage.

[0064] The linearized primers used in the examples are shown in Table 1.

[0065] Table 1 ABE8.20-m linearized primers

[0066] Primer name Primer sequence ABE8-linear-for (Forward primer) tctggtggttcttctggtggttctagcggca(SEQ ID NO:8) ABE8-linear-rev (Reverse primer) ggtggcggctctccctatagtg(SEQ ID NO:9)

[0067] The SgRNA sequences used in the examples are shown in Table 2.

[0068] Table 2 SgRNA sequences

[0069] SgRNA name Sequence (5’ to 3’) Site2-sense GAACACAAAGCATAGACTGC(SEQ ID NO:10) Site4-sense GTCATCTTAGTCATTACCTG(SEQ ID NO:11) Site8-sense GGTCGTAGCCAGTCCGAACCC(SEQ ID NO:12)

[0070] The identification primers of the target sites used in the examples are shown in Table 3.

[0071] Table 3, Fragment amplification primers corresponding to SgRNA

[0072] Primer name Sequence (5’ to 3’) Number of bases Site2-for CCAGCCCCATCTGTCAAACT(SEQ ID NO:13) 20 Site2-rev TGAATGGATTCCTTGGAAACAATGA(SEQ ID NO:14) 25 Site4-for ACGTCTCATATGCCCCTTGG(SEQ ID NO:15) 20 Site4-rev ACGTAGGAATTTTGGTGGGACA(SEQ ID NO:16) 22 Site8-for GCTGCTGGAATACCGAGGAC(SEQ ID NO:17) 20 Site8-rev GCAACTCTCTTTTCTCCGGGA(SEQ ID NO:18) 21

[0073] Example 1

[0074] After replacing the TadA sequence in ABE8.20-m (hereinafter abbreviated as ABE8) with the new TadA sequences designed in the present invention (SEQ ID NO:4 and SEQ ID NO:5 sequences, synthesized by Ascentage), the new base editors were obtained, denoted as ABE10.1 and ABE10.2 respectively.

[0075] In order to compare the editing characteristics of ABE8 with ABE10.1 and ABE10.2, this example was designed.

[0076] 1.1 Design and construction of ABE10.1 and ABE10.2 plasmids

[0077] 1) Preparation of insertion fragments for homologous recombination

[0078] The pUC-GW-Amp plasmid containing pre-designed fragments (SEQ ID NO:4 or SEQ ID NO:5) was synthesized by Ascenta. The pre-designed fragments (SEQ ID NO:4 and SEQ ID NO:5) were PCR amplified from the gene synthesis universal vector pUC-GW-Amp using the Novoprotein Phanta Max Super-Fidelity DNA Polymerase kit, and homologous arms were added simultaneously for subsequent homologous recombination with the vector. The sequences of the homologous arms are forward 5’-3’ atacgactcactatagggagagccgccacc (SEQ ID NO:19) and reverse 5’-3’ tgccgctagaaccaccagaagaaccaccaga (SEQ ID NO:20).

[0079] The obtained PCR fragment was subjected to DNA electrophoresis, and the target fragment around 500 bp was excised. Then, it was recovered and purified using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 to obtain the insertion fragment for homologous recombination.

[0080] 2) Preparation of linearized base editing vector

[0081] The ABE8.20-m vector ( Figure 1 ) was linearized by inverse PCR to expose the homologous arm ends. Then, DNA electrophoresis was performed, the target fragment was excised, and it was recovered and purified by gel to obtain the vector fragment for homologous recombination.

[0082] 3) Integration

[0083] The above-mentioned insertion fragment and vector fragment were integrated by homologous recombination using NEBbuilder HiFi DNA Assembly Master Mix, and the molar ratio of the vector fragment to the insertion fragment was 1:10. Then, the integrated product was transformed into competent cells using the TransGen Biotech chemically competent cell trans-5α. The next day, 5-10 monoclonal strains were picked for sanger sequencing identification. Finally, the clones that perfectly matched the designed sequence were selected for amplification, and the base editor plasmid DNA (i.e., ABE10.1 and ABE10.2 plasmids) was extracted for subsequent experiments.

[0084] 1.2 Construction of SgRNA expression vector (SgRNA plasmid)

[0085] Select plasmid pFYF1548 as the SgRNA expression backbone and replace the original SgRNA with the target SgRNA. Downstream primer: GGTGTTTCGTCCTTTCCACAAG (SEQ ID NO:21), upstream primer: add GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC (SEQ ID NO:22) to the 3' end of the SgRNA sequence corresponding to Site2-sense. Phosphorylate the primers with T4 PNK enzyme. Perform circular PCR using the phosphorylated primers. To increase the positive clones, treat the PCR product with DpnⅠ enzyme to cut up the template plasmid. After purification with a PCR clean-up kit, ligate with T4 ligase. Transform the ligation product into trans5 E. coli competent cells, then plate, pick single colonies, shake the bacteria, extract plasmid DNA, and perform sanger sequencing for identification. The SgRNA plasmid DNA with correct sequencing alignment is used for subsequent experiments.

[0086] 1.3 Cell transfection

[0087] Use ABE8.20-m, ABE10.1, and ABE10.2 plasmids as base editor plasmids respectively and perform cell transfection together with the above-mentioned SgRNA plasmid.

[0088] Day 1: Seed a 12-well plate with HEK293T cells in good condition, seed 7x10 4 cells in each well to ensure that the cell confluence is 40% during the experiment on the next day

[0089] Day 2: Perform transfection using lipo2000 reagent. For the cells in one well, the amount of transfection reagent used is

[0090] Tube A: 50 μl of optiMEM + 5 μl of lipofectamine2000

[0091] Tube B: 50 μl of opti-MEM + 1 μg of DNA (0.5 μg of base editor plasmid + 0.5 μg of SgRNA plasmid)

[0092] Gently mix Tube A and Tube B, let stand for 15 minutes, then evenly spot on the 12-well plate and incubate for 6 hours. Observe the cell state during the medium change. Passage normally on the 5th day and harvest the cells 72 h after transfection.

[0093] 1.4 Genomic DNA extraction, amplification of target fragment, and library preparation

[0094] 72 h after cell transfection, extract the genomic DNA of the cells using the qiagen tissue&blood DNA extraction kit.

[0095] Subsequently, an amplicon library was constructed using the two-step PCR method. In the first PCR, the DNA fragment for the target editing was extracted. The operation procedure of the Novoprotein Phanta Max Super-Fidelity DNA Polymerase kit was adopted. Using the amplification primers corresponding to the edited SgRNA (Table 3), with the extracted cellular DNA as the template, PCR amplification was performed for 13 cycles to obtain the sequence near the editing site. In the second PCR, the aim was to add the Tsingke fastNGS adapter sequences at both ends. The adapter read1: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGA CAG-3’ (SEQ ID NO:23) was added to the 5’ end of the forward primer, and the adapter read2: 5’-GTCTCGTGGGCTCGG AGATGTGTATAAGAGACAG-3’ (SEQ ID NO:24) was added to the 5’ end of the reverse primer.

[0096] Using the product of the first reaction as the template, PCR amplification was performed for 13 cycles. Finally, DNA electrophoresis was carried out on the obtained PCR products, followed by gel extraction. The final products were sent to Tsingke for high-throughput sequencing, and the sequencing target depth was approximately 5000x.

[0097] 1.5 Analysis and Statistics of Second-Generation Sequencing Data

[0098] The adapters sequences were removed through the trimmomatic program to obtain clean reads. Then, the paired-end reads were mapped to the hg38 genome using bowtie2. After the alignment file was converted in format by samtools, the bam-readcount program was used to calculate the sequencing depth and mutation information at each base position in the targeted interval, and the mutation frequency and INDEL ratio were statistically analyzed.

[0099] 1.6 Result Analysis

[0100] As Figure 3 shown, the maximum editing active site of ABE8 at site2 is at A5. There are 3 base sites where the A-to-G editing ratio is greater than 15%, namely A3, A5, and A7. The maximum editing active site of ABE10.1 is at A5, and the editing ratio is higher than that of ABE8. There are 2 base sites where the A-to-G editing ratio is greater than 15%, namely A3 and A5. The maximum editing active site of ABE10.2 is also at A5, and the editing ratio is greater than that of ABE8. There is 1 base site where the A-to-G editing ratio is greater than 15%, namely A5.

[0101] In addition, ABE10.1 and ABE10.2 have a relatively low proportion of INDEL events occurring (Table 4).

[0102] The results showed that compared with ABE8.20-m, ABE10.1 and ABE10.2 had a narrower editing window, higher or similar editing activity, and a similar lower proportion of INDEL occurrence.

[0103] Table 4 INDEL ratio of editors at site2

[0104] Editor Ratio ABE8 0.08％ ABE10.1 0.14％ ABE10.2 0.12％ NC 0.00％

[0105] Example 2

[0106] In order to compare the editing characteristics of ABE8 with ABE10.1 and ABE10.2 at site4, this example was designed.

[0107] 2.1 Plasmid design and construction

[0108] In this example, except for synthesizing the sense and antisense strands of SgRNA (Table 2, site4-sense), the construction method of the SgRNA plasmid targeting site4 was as described in Example 1. The construction method of the base editing vector in this example was as described in Example 1.

[0109] 2.2 Cell transfection

[0110] The cell transfection method in this example was the same as that in Example 1.

[0111] 2.3 Target fragment amplification and library preparation

[0112] The methods of target fragment amplification and library preparation in this example were as described in Example 1.

[0113] 2.4 Second-generation sequencing data analysis and statistics

[0114] The data analysis and statistics methods in this example were as described in Example 1.

[0115] 2.5 Result analysis

[0116] As Figure 4 shown, the maximum editing activity site of ABE8 at site4 was at A4. The maximum editing activity site of ABE10.1 was at A4, and the editing ratio was higher than that of ABE8. The maximum editing activity site of ABE10.2 was also at A4, and the editing ratio was higher than that of ABE8. The editing ratios of ABE8, ABE10.1, and ABE10.2 at the A9 site were all low.

[0117] Example 3

[0118] In order to compare the editing characteristics of ABE8 with ABE10.1 and ABE10.2 at site8, this example was designed.

[0119] 2.1 Plasmid design and construction

[0120] In this example, the construction method of the SgRNA plasmid targeting site8 is as described in Example 1. In this example, except for synthesizing the sense strand and antisense strand of SgRNA (Table 2, site8-sense), the construction method of the base editing vector is as described in Example 1.

[0121] 2.2 Cell transfection

[0122] In this example, the cell transfection method is the same as that in Example 1.

[0123] 2.3 Amplification of target fragment and library preparation

[0124] In this example, the methods for amplifying the target fragment and preparing the library are as described in Example 1.

[0125] 2.4 Second-generation sequencing data analysis and statistics

[0126] In this example, the data analysis and statistics methods are as described in Example 1.

[0127] 2.5 Result analysis

[0128] As Figure 5 shown, the maximum editing active site of ABE8 at site8 is at A7. The maximum editing active site of ABE10.1 is at A7, and the editing ratio is higher than that of ABE8. The maximum editing active site of ABE10.2 is also at A7, and the editing ratio is also higher than that of ABE8. The editing ratios of ABE8, ABE10.1, and ABE10.2 at A11 and A17 sites are all relatively low.

[0129] Example 4

[0130] After replacing the TadA sequence in ABE10.1 with the SEQ ID NO:6 sequence, a new base editor is obtained, denoted as ABE10.3. In order to compare the editing characteristics of ABE8 and ABE10.3, this example is designed.

[0131] 2.1 Plasmid design and construction

[0132] In this example, the construction method of the SgRNA plasmid targeting site2 is as described in Example 1. The construction method of the base editing vector in this example is as described in Example 1, and the TadA sequence used is SEQ ID NO:6.

[0133] 2.2 Cell transfection

[0134] In this example, the cell transfection method is the same as that in Example 1, and the cell dosage is 2x10 5 cells per well.

[0135] 2.3 Amplification of the target fragment and library preparation

[0136] In this example, the method for amplifying the target fragment and preparing the library is as described in Example 1.

[0137] 2.4 Second-generation sequencing data analysis and statistics

[0138] In this example, the data analysis and statistics method is as described in Example 1.

[0139] 2.5 Result analysis

[0140] As Figure 6 shown, the maximum editing active site of ABE10.3 is at A5, and the editing ratio is higher than that of ABE8. The second-highest editing active site is at A3, and the editing ratio is higher than that of ABE8. The results show that compared with ABE8.20-m, ABE10.3 has higher or similar editing activity, and the distribution of editing activity within the editing window is different.

[0141] Sequence information

[0142] SEQ ID NO:1

[0143]

[0144] SEQ ID NO:2

[0145]

[0146] SEQ ID NO:3

[0147]

[0148] SEQ ID NO:4

[0149]

[0150]

[0151] SEQ ID NO:5

[0152]

[0153] SEQ ID NO:6

[0154]

[0155] SEQ ID NO:7

[0156]

Claims

1. An adenine deaminase, comprising one or more of the following sequences: (a) an amino acid sequence as shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3; (b) an amino acid sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3; (c) an amino acid sequence with addition, substitution, deletion or insertion of one or more amino acid residues in the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, and retaining the deamination activity of the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3; or, (d) an amino acid sequence encoded by a nucleotide sequence that hybridizes under stringent conditions with a polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, and the amino acid sequence retaining the deamination activity of the amino acid sequence shown in SEQ ID NO:1 or SEQ ID NO:2 or SEQ ID NO:3, wherein the stringent conditions are moderate stringent conditions, medium-high stringent conditions, high stringent conditions or very high stringent conditions.

2. The adenine deaminase according to claim 1, wherein The polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:1 is as shown in SEQ ID NO:4, the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:2 is as shown in SEQ ID NO:5, and the polynucleotide sequence encoding the amino acid sequence shown in SEQ ID NO:3 is as shown in SEQ ID NO:

6.

3. An adenine base editor fusion protein, comprising a nuclease and at least one adenine deaminase as claimed in claim 1 or 2.

4. The adenine base editor fusion protein according to claim 3, further comprising a nuclear localization signal sequence, preferably, the nuclear localization signal sequence is the nuclear localization signal sequence as shown in SEQ ID NO:

7.

5. The adenine base editor fusion protein according to claim 3 or 4, wherein, The nuclease is selected from Cas proteins and their variants, and TnpB proteins.

6. The adenine base editor fusion protein according to claim 3 or 4, wherein, The nucleotide sequence encoding the adenine base editor fusion protein sequentially comprises a promoter - adenine deaminase - nuclease - polyadenylation signal.

7. A polynucleotide encoding the adenine deaminase as claimed in claim 1 or 2 or encoding the adenine base editor fusion protein as claimed in any one of claims 3 to 6.

8. A vector comprising the polynucleotide as claimed in claim 7.

9. A cell comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 3 to 6, the polynucleotide as described in claim 7, and the vector as described in claim 8.

10. An adenine base editing system comprising: The adenine deaminase as described in claim 1 or 2; a nuclease; and an SgRNA, or The adenine base editor fusion protein as described in any one of claims 3 - 6; and an SgRNA.

11. A pharmaceutical composition comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, and the adenine base editor system as described in claim 10, and a pharmaceutically acceptable carrier.

12. A kit comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, and the adenine base editor system as described in claim 10.

13. A delivery system comprising one or more selected from the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, and the adenine base editor system as described in claim 10; and a delivery medium.

14. A base editing method comprising the following steps: Expressing in a target cell the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 3 to 6, or the adenine base editing system as described in claim 10, and under the guidance of an SgRNA, causing gene editing in the target cell.

15. Use of the adenine deaminase as described in claim 1 or 2, the adenine base editor fusion protein as described in any one of claims 4 to 6, the polynucleotide as described in claim 7, the vector as described in claim 8, the cell as described in claim 9, the adenine base editor system as described in claim 10, the pharmaceutical composition as described in claim 11, the kit as described in claim 12, and the delivery system as described in claim 13 in the preparation of base editing drugs or tools, the preparation of gene therapy drugs, the construction of animal models, or crop breeding.

Images