SiRNA and shRNA targeting XDH, and conjugate and medical application thereof
By targeting XDH siRNA and shRNA, specifically inhibiting XDH gene expression, the treatment problems of diseases such as hyperuricemia and gout are solved, and the effective control of uric acid production is achieved.
Patent Information
- Application Number
- CN202410031531.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-09
- Publication Date
- 2025-07-11
AI Technical Summary
The prior art is difficult to effectively inhibit the expression of xanthine dehydrogenase (XDH), resulting in the treatment problems of hyperuricemia and related diseases such as gout, gout nephropathy, uric acid stones, etc.
Develop siRNA and shRNA and their conjugates targeting XDH, and realize tissue-specific delivery and reduce uric acid production by specifically inhibiting XDH gene expression.
By targeting XDH siRNA and shRNA, it can significantly inhibit XDH expression, reduce uric acid production, and effectively treat hyperuricemia and related diseases.
Smart Images

Figure BDA0004656338380000111 
Figure BDA0004656338380000121 
Figure BDA0004656338380000131
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine. Specifically, the present invention relates to an siRNA, shRNA and their conjugates capable of inhibiting the expression of xanthine dehydrogenase (XDH), a pharmaceutical composition containing them, and their preparation methods and applications. Background Art
[0002] Hyperuricemia is the pathogenesis basis of gout. The higher the blood uric acid level, the greater the possibility of developing gout in the next 5 years. The cause of hyperuricemia in patients with primary gout is related to excessive uric acid production. Hyperuricemia refers to the excessive production and / or insufficient excretion of uric acid in the body under normal diet conditions.
[0003] High uric acid and hyperuricemia are related to increased uric acid synthesis. Xanthine dehydrogenase (XDH) is one of the key enzymes in the uric acid synthesis pathway. By inhibiting the expression of XDH, the production of uric acid can be reduced, thereby alleviating the process of hyperuricemia and related diseases. By inhibiting the expression of the XDH gene, it is possible to treat and prevent diseases caused by abnormal uric acid metabolism at the cellular level, especially hyperuricemia, gout, gouty nephropathy, and uric acid stones.
[0004] RNA interference (RNAi) refers to a phenomenon in which highly conserved in the process of evolution, homologous mRNA is efficiently and specifically degraded induced by double-stranded small interfering ribonucleic acid (siRNA). Therefore, it is of great significance to research and develop siRNA targeting XDH. Summary of the Invention
[0005] The present invention provides an siRNA, shRNA and their conjugates capable of specifically inhibiting the expression of xanthine dehydrogenase (XDH), their salts, and their pharmaceutical compositions. They can specifically target hepatocytes, thereby realizing tissue-specific delivery of nucleic acid inhibitors and realizing the treatment of human xanthine dehydrogenase-related diseases.
[0006] On the one hand, the present invention provides an siRNA or its salt. The siRNA contains a sense strand and an antisense strand. Each nucleotide in the siRNA is independently a modified or unmodified nucleotide. Among them, the sense strand contains nucleotide sequence I, the antisense strand contains nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence II are selected from a group of sequences shown in the following (1)-(72):
[0007] (1) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:74:
[0008] ACAGAGCAGUGAUAACUAC(SEQ ID NO:2)
[0009] GUAGUUAUCACUGCUCUGUdTdT(SEQ ID NO:74);
[0010] (2) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:75:
[0011] GUCUCUUAGGAGUGAGGUA(SEQ ID NO:3)
[0012] UACCUCACUCCUAAGAGACdTdT(SEQ ID NO:75);
[0013] (3) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:76:
[0014] AAUGCAGAUCCAGAGACAA(SEQ ID NO:4)
[0015] UUGUCUCUGGAUCUGCAUUdTdT(SEQ ID NO:76);
[0016] (4) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:77:
[0017] CAACCCUUUUGGCCUACCU(SEQ ID NO:5)
[0018] AGGUAGGCCAAAAGGGUUGdTdT (SEQ ID NO:77);
[0019] (5) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:78:
[0020] UUGGCCUACCUGAGAAGAA (SEQ ID NO:6)
[0021] UUCUUCUCAGGUAGGCCAAdTdT (SEQ ID NO:78);
[0022] (6) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:79:
[0023] UGGCCUACCUGAGAAGAAA (SEQ ID NO:7)
[0024] UUUCUUCUCAGGUAGGCCAdTdT (SEQ ID NO:79);
[0025] (7) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:80:
[0026] GGCCUACCUGAGAAGAAAG (SEQ ID NO:8)
[0027] CUUUCUUCUCAGGUAGGCCdTdT (SEQ ID NO:80);
[0028] The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:81:
[0029] GCCUACCUGAGAAGAAAGU(SEQ ID NO:9)
[0030] ACUUUCUUCUCAGGUAGGCdTdT(SEQ ID NO:81);
[0031] (9) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:82:
[0032] GUGACAACUGUGGAAGGAA(SEQ ID NO:10)
[0033] UUCCUUCCACAGUUGUCACdTdT(SEQ ID NO:82);
[0034] (10) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:83:
[0035] UGACAACUGUGGAAGGAAU(SEQ ID NO:11)
[0036] AUUCCUUCCACAGUUGUCAdTdT(SEQ ID NO:83);
[0037] (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:84:
[0038] GGAAUAGGAAGCACCAAGA(SEQ ID NO:12)
[0039] UCUUGGUGCUUCCUAUUCCdTdT (SEQ ID NO:84);
[0040] (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:85:
[0041] ACACACUGCUCCGGAAUCA (SEQ ID NO:13)
[0042] UGAUUCCGGAGCAGUGUGUdTdT (SEQ ID NO:85);
[0043] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:86:
[0044] CACCAUGGAGGAGAUUGAG (SEQ ID NO:14)
[0045] CUCAAUCUCCUCCAUGGUGdTdT (SEQ ID NO:86);
[0046] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:87:
[0047] CCAUGGAGGAGAUUGAGAA (SEQ ID NO:15)
[0048] UUCUCAAUCUCCUCCAUGGdTdT (SEQ ID NO:87);
[0049] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 88:
[0050] CAUGGAGGAGAUUGAGAAU(SEQ ID NO:16)
[0051] AUUCUCAAUCUCCUCCAUGdTdT(SEQ ID NO:88);
[0052] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 89:
[0053] UGUGGAGGAGAUGGGAAUA(SEQ ID NO:17)
[0054] UAUUCCCAUCUCCUCCACAdTdT(SEQ ID NO:89);
[0055] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 90:
[0056] GCAUGAACCAGAAGAAAGA(SEQ ID NO:18)
[0057] UCUUUCUUCUGGUUCAUGCdTdT SEQ ID NO:90);
[0058] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 91:
[0059] UCUCGCCAUCUUUAUUCAA(SEQ ID NO:19)
[0060] UUGAAUAAAGAUGGCGAGAdTdT (SEQ ID NO:91);
[0061] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:92:
[0062] CUCGCCAUCUUUAUUCAAA (SEQ ID NO:20)
[0063] UUUGAAUAAAGAUGGCGAGdTdT (SEQ ID NO:92);
[0064] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:93:
[0065] CCAUUUUUCCCCCAGAGUU (SEQ ID NO:21)
[0066] AACUCUGGGGGAAAAAUGGdTdT (SEQ ID NO:93);
[0067] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:94:
[0068] CUGGAUCCCUGAGCUGAAU (SEQ ID NO:22)
[0069] AUUCAGCUCAGGGAUCCAGdTdT (SEQ ID NO:94);
[0070] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:95:
[0071] UGGAUCCCUGAGCUGAAUU(SEQ ID NO:23)
[0072] AAUUCAGCUCAGGGAUCCAdTdT(SEQ ID NO:95);
[0073] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:96:
[0074] GGAUCCCUGAGCUGAAUUC(SEQ ID NO:24)
[0075] GAAUUCAGCUCAGGGAUCCdTdT(SEQ ID NO:96);
[0076] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:97:
[0077] CCCUGAGCAUUGUGGAAAA(SEQ ID NO:25)
[0078] UUUUCCACAAUGCUCAGGGdTdT(SEQ ID NO:97);
[0079] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:98:
[0080] UCCGUUGGAGGGAACAUCA(SEQ ID NO:26)
[0081] UGAUGUUCCCUCCAACGGAdTdT (SEQ ID NO:98);
[0082] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:99:
[0083] CCGUUGGAGGGAACAUCAU (SEQ ID NO:27)
[0084] AUGAUGUUCCCUCCAACGGdTdT (SEQ ID NO:99);
[0085] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:100:
[0086] UCCCUGGCUACAGAAAGAC (SEQ ID NO:28)
[0087] GUCUUUCUGUAGCCAGGGAdTdT (SEQ ID NO:100);
[0088] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:101:
[0089] AGGAGAUACUGCUCUCCAU (SEQ ID NO:29)
[0090] AUGGAGAGCAGUAUCUCCUdTdT (SEQ ID NO:101);
[0091] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102:
[0092] GGAGAUACUGCUCUCCAUA(SEQ ID NO:30)
[0093] UAUGGAGAGCAGUAUCUCCdTdT(SEQ ID NO:102);
[0094] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103:
[0095] GAGAUACUGCUCUCCAUAG(SEQ ID NO:31)
[0096] CUAUGGAGAGCAGUAUCUCdTdT(SEQ ID NO:103);
[0097] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104:
[0098] CCAUAGAGAUCCCCUACAG(SEQ ID NO:32)
[0099] CUGUAGGGGAUCUCUAUGGdTdT(SEQ ID NO:104);
[0100] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 105:
[0101] GGAAGACAAGUGUGGUAAA(SEQ ID NO:33)
[0102] UUUACCACACUUGUCUUCCdTdT(SEQ ID NO:105);
[0103] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:106:
[0104] GAAGACAAGUGUGGUAAAC(SEQ ID NO:34)
[0105] GUUUACCACACUUGUCUUCdTdT(SEQ ID NO:106);
[0106] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:107:
[0107] GCCAGUGCAACUUUACUGU(SEQ ID NO:35)
[0108] ACAGUAAAGUUGCACUGGCdTdT(SEQ ID NO:107);
[0109] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:108:
[0110] CAAGAUCAAGUCCAUAGAU(SEQ ID NO:36)
[0111] AUCUAUGGACUUGAUCUUGdTdT(SEQ ID NO:108);
[0112] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 109:
[0113] AUGAUGUUCCUGGGAGUAA(SEQ ID NO:37)
[0114] UUACUCCCAGGAACAUCAUdTdT(SEQ ID NO:109);
[0115] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 110:
[0116] GAAGAACUACCAGCCAUUA(SEQ ID NO:38)
[0117] UAAUGGCUGGUAGUUCUUCdTdT(SEQ ID NO:110);
[0118] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 111:
[0119] GACCUAAAGAAGGGGUUUU(SEQ ID NO:39)
[0120] AAAACCCCUUCUUUAGGUCdTdT(SEQ ID NO:111);
[0121] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 112:
[0122] UUCCGAAGCAGAUAAUGUU(SEQ ID NO:40)
[0123] AACAUUAUCUGCUUCGGAAdTdT(SEQ ID NO:112);
[0124] (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:113:
[0125] UCCGAAGCAGAUAAUGUUG(SEQ ID NO:41)
[0126] CAACAUUAUCUGCUUCGGAdTdT(SEQ ID NO:113);
[0127] (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:114:
[0128] CGAAGCAGAUAAUGUUGUG(SEQ ID NO:42)
[0129] CACAACAUUAUCUGCUUCGdTdT(SEQ ID NO:114);
[0130] (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:115:
[0131] GAAGCAGAUAAUGUUGUGU(SEQ ID NO:43)
[0132] ACACAACAUUAUCUGCUUCdTdT(SEQ ID NO:115);
[0133] (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116:
[0134] GCAGAUAAUGUUGUGUCAG(SEQ ID NO:44)
[0135] CUGACACAACAUUAUCUGCdTdT(SEQ ID NO:116);
[0136] (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117:
[0137] GAAGACCCAGAGCUUUGUU(SEQ ID NO:45)
[0138] AACAAAGCUCUGGGUCUUCdTdT(SEQ ID NO:117);
[0139] (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118:
[0140] CGGAUUGUGGUUCGAGUGA(SEQ ID NO:46)
[0141] UCACUCGAACCACAAUCCGdTdT(SEQ ID NO:118);
[0142] (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119:
[0143] GUGGUUCGAGUGAAGAGAA(SEQ ID NO:47)
[0144] UUCUCUUCACUCGAACCACdTdT(SEQ ID NO:119);
[0145] (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:120:
[0146] CCAGAAGCUUGAGGGUUUC(SEQ ID NO:48)
[0147] GAAACCCUCAAGCUUCUGGdTdT(SEQ ID NO:120);
[0148] (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:121:
[0149] AGGUUGACAAGUUCAACAA(SEQ ID NO:49)
[0150] UUGUUGAACUUGUCAACCUdTdT(SEQ ID NO:121);
[0151] (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:122:
[0152] GGUUGACAAGUUCAACAAG(SEQ ID NO:50)
[0153] CUUGUUGAACUUGUCAACCdTdT(SEQ ID NO:122);
[0154] (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:123:
[0155] ACAAGUUCAACAAGGAGAA(SEQ ID NO:51)
[0156] UUCUCCUUGUUGAACUUGUdTdT(SEQ ID NO:123);
[0157] (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:124:
[0158] GUUGGAAAAAGAGAGGAUU(SEQ ID NO:52)
[0159] AAUCCUCUCUUUUUCCAACdTdT(SEQ ID NO:124);
[0160] (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:125:
[0161] GGAGCCCUACUUCAUGUGU(SEQ ID NO:53)
[0162] ACACAUGAAGUAGGGCUCCdTdT(SEQ ID NO:125);
[0163] (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:126:
[0164] GAGCCCUACUUCAUGUGUA(SEQ ID NO:54)
[0165] UACACAUGAAGUAGGGCUCdTdT(SEQ ID NO:126);
[0166] (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:127:
[0167] CUGAAAAUCCCCACCUCUA(SEQ ID NO:55)
[0168] UAGAGGUGGGGAUUUUCAGdTdT(SEQ ID NO:127);
[0169] (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:128:
[0170] UGAAAAUCCCCACCUCUAA(SEQ ID NO:56)
[0171] UUAGAGGUGGGGAUUUUCAdTdT(SEQ ID NO:128);
[0172] (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:129:
[0173] UGUCAGCGCUGACCUCAAU(SEQ ID NO:57)
[0174] AUUGAGGUCAGCGCUGACAdTdT(SEQ ID NO:129);
[0175] (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:130:
[0176] AAAGGCUGGAACCCUACAA(SEQ ID NO:58)
[0177] UUGUAGGGUUCCAGCCUUUdTdT(SEQ ID NO:130);
[0178] (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:131:
[0179] GGACACAGUGAGCUUGUCU(SEQ ID NO:59)
[0180] AGACAAGCUCACUGUGUCCdTdT(SEQ ID NO:131);
[0181] (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:132:
[0182] CGACUGCCUAACAGGAGAU(SEQ ID NO:60)
[0183] AUCUCCUGUUAGGCAGUCGdTdT(SEQ ID NO:132);
[0184] (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:133:
[0185] CAGUCUAAACCCUGCCAUU(SEQ ID NO:61)
[0186] AAUGGCAGGGUUUAGACUGdTdT(SEQ ID NO:133);
[0187] (61) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:134:
[0188] ACAGGUGGAAGGGGCAUUU(SEQ ID NO:62)
[0189] AAAUGCCCCUUCCACCUGUdTdT(SEQ ID NO:134);
[0190] (62) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:135:
[0191] CCCUAGAGGAGCUACACUA(SEQ ID NO:63)
[0192] UAGUGUAGCUCCUCUAGGGdTdT(SEQ ID NO:135);
[0193] (63) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:136:
[0194] AGGCCAUCUAUGCAUCGAA(SEQ ID NO:64)
[0195] UUCGAUGCAUAGAUGGCCUdTdT(SEQ ID NO:136);
[0196] (64) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 137:
[0197] CAUGGAGCAGGAGGAACAU(SEQ ID NO:65)
[0198] AUGUUCCUCCUGCUCCAUGdTdT(SEQ ID NO:137);
[0199] (65) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 138:
[0200] GAGCAGGAGGAACAUACCA(SEQ ID NO:66)
[0201] UGGUAUGUUCCUCCUGCUCdTdT(SEQ ID NO:138);
[0202] (66) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 139:
[0203] GGAGGAACAUACCACAGAA(SEQ ID NO:67)
[0204] UUCUGUGGUAUGUUCCUCCdTdT(SEQ ID NO:139);
[0205] (67) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 140:
[0206] GAGGAACAUACCACAGAAC (SEQ ID NO:68)
[0207] GUUCUGUGGUAUGUUCCUCdTdT (SEQ ID NO:140);
[0208] (68) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:141:
[0209] GGAACAUACCACAGAACAU (SEQ ID NO:69)
[0210] AUGUUCUGUGGUAUGUUCCdTdT (SEQ ID NO:141);
[0211] (69) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:142:
[0212] UGGACAGCCUGUAUAACCU (SEQ ID NO:70)
[0213] AGGUUAUACAGGCUGUCCAdTdT (SEQ ID NO:142);
[0214] (70) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:143:
[0215] ACAGCCUGUAUAACCUCAA (SEQ ID NO:71)
[0216] UUGAGGUUAUACAGGCUGUdTdT (SEQ ID NO:143);
[0217] (71) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 144:
[0218] CAGCCUGUAUAACCUCAAG (SEQ ID NO: 72)
[0219] CUUGAGGUUAUACAGGCUGdTdT (SEQ ID NO: 144);
[0220] (72) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 145:
[0221] GAUGGUGUCUGUCCUUUGA (SEQ ID NO: 73)
[0222] UCAAAGGACAGACACCAUCdTdT (SEQ ID NO: 145).
[0223] In some embodiments, the siRNA is selected from the following double-stranded siRNAs:
[0224]
[0225]
[0226]
[0227]
[0228] On the other hand, the present invention provides an shRNA or a salt thereof, the shRNA contains a sense strand, an antisense strand, and a loop sequence separating the sense strand and the antisense strand, each nucleotide in the shRNA is independently a modified or unmodified nucleotide, wherein the sense strand contains the nucleotide sequence I, the antisense strand contains the nucleotide sequence II, the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region, and the nucleotide sequence I and the nucleotide sequence II are selected from a group of sequences shown in the following (1)-(72):
[0229] (1) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:74:
[0230] ACAGAGCAGUGAUAACUAC(SEQ ID NO:2)
[0231] GUAGUUAUCACUGCUCUGUdTdT(SEQ ID NO:74);
[0232] (2) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:75:
[0233] GUCUCUUAGGAGUGAGGUA(SEQ ID NO:3)
[0234] UACCUCACUCCUAAGAGACdTdT(SEQ ID NO:75);
[0235] (3) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:76:
[0236] AAUGCAGAUCCAGAGACAA(SEQ ID NO:4)
[0237] UUGUCUCUGGAUCUGCAUUdTdT(SEQ ID NO:76);
[0238] (4) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:77:
[0239] CAACCCUUUUGGCCUACCU(SEQ ID NO:5)
[0240] AGGUAGGCCAAAAGGGUUGdTdT (SEQ ID NO:77);
[0241] (5) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:78:
[0242] UUGGCCUACCUGAGAAGAA (SEQ ID NO:6)
[0243] UUCUUCUCAGGUAGGCCAAdTdT (SEQ ID NO:78);
[0244] (6) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:79:
[0245] UGGCCUACCUGAGAAGAAA (SEQ ID NO:7)
[0246] UUUCUUCUCAGGUAGGCCAdTdT (SEQ ID NO:79);
[0247] (7) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:80:
[0248] GGCCUACCUGAGAAGAAAG (SEQ ID NO:8)
[0249] CUUUCUUCUCAGGUAGGCCdTdT (SEQ ID NO:80);
[0250] The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:81:
[0251] GCCUACCUGAGAAGAAAGU(SEQ ID NO:9)
[0252] ACUUUCUUCUCAGGUAGGCdTdT(SEQ ID NO:81);
[0253] (9) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:82:
[0254] GUGACAACUGUGGAAGGAA(SEQ ID NO:10)
[0255] UUCCUUCCACAGUUGUCACdTdT(SEQ ID NO:82);
[0256] (10) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:83:
[0257] UGACAACUGUGGAAGGAAU(SEQ ID NO:11)
[0258] AUUCCUUCCACAGUUGUCAdTdT(SEQ ID NO:83);
[0259] (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:84:
[0260] GGAAUAGGAAGCACCAAGA(SEQ ID NO:12)
[0261] UCUUGGUGCUUCCUAUUCCdTdT (SEQ ID NO:84);
[0262] (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:85:
[0263] ACACACUGCUCCGGAAUCA (SEQ ID NO:13)
[0264] UGAUUCCGGAGCAGUGUGUdTdT (SEQ ID NO:85);
[0265] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:86:
[0266] CACCAUGGAGGAGAUUGAG (SEQ ID NO:14)
[0267] CUCAAUCUCCUCCAUGGUGdTdT (SEQ ID NO:86);
[0268] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:87:
[0269] CCAUGGAGGAGAUUGAGAA (SEQ ID NO:15)
[0270] UUCUCAAUCUCCUCCAUGGdTdT (SEQ ID NO:87);
[0271] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:88:
[0272] CAUGGAGGAGAUUGAGAAU(SEQ ID NO:16)
[0273] AUUCUCAAUCUCCUCCAUGdTdT(SEQ ID NO:88);
[0274] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:89:
[0275] UGUGGAGGAGAUGGGAAUA(SEQ ID NO:17)
[0276] UAUUCCCAUCUCCUCCACAdTdT(SEQ ID NO:89);
[0277] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:90:
[0278] GCAUGAACCAGAAGAAAGA(SEQ ID NO:18)
[0279] UCUUUCUUCUGGUUCAUGCdTdT SEQ ID NO:90);
[0280] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:91:
[0281] UCUCGCCAUCUUUAUUCAA(SEQ ID NO:19)
[0282] UUGAAUAAAGAUGGCGAGAdTdT (SEQ ID NO:91);
[0283] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:92:
[0284] CUCGCCAUCUUUAUUCAAA (SEQ ID NO:20)
[0285] UUUGAAUAAAGAUGGCGAGdTdT (SEQ ID NO:92);
[0286] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:93:
[0287] CCAUUUUUCCCCCAGAGUU (SEQ ID NO:21)
[0288] AACUCUGGGGGAAAAAUGGdTdT (SEQ ID NO:93);
[0289] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:94:
[0290] CUGGAUCCCUGAGCUGAAU (SEQ ID NO:22)
[0291] AUUCAGCUCAGGGAUCCAGdTdT (SEQ ID NO:94);
[0292] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:95:
[0293] UGGAUCCCUGAGCUGAAUU(SEQ ID NO:23)
[0294] AAUUCAGCUCAGGGAUCCAdTdT(SEQ ID NO:95);
[0295] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:96:
[0296] GGAUCCCUGAGCUGAAUUC(SEQ ID NO:24)
[0297] GAAUUCAGCUCAGGGAUCCdTdT(SEQ ID NO:96);
[0298] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:97:
[0299] CCCUGAGCAUUGUGGAAAA(SEQ ID NO:25)
[0300] UUUUCCACAAUGCUCAGGGdTdT(SEQ ID NO:97);
[0301] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:98:
[0302] UCCGUUGGAGGGAACAUCA(SEQ ID NO:26)
[0303] UGAUGUUCCCUCCAACGGAdTdT (SEQ ID NO:98);
[0304] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:99:
[0305] CCGUUGGAGGGAACAUCAU (SEQ ID NO:27)
[0306] AUGAUGUUCCCUCCAACGGdTdT (SEQ ID NO:99);
[0307] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:100:
[0308] UCCCUGGCUACAGAAAGAC (SEQ ID NO:28)
[0309] GUCUUUCUGUAGCCAGGGAdTdT (SEQ ID NO:100);
[0310] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:101:
[0311] AGGAGAUACUGCUCUCCAU (SEQ ID NO:29)
[0312] AUGGAGAGCAGUAUCUCCUdTdT (SEQ ID NO:101);
[0313] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102:
[0314] GGAGAUACUGCUCUCCAUA(SEQ ID NO:30)
[0315] UAUGGAGAGCAGUAUCUCCdTdT(SEQ ID NO:102);
[0316] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103:
[0317] GAGAUACUGCUCUCCAUAG(SEQ ID NO:31)
[0318] CUAUGGAGAGCAGUAUCUCdTdT(SEQ ID NO:103);
[0319] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104:
[0320] CCAUAGAGAUCCCCUACAG(SEQ ID NO:32)
[0321] CUGUAGGGGAUCUCUAUGGdTdT(SEQ ID NO:104);
[0322] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 105:
[0323] GGAAGACAAGUGUGGUAAA(SEQ ID NO:33)
[0324] UUUACCACACUUGUCUUCCdTdT(SEQ ID NO:105);
[0325] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:106:
[0326] GAAGACAAGUGUGGUAAAC(SEQ ID NO:34)
[0327] GUUUACCACACUUGUCUUCdTdT(SEQ ID NO:106);
[0328] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:107:
[0329] GCCAGUGCAACUUUACUGU(SEQ ID NO:35)
[0330] ACAGUAAAGUUGCACUGGCdTdT(SEQ ID NO:107);
[0331] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:108:
[0332] CAAGAUCAAGUCCAUAGAU(SEQ ID NO:36)
[0333] AUCUAUGGACUUGAUCUUGdTdT(SEQ ID NO:108);
[0334] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 109:
[0335] AUGAUGUUCCUGGGAGUAA(SEQ ID NO:37)
[0336] UUACUCCCAGGAACAUCAUdTdT(SEQ ID NO:109);
[0337] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 110:
[0338] GAAGAACUACCAGCCAUUA(SEQ ID NO:38)
[0339] UAAUGGCUGGUAGUUCUUCdTdT(SEQ ID NO:110);
[0340] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 111:
[0341] GACCUAAAGAAGGGGUUUU(SEQ ID NO:39)
[0342] AAAACCCCUUCUUUAGGUCdTdT(SEQ ID NO:111);
[0343] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 112:
[0344] UUCCGAAGCAGAUAAUGUU(SEQ ID NO:40)
[0345] AACAUUAUCUGCUUCGGAAdTdT(SEQ ID NO:112);
[0346] (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:113:
[0347] UCCGAAGCAGAUAAUGUUG(SEQ ID NO:41)
[0348] CAACAUUAUCUGCUUCGGAdTdT(SEQ ID NO:113);
[0349] (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:114:
[0350] CGAAGCAGAUAAUGUUGUG(SEQ ID NO:42)
[0351] CACAACAUUAUCUGCUUCGdTdT(SEQ ID NO:114);
[0352] (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:115:
[0353] GAAGCAGAUAAUGUUGUGU(SEQ ID NO:43)
[0354] ACACAACAUUAUCUGCUUCdTdT(SEQ ID NO:115);
[0355] (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116:
[0356] GCAGAUAAUGUUGUGUCAG(SEQ ID NO:44)
[0357] CUGACACAACAUUAUCUGCdTdT(SEQ ID NO:116);
[0358] (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117:
[0359] GAAGACCCAGAGCUUUGUU(SEQ ID NO:45)
[0360] AACAAAGCUCUGGGUCUUCdTdT(SEQ ID NO:117);
[0361] (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118:
[0362] CGGAUUGUGGUUCGAGUGA(SEQ ID NO:46)
[0363] UCACUCGAACCACAAUCCGdTdT(SEQ ID NO:118);
[0364] (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119:
[0365] GUGGUUCGAGUGAAGAGAA(SEQ ID NO:47)
[0366] UUCUCUUCACUCGAACCACdTdT(SEQ ID NO:119);
[0367] (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:120:
[0368] CCAGAAGCUUGAGGGUUUC(SEQ ID NO:48)
[0369] GAAACCCUCAAGCUUCUGGdTdT(SEQ ID NO:120);
[0370] (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:121:
[0371] AGGUUGACAAGUUCAACAA(SEQ ID NO:49)
[0372] UUGUUGAACUUGUCAACCUdTdT(SEQ ID NO:121);
[0373] (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:122:
[0374] GGUUGACAAGUUCAACAAG(SEQ ID NO:50)
[0375] CUUGUUGAACUUGUCAACCdTdT(SEQ ID NO:122);
[0376] (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:123:
[0377] ACAAGUUCAACAAGGAGAA(SEQ ID NO:51)
[0378] UUCUCCUUGUUGAACUUGUdTdT(SEQ ID NO:123);
[0379] (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:124:
[0380] GUUGGAAAAAGAGAGGAUU(SEQ ID NO:52)
[0381] AAUCCUCUCUUUUUCCAACdTdT(SEQ ID NO:124);
[0382] (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:125:
[0383] GGAGCCCUACUUCAUGUGU(SEQ ID NO:53)
[0384] ACACAUGAAGUAGGGCUCCdTdT(SEQ ID NO:125);
[0385] (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:126:
[0386] GAGCCCUACUUCAUGUGUA(SEQ ID NO:54)
[0387] UACACAUGAAGUAGGGCUCdTdT(SEQ ID NO:126);
[0388] (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:127:
[0389] CUGAAAAUCCCCACCUCUA(SEQ ID NO:55)
[0390] UAGAGGUGGGGAUUUUCAGdTdT(SEQ ID NO:127);
[0391] (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:128:
[0392] UGAAAAUCCCCACCUCUAA(SEQ ID NO:56)
[0393] UUAGAGGUGGGGAUUUUCAdTdT(SEQ ID NO:128);
[0394] (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:129:
[0395] UGUCAGCGCUGACCUCAAU(SEQ ID NO:57)
[0396] AUUGAGGUCAGCGCUGACAdTdT(SEQ ID NO:129);
[0397] (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:130:
[0398] AAAGGCUGGAACCCUACAA(SEQ ID NO:58)
[0399] UUGUAGGGUUCCAGCCUUUdTdT(SEQ ID NO:130);
[0400] (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:131:
[0401] GGACACAGUGAGCUUGUCU(SEQ ID NO:59)
[0402] AGACAAGCUCACUGUGUCCdTdT(SEQ ID NO:131);
[0403] (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:132:
[0404] CGACUGCCUAACAGGAGAU(SEQ ID NO:60)
[0405] AUCUCCUGUUAGGCAGUCGdTdT(SEQ ID NO:132);
[0406] (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:133:
[0407] CAGUCUAAACCCUGCCAUU(SEQ ID NO:61)
[0408] AAUGGCAGGGUUUAGACUGdTdT(SEQ ID NO:133);
[0409] (61) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:134:
[0410] ACAGGUGGAAGGGGCAUUU(SEQ ID NO:62)
[0411] AAAUGCCCCUUCCACCUGUdTdT(SEQ ID NO:134);
[0412] (62) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:135:
[0413] CCCUAGAGGAGCUACACUA(SEQ ID NO:63)
[0414] UAGUGUAGCUCCUCUAGGGdTdT(SEQ ID NO:135);
[0415] (63) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:136:
[0416] AGGCCAUCUAUGCAUCGAA(SEQ ID NO:64)
[0417] UUCGAUGCAUAGAUGGCCUdTdT(SEQ ID NO:136);
[0418] (64) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 137:
[0419] CAUGGAGCAGGAGGAACAU(SEQ ID NO:65)
[0420] AUGUUCCUCCUGCUCCAUGdTdT(SEQ ID NO:137);
[0421] (65) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 138:
[0422] GAGCAGGAGGAACAUACCA(SEQ ID NO:66)
[0423] UGGUAUGUUCCUCCUGCUCdTdT(SEQ ID NO:138);
[0424] (66) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 139:
[0425] GGAGGAACAUACCACAGAA(SEQ ID NO:67)
[0426] UUCUGUGGUAUGUUCCUCCdTdT(SEQ ID NO:139);
[0427] (67) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 140:
[0428] GAGGAACAUACCACAGAAC(SEQ ID NO:68)
[0429] GUUCUGUGGUAUGUUCCUCdTdT(SEQ ID NO:140);
[0430] (68) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:141:
[0431] GGAACAUACCACAGAACAU(SEQ ID NO:69)
[0432] AUGUUCUGUGGUAUGUUCCdTdT(SEQ ID NO:141);
[0433] (69) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:142:
[0434] UGGACAGCCUGUAUAACCU(SEQ ID NO:70)
[0435] AGGUUAUACAGGCUGUCCAdTdT(SEQ ID NO:142);
[0436] (70) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:143:
[0437] ACAGCCUGUAUAACCUCAA(SEQ ID NO:71)
[0438] UUGAGGUUAUACAGGCUGUdTdT(SEQ ID NO:143);
[0439] (71) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:144:
[0440] CAGCCUGUAUAACCUCAAG (SEQ ID NO:72)
[0441] CUUGAGGUUAUACAGGCUGdTdT (SEQ ID NO:144);
[0442] (72) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:145:
[0443] GAUGGUGUCUGUCCUUUGA (SEQ ID NO:73)
[0444] UCAAAGGACAGACACCAUCdTdT (SEQ ID NO:145).
[0445] In some embodiments, in the siRNA or shRNA of the present invention, each nucleotide is independently a modified or unmodified nucleotide. In some embodiments, the siRNA or shRNA of the present invention may comprise at least one modified nucleotide and / or at least one interstrand modification.
[0446] In some embodiments, all nucleotides on the sense strand are modified nucleotides.
[0447] In some embodiments, all nucleotides on the antisense strand are modified nucleotides.
[0448] In some embodiments, substantially all nucleotides on the sense and antisense strands are modified nucleotides.
[0449] In some embodiments, all nucleotides on the sense strand and all nucleotides on the antisense strand are modified nucleotides.
[0450] The modified nucleotides include, but are not limited to, modified nucleotides such as 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP, etc.
[0451] The 2'-F, 2'-OME, and 2'-MOE modifications refer to the substitution of the hydroxyl group at the 2' position of the furanosyl ring of a nucleotide by fluorine (F), methoxy (OMe), or methoxyethoxy (MOE), respectively.
[0452] The GNA modification refers to glyceronucleotide, which is composed of glycerol (DNA and RNA have pentose sugars) linked via phosphoester bonds.
[0453] The UNA modification refers to unlocked nucleic acid. UNA lacks the C2'-C3' chemical bond of the RNA ribose ring, but it can still mimic unmodified RNA when bound to the RNA double-stranded structure.
[0454] The PNA modification refers to peptide nucleic acid, a type of DNA analog that replaces the sugar-phosphate backbone with a polypeptide backbone.
[0455] The 5'-VP modification refers to the modification of the 5' end of siRNA via vinyl-phosphate.
[0456] The interstrand modifications described above include, but are not limited to, phosphorothioate, -OEt, -OME, etc. modifications. The phosphorothioate modification refers to the substitution of the hydroxyl group on the phosphate backbone by a mercapto group. The -OEt modification refers to the substitution of the hydrogen of the hydroxyl group on the phosphate backbone by an ethyl group. The -OME modification refers to the substitution of the hydrogen of the hydroxyl group on the phosphate backbone by a methyl group.
[0457] On the other hand, the present invention provides a method for preparing the above-mentioned shRNA or siRNA.
[0458] The shRNA or siRNA of the present invention can be chemically synthesized or prepared by transcribing into single-stranded RNA from an expression cassette in a recombinant nucleic acid construct. Nucleic acid inhibitors such as siRNA or shRNA (or constructs or expression vectors containing shRNA) can be delivered into cells by using appropriate transfection reagents or can also be delivered into cells by using various techniques known in the art.
[0459] On another aspect, the present invention provides a conjugate, which contains: the siRNA or shRNA of the present invention or their salts; and a conjugation group conjugated to the siRNA or shRNA.
[0460] In some embodiments, the conjugation group comprises a pharmaceutically acceptable targeting group and a linker, and the siRNA, the linker, and the targeting group are covalently or non-covalently linked in sequence.
[0461] In some embodiments, the conjugating group may be derived from a tissue-specific targeting molecule. The conjugate may be formed by chemically coupling a tissue-specific targeting molecule with a nucleic acid inhibitor. Targeting molecules capable of targeting different cell surface molecules include, but are not limited to, specifically targeted antibodies, antibody fragments, polypeptides, ligands, inhibitors, etc.
[0462] In yet another aspect, the present invention provides a pharmaceutical composition comprising the above-mentioned siRNA and / or shRNA and / or their salts, and optionally a pharmaceutically acceptable carrier.
[0463] As used herein, "pharmaceutically acceptable carrier" refers to a carrier for administering a therapeutic agent, including various excipients and diluents. In the composition, the pharmaceutically acceptable carrier may contain liquids, such as water, saline, buffer solutions, etc. Additionally, auxiliary substances may be present in these carriers, such as fillers, lubricants, glidants, wetting agents and emulsifiers, pH buffering substances, etc. The carrier may also contain cell transfection reagents.
[0464] In some embodiments, the pharmaceutical composition of the present invention may be administered in various forms, including but not limited to, intravenous administration, subcutaneous injection, intramuscular injection, transdermal administration, topical administration, implantation, sustained release administration, etc.
[0465] In the present invention, salts of the products, such as the above-mentioned siRNA and shRNA, may be alkali metal salts, such as potassium salts, sodium salts or lithium salts, or may be ammonium salts. In particular, the salt is a sodium salt.
[0466] In yet another aspect, the present invention provides a method for treating a subject who would benefit from a reduced expression of xanthine dehydrogenase (XDH), the method comprising administering to the subject a therapeutically effective amount of the siRNA and / or shRNA and / or pharmaceutical composition of the present invention.
[0467] In some embodiments, the method comprises administering to the subject a fixed dose of about 50 mg to 800 mg of the active substance of the siRNA and / or shRNA and / or pharmaceutical composition.
[0468] In yet another aspect, the present invention provides the use of the above-mentioned siRNA or shRNA or their salts or pharmaceutical composition in the preparation of a drug capable of inhibiting the expression of the xanthine dehydrogenase (XDH) gene.
[0469] In yet another aspect, the present invention provides the use of the above-mentioned siRNA or shRNA or their salts or pharmaceutical composition in the preparation of a drug for preventing or treating xanthine dehydrogenase (XDH)-related diseases or disorders.
[0470] In the present invention, the xanthine dehydrogenase (XDH)-related diseases or disorders are diseases or disorders caused by or associated with high expression of the XDH gene. The term "XDH-related diseases" includes diseases or disorders that benefit from reduced expression or replication of the XDH gene. Non-limiting examples of XDH-related diseases include diseases caused by abnormal uric acid metabolism, particularly hyperuricemia, gout, gouty nephropathy, and uric acid stones.
[0471] In another aspect, the present invention provides a method for inhibiting the expression of the xanthine dehydrogenase (XDH) gene in cells, which comprises contacting the cells with an effective amount of the siRNA, shRNA, their salts, and / or pharmaceutical compositions of the present invention, thereby inhibiting the expression of the XDH gene in the cells.
[0472] In the present invention, the cells may refer to any cell type that can benefit from reduced expression of xanthine dehydrogenase (XDH), and examples thereof include, but are not limited to, human tongue squamous carcinoma cells (CAL-27), hepatocytes, and other cell types with high XDH expression. BRIEF DESCRIPTION OF THE DRAWINGS
[0473] Figure 1 and Figure 2 shows the dual-concentration inhibitory activity results of siRNA on human XDH in human tongue squamous carcinoma cells (CAL-27) in Example 2.
[0474] Figure 3 and Figure 4 shows the multi-concentration point inhibitory activity results of siRNA on human XDH in human tongue squamous carcinoma cells (CAL-27) in Example 3. DETAILED DESCRIPTION OF THE INVENTION
[0475] Hereinafter, the specific embodiments of the present invention will be described in detail. It should be understood that the specific embodiments described herein are only for the purpose of illustrating and explaining the present invention, and are not intended to limit the present invention.
[0476] In the invention, the xanthine dehydrogenase (XDH) mRNA refers to the mRNA having the sequence shown in Genbank accession number NM_000379.4. Further, unless otherwise specified, the term "target gene" used in the present invention refers to the gene that transcribes the above XDH mRNA, and the term "target mRNA" refers to the above XDH mRNA. In some embodiments, the nucleotide sequence of the XDH gene is as shown in SEQ ID NO:1.
[0477] DEFINITIONS
[0478] As used in the present invention, the term "link" or "linked", when referring to the connection between two molecules, means that the two molecules are connected by a covalent bond or the two molecules are associated via a non-covalent bond (e.g., hydrogen bond or ionic bond).
[0479] As used in the present invention, the term "inhibit" or "inhibiting", when referring to the expression of a given gene, means that the gene expression is reduced when a cell, cell population or tissue is treated with the siRNA, shRNA, conjugate and pharmaceutical composition of the present invention, compared to a cell, cell population or tissue that has not been so treated.
[0480] The terms "inhibit", "reduce", "silence", "down-regulate" and other similar terms as used in the present invention are used interchangeably and include any level of inhibition. Preferably, inhibition includes statistically significant inhibition or clinically significant inhibition.
[0481] As used in the present invention, the phrase "inhibit the expression of XDH" or "inhibit the expression of the XDH gene" includes inhibiting the expression of any XDH gene (e.g., the XDH gene expressed by an expression construct in a cell) and variants or mutants of the XDH gene encoding the XDH protein.
[0482] Each nucleotide in the sense strand and the antisense strand is independently a modified or unmodified nucleotide.
[0483] In the context of the present invention, the expressions "complementary" or "reverse complementary" are used interchangeably and have the meanings well known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one strand pair with the bases of the other strand in a complementary manner. In DNA, the purine base adenine (A) always pairs with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (G) always pairs with the pyrimidine base cytosine (C). Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are considered to be complementary to each other, and the sequence of one strand can be deduced from the sequence of its complementary strand. Correspondingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at corresponding positions do not pair in a complementary form.
[0484] As used hereinabove and hereinafter, unless otherwise specified, "substantially reverse complementary" means that there are no more than 3 base mismatches between two nucleotide sequences involved; "essentially reverse complementary" means that there is no more than 1 base mismatch between two nucleotide sequences; "fully reverse complementary" means that there is no base mismatch between two nucleotide sequences. As used hereinabove and hereinafter, when a nucleotide sequence has a "nucleotide difference" from another nucleotide sequence, it means that compared with the latter, the base type of the nucleotide at the same position has changed. For example, when a nucleobase in the latter is A, if the corresponding nucleobase at the same position in the former is U, C, G or T, it is determined that there is a nucleotide difference between the two nucleotide sequences at this position. In some embodiments, when a nucleotide at the original position is replaced by a non-nucleotide base or its equivalent, a nucleotide difference is also considered to have occurred at this position.
[0485] As used hereinabove and hereinafter, especially when describing the preparation methods of the siRNAs and pharmaceutical compositions containing siRNAs of the present invention, unless otherwise specified, the "nucleoside monomer" refers to the modified or unmodified RNA phosphoramidite monomers (sometimes RNA phosphoramidites are also referred to as Nucleoside phosphoramidites) used in the phosphoramidite solid-phase synthesis according to the types and sequences of nucleotides in the siRNA to be prepared. The phosphoramidite solid-phase synthesis is a method used in RNA synthesis well-known to those skilled in the art. The nucleoside monomers used in the present invention can all be commercially purchased.
[0486] As used herein, "optional" or "optionally" means that the event or condition described thereafter may or may not occur, and this description includes the cases where the event or condition occurs and the cases where it does not occur. For example, "optionally substituted" "alkyl" includes "alkyl" and "substituted alkyl" as defined hereinafter. Those skilled in the art will understand that for any group containing one or more substituents, these groups are not intended to introduce any substitutions or substitution patterns that are spatially unrealistic, synthetically infeasible, and / or inherently unstable.
[0487] The term "subject", as used herein, refers to any animal, such as a mammal or a marsupial. The subjects of the present invention include, but are not limited to, humans, non-human primates (e.g., monkeys and orangutans), mice, rabbits, dogs, cats, pigs, horses, cows, rats, or any kind of poultry.
[0488] As used herein, "treatment" refers to a method of obtaining a beneficial or desired result, including but not limited to a therapeutic benefit. "Therapeutic benefit" means eradicating or ameliorating the underlying disorder being treated. Additionally, a therapeutic benefit is obtained by observing an improvement in a subject through eradicating or ameliorating one or more physiological symptoms associated with the underlying disorder, even though the subject may still be afflicted with the underlying disorder. "Improvement" refers to a reduction in at least one indicator, marker, sign, and / or symptom of the relevant disease, disorder, or condition. In certain embodiments, improvement includes delaying or slowing the progression of one or more indicators of a condition, disorder, and / or disease. The severity of an indicator can be determined by subjective or objective measures known to those skilled in the art.
[0489] The term "xanthine dehydrogenase-related disease and / or disorder" or "XDH-related disease" as used in the present invention refers to a disease or disorder caused by or associated with high expression of the XDH gene. The term "XDH-related disease" includes diseases or disorders that benefit from reduced XDH gene expression or replication. Non-limiting examples of XDH-related diseases include diseases caused by abnormal uric acid metabolism, particularly hyperuricemia, gout, gouty nephropathy, uric acid stones, etc.
[0490] The present invention will be further described below in conjunction with examples, but these examples do not limit the scope of the present invention. For the experimental methods without specific conditions noted in the examples of the present invention, they are generally carried out under conventional conditions or according to the conditions recommended by the raw material or commodity manufacturer. For reagents without specific sources noted, the reagents can be obtained from any supplier of molecular biology reagents in the quality / purity for molecular biology applications.
[0491] Example 1 Sequence Design of Human XDH siRNA
[0492] Using the human (Homo sapiens) XDH gene (NM_000379.4, SEQ ID NO:1) as the target gene, 19 / 19nt siRNAs were designed to meet the general rules of active siRNAs, and two thymidine deoxyribonucleic acids were added to the 3' end of the antisense strand. The sequences of the unmodified sense strand and antisense strand are shown in Table 1.
[0493] Table 1. Unmodified Sense Strand and Antisense Strand of Human siRNA
[0494]
[0495]
[0496]
[0497] Example 2 Inhibition of XDH by siRNA in Human Tongue Squamous Carcinoma Cells (CAL-27) - Inhibitory Activity at Two Concentration Points
[0498] A dose experiment was conducted in human tongue squamous carcinoma cells (CAL-27) at two concentrations, namely, final duplex concentrations of 10 nM and 0.1 nM. See Tables 3 and 4 for experimental consumables.
[0499] Twenty-four hours before transfection, CAL-27 cells were plated at approximately 20,000 cells / well on a 96-well plate, with 100 μL of medium per well. At the time of transfection, siRNA was transfected using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the product instruction manual. The gradient final concentrations of siRNA transfection were 10 nM and 0.1 nM. After 24 hours of treatment, total cellular RNA was extracted using a high-throughput cell RNA extraction kit (QIAGEN, RNeasy 96Kit), and RNA reverse transcription experiments (Takara PrimeScript TM II 1st Strand cDNA Synthesis Kit (6210A) and quantitative real-time PCR (TaqMan TM Fast Advanced Master Mix (4444557) were performed for detection. See Table 3 for Taqman probe primer information. The mRNA level of human XDH was measured, and the mRNA level of human XDH was corrected according to the GAPDH housekeeping gene level.
[0500] After the Taqman probe Q-PCR detection experiment, the corresponding Ct value was obtained according to the threshold automatically set by the system. The expression of a certain gene can be relatively quantified by comparing Ct values: the comparative Ct refers to calculating the gene expression difference by the difference between the Ct value of the target gene and the Ct value of the housekeeping gene, which is also called 2 -ΔΔCt , ΔΔCt = [(Ct of the target gene in the experimental group - Ct of the housekeeping gene in the experimental group) - (Ct of the target gene in the control group - Ct of the housekeeping gene in the control group)]. Inhibition rate (%) = (1 - remaining amount of target gene expression) * 100%.
[0501] Table 3. Experimental consumables for cell activity screening (nucleic acid extractor)
[0502] Name Company Article Number / Model Lipofectamine RNAi Max Invitrogen 13778150 High-throughput Cell RNA Extraction Kit QIAGEN 74181 <![CDATA[PrimeScript TM II 1st Strand cDNA Synthesis Kit]]> Takara 6210B(A×4) <![CDATA[TaqMan TM Fast Advanced Master Mix]]> Thermo 4444964
[0503] Table 4. Taqman probe primer information table
[0504] Primer Name SEQ ID NO: Sequence Information hGAPDH-F 146 GCTCCTCCTGTTCGACAGTCAG hGAPDH-R 147 CAGGCGCCCAATACGACCAAATC hGAPDH-P 148 TTGACTCCGACCTTCACCTTCCCCATGG hXDH-F 149 AGTCTTTGCGAAGGATAAGGTTAC hXDH-R 150 AATGGCTGGTAGTTCTTCATAGGT hXDH-P 151 TTGGGCATATCATTGGTGCTGTGGTTG
[0505] The results are expressed as the percentage of remaining human XDH mRNA expression in cells relative to the control (cells untreated with siRNA). The IC of the inhibition rate 50 The results are shown in Table 5 and Figure 1, Figure 2 .
[0506] Table 5. Results of the dual-concentration inhibitory activity of siRNA on human XDH in human tongue squamous carcinoma cells (CAL-27)
[0507]
[0508]
[0509] Example 3. Inhibition of XDH by siRNA in human tongue squamous carcinoma cells (CAL-27) - Multi-concentration point inhibitory activity
[0510] A dose-response experiment was conducted using 7 concentration gradients of siRNA in human tongue squamous carcinoma cells (CAL-27).
[0511] Twenty-four hours before transfection, MCF7 cells were seeded at approximately 20,000 cells / well in a 96-well plate, with 100 μL of medium per well. At the time of transfection, siRNA was transfected using Lipofectamine RNAi MAX (ThermoFisher, 13778150) according to the product instruction manual. The final gradient concentrations of siRNA transfection were 10, 2.5, 0.625, 0.1563, 0.0391, 0.0098, and 0.0024 nM. After 24 hours of treatment, total cellular RNA was extracted using a high-throughput cell RNA extraction kit, followed by RNA reverse transcription and quantitative real-time PCR assays to determine the mRNA level of human XDH. The mRNA level of human XDH was corrected according to the internal reference gene level of GAPDH.
[0512] The results were expressed as the remaining percentage of human XDH mRNA expression relative to cells treated with the control (untreated with siRNA). The IC of the inhibition rate 50 The results are shown in Table 7, Table 8, and Figure 3 and Figure 4 . The experimental operations refer to Example 2.
[0513] Table 7. Inhibitory activity of siRNA on the mRNA concentration of human XDH in CAL-27 cells
[0514]
[0515] SEQ ID NO:1
[0516]
Claims
1. An siRNA or a salt thereof, the siRNA comprising a sense strand and an antisense strand, each nucleotide in the siRNA being independently a modified or unmodified nucleotide, wherein, The sense strand contains nucleotide sequence I, the antisense strand contains nucleotide sequence II, and nucleotide sequence I and nucleotide sequence II are at least partially reverse complementary to form a double-stranded region. Nucleotide sequence I and nucleotide sequence II are selected from one of the sequences shown in (1)-(72) below: (1) Nucleotide sequence I contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:2, and nucleotide sequence II contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:74: ACAGAGCAGUGAUAACUAC (SEQ ID NO:2) GUAGUUAUCACUGCUCUGUdTdT (SEQ ID NO:74); (2) Nucleotide sequence I contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:3, and nucleotide sequence II contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:75: GUCUCUUAGGAGUGAGGUA (SEQ ID NO:3) UACCUCACUCCUAAGAGACdTdT (SEQ ID NO:75); (3) Nucleotide sequence I contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:4, and nucleotide sequence II contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:76: AAUGCAGAUCCAGAGACAA (SEQ ID NO:4) UUGUCUCUGGAUCUGCAUUdTdT (SEQ ID NO:76); (4) Nucleotide sequence I contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:5, and nucleotide sequence II contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:77: CAACCCUUUUGGCCUACCU (SEQ ID NO:5) AGGUAGGCCAAAAGGGUUGdTdT (SEQ ID NO:77); (5) Nucleotide sequence I contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:6, and nucleotide sequence II contains at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:78: UUGGCCUACCUGAGAAGAA(SEQ ID NO:6) UUCUUCUCAGGUAGGCCAAdTdT(SEQ ID NO:78); (6) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:79: UGGCCUACCUGAGAAGAAA(SEQ ID NO:7) UUUCUUCUCAGGUAGGCCAdTdT(SEQ ID NO:79); (7) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:80: GGCCUACCUGAGAAGAAAG(SEQ ID NO:8) CUUUCUUCUCAGGUAGGCCdTdT(SEQ ID NO:80); (8) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:81: GCCUACCUGAGAAGAAAGU(SEQ ID NO:9) ACUUUCUUCUCAGGUAGGCdTdT(SEQ ID NO:81); (9) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:82: GUGACAACUGUGGAAGGAA(SEQ ID NO:10) UUCCUUCCACAGUUGUCACdTdT(SEQ ID NO:82); (10) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:83: UGACAACUGUGGAAGGAAU(SEQ ID NO:11) AUUCCUUCCACAGUUGUCAdTdT (SEQ ID NO:83); (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:84: GGAAUAGGAAGCACCAAGA (SEQ ID NO:12) UCUUGGUGCUUCCUAUUCCdTdT (SEQ ID NO:84); (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:85: ACACACUGCUCCGGAAUCA (SEQ ID NO:13) UGAUUCCGGAGCAGUGUGUdTdT (SEQ ID NO:85); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:86: CACCAUGGAGGAGAUUGAG (SEQ ID NO:14) CUCAAUCUCCUCCAUGGUGdTdT (SEQ ID NO:86); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:87: CCAUGGAGGAGAUUGAGAA (SEQ ID NO:15) UUCUCAAUCUCCUCCAUGGdTdT (SEQ ID NO:87); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:88: CAUGGAGGAGAUUGAGAAU (SEQ ID NO:16) AUUCUCAAUCUCCUCCAUGdTdT (SEQ ID NO:88); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:89: UGUGGAGGAGAUGGGAAUA (SEQ ID NO:17) UAUUCCCAUCUCCUCCACAdTdT (SEQ ID NO:89); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:90: GCAUGAACCAGAAGAAAGA (SEQ ID NO:18) UCUUUCUUCUGGUUCAUGCdTdT SEQ ID NO:90); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:91: UCUCGCCAUCUUUAUUCAA (SEQ ID NO:19) UUGAAUAAAGAUGGCGAGAdTdT (SEQ ID NO:91); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:92: CUCGCCAUCUUUAUUCAAA (SEQ ID NO:20) UUUGAAUAAAGAUGGCGAGdTdT (SEQ ID NO:92); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:93: CCAUUUUUCCCCCAGAGUU (SEQ ID NO:21) AACUCUGGGGGAAAAAUGGdTdT(SEQ ID NO:93); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:94: CUGGAUCCCUGAGCUGAAU(SEQ ID NO:22) AUUCAGCUCAGGGAUCCAGdTdT(SEQ ID NO:94); (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:95: UGGAUCCCUGAGCUGAAUU(SEQ ID NO:23) AAUUCAGCUCAGGGAUCCAdTdT(SEQ ID NO:95); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:96: GGAUCCCUGAGCUGAAUUC(SEQ ID NO:24) GAAUUCAGCUCAGGGAUCCdTdT(SEQ ID NO:96); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:97: CCCUGAGCAUUGUGGAAAA(SEQ ID NO:25) UUUUCCACAAUGCUCAGGGdTdT(SEQ ID NO:97); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:98: UCCGUUGGAGGGAACAUCA(SEQ ID NO:26) UGAUGUUCCCUCCAACGGAdTdT (SEQ ID NO:98); (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:99: CCGUUGGAGGGAACAUCAU (SEQ ID NO:27) AUGAUGUUCCCUCCAACGGdTdT (SEQ ID NO:99); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:100: UCCCUGGCUACAGAAAGAC (SEQ ID NO:28) GUCUUUCUGUAGCCAGGGAdTdT (SEQ ID NO:100); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:101: AGGAGAUACUGCUCUCCAU (SEQ ID NO:29) AUGGAGAGCAGUAUCUCCUdTdT (SEQ ID NO:101); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:102: GGAGAUACUGCUCUCCAUA (SEQ ID NO:30) UAUGGAGAGCAGUAUCUCCdTdT (SEQ ID NO:102); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:103: GAGAUACUGCUCUCCAUAG (SEQ ID NO:31) CUAUGGAGAGCAGUAUCUCdTdT(SEQ ID NO:103); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:104: CCAUAGAGAUCCCCUACAG(SEQ ID NO:32) CUGUAGGGGAUCUCUAUGGdTdT(SEQ ID NO:104); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:105: GGAAGACAAGUGUGGUAAA(SEQ ID NO:33) UUUACCACACUUGUCUUCCdTdT(SEQ ID NO:105); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:106: GAAGACAAGUGUGGUAAAC(SEQ ID NO:34) GUUUACCACACUUGUCUUCdTdT(SEQ ID NO:106); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:107: GCCAGUGCAACUUUACUGU(SEQ ID NO:35) ACAGUAAAGUUGCACUGGCdTdT(SEQ ID NO:107); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:108: CAAGAUCAAGUCCAUAGAU(SEQ ID NO:36) AUCUAUGGACUUGAUCUUGdTdT(SEQ ID NO:108); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:109: AUGAUGUUCCUGGGAGUAA(SEQ ID NO:37) UUACUCCCAGGAACAUCAUdTdT(SEQ ID NO:109); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:110: GAAGAACUACCAGCCAUUA(SEQ ID NO:38) UAAUGGCUGGUAGUUCUUCdTdT(SEQ ID NO:110); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:111: GACCUAAAGAAGGGGUUUU(SEQ ID NO:39) AAAACCCCUUCUUUAGGUCdTdT(SEQ ID NO:111); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:112: UUCCGAAGCAGAUAAUGUU(SEQ ID NO:40) AACAUUAUCUGCUUCGGAAdTdT(SEQ ID NO:112); (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:113: UCCGAAGCAGAUAAUGUUG(SEQ ID NO:41) CAACAUUAUCUGCUUCGGAdTdT (SEQ ID NO:113); (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:114: CGAAGCAGAUAAUGUUGUG (SEQ ID NO:42) CACAACAUUAUCUGCUUCGdTdT (SEQ ID NO:114); (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:115: GAAGCAGAUAAUGUUGUGU (SEQ ID NO:43) ACACAACAUUAUCUGCUUCdTdT (SEQ ID NO:115); (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:116: GCAGAUAAUGUUGUGUCAG (SEQ ID NO:44) CUGACACAACAUUAUCUGCdTdT (SEQ ID NO:116); (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:117: GAAGACCCAGAGCUUUGUU (SEQ ID NO:45) AACAAAGCUCUGGGUCUUCdTdT (SEQ ID NO:117); (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides having optionally no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:118: CGGAUUGUGGUUCGAGUGA (SEQ ID NO:46) UCACUCGAACCACAAUCCGdTdT(SEQ ID NO:118); (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:119: GUGGUUCGAGUGAAGAGAA(SEQ ID NO:47) UUCUCUUCACUCGAACCACdTdT(SEQ ID NO:119); (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:120: CCAGAAGCUUGAGGGUUUC(SEQ ID NO:48) GAAACCCUCAAGCUUCUGGdTdT(SEQ ID NO:120); (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:121: AGGUUGACAAGUUCAACAA(SEQ ID NO:49) UUGUUGAACUUGUCAACCUdTdT(SEQ ID NO:121); (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:122: GGUUGACAAGUUCAACAAG(SEQ ID NO:50) CUUGUUGAACUUGUCAACCdTdT(SEQ ID NO:122); (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:123: ACAAGUUCAACAAGGAGAA(SEQ ID NO:51) UUCUCCUUGUUGAACUUGUdTdT(SEQ ID NO:123); (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:124: GUUGGAAAAAGAGAGGAUU(SEQ ID NO:52) AAUCCUCUCUUUUUCCAACdTdT(SEQ ID NO:124); (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:125: GGAGCCCUACUUCAUGUGU(SEQ ID NO:53) ACACAUGAAGUAGGGCUCCdTdT(SEQ ID NO:125); (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:126: GAGCCCUACUUCAUGUGUA(SEQ ID NO:54) UACACAUGAAGUAGGGCUCdTdT(SEQ ID NO:126); (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:127: CUGAAAAUCCCCACCUCUA(SEQ ID NO:55) UAGAGGUGGGGAUUUUCAGdTdT(SEQ ID NO:127); (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:128: UGAAAAUCCCCACCUCUAA(SEQ ID NO:56) UUAGAGGUGGGGAUUUUCAdTdT (SEQ ID NO:128); (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:129: UGUCAGCGCUGACCUCAAU (SEQ ID NO:57) AUUGAGGUCAGCGCUGACAdTdT (SEQ ID NO:129); (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:130: AAAGGCUGGAACCCUACAA (SEQ ID NO:58) UUGUAGGGUUCCAGCCUUUdTdT (SEQ ID NO:130); (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:131: GGACACAGUGAGCUUGUCU (SEQ ID NO:59) AGACAAGCUCACUGUGUCCdTdT (SEQ ID NO:131); (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:132: CGACUGCCUAACAGGAGAU (SEQ ID NO:60) AUCUCCUGUUAGGCAGUCGdTdT (SEQ ID NO:132); (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:133: CAGUCUAAACCCUGCCAUU (SEQ ID NO:61) AAUGGCAGGGUUUAGACUGdTdT (SEQ ID NO:133); (61) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:134: ACAGGUGGAAGGGGCAUUU (SEQ ID NO:62) AAAUGCCCCUUCCACCUGUdTdT (SEQ ID NO:134); (62) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:135: CCCUAGAGGAGCUACACUA (SEQ ID NO:63) UAGUGUAGCUCCUCUAGGGdTdT (SEQ ID NO:135); (63) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:136: AGGCCAUCUAUGCAUCGAA (SEQ ID NO:64) UUCGAUGCAUAGAUGGCCUdTdT (SEQ ID NO:136); (64) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:137: CAUGGAGCAGGAGGAACAU (SEQ ID NO:65) AUGUUCCUCCUGCUCCAUGdTdT (SEQ ID NO:137); (65) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:138: GAGCAGGAGGAACAUACCA (SEQ ID NO:66) UGGUAUGUUCCUCCUGCUCdTdT(SEQ ID NO:138); (66) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:139: GGAGGAACAUACCACAGAA(SEQ ID NO:67) UUCUGUGGUAUGUUCCUCCdTdT(SEQ ID NO:139); (67) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:140: GAGGAACAUACCACAGAAC(SEQ ID NO:68) GUUCUGUGGUAUGUUCCUCdTdT(SEQ ID NO:140); (68) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:141: GGAACAUACCACAGAACAU(SEQ ID NO:69) AUGUUCUGUGGUAUGUUCCdTdT(SEQ ID NO:141); (69) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:142: UGGACAGCCUGUAUAACCU(SEQ ID NO:70) AGGUUAUACAGGCUGUCCAdTdT(SEQ ID NO:142); (70) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:143: ACAGCCUGUAUAACCUCAA(SEQ ID NO:71) UUGAGGUUAUACAGGCUGUdTdT(SEQ ID NO:143); (71) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:144: CAGCCUGUAUAACCUCAAG(SEQ ID NO:72) CUUGAGGUUAUACAGGCUGdTdT(SEQ ID NO:144); (72) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:145: GAUGGUGUCUGUCCUUUGA(SEQ ID NO:73) UCAAAGGACAGACACCAUCdTdT(SEQ ID NO:145).
2. The siRNA or a salt thereof according to claim 1, wherein the siRNA is selected from the following double-stranded siRNAs:
3. The siRNA or its salt according to claim 1 or 2, wherein, The siRNA comprises at least one modified nucleotide and / or at least one inter-strand modification, Preferably, all nucleotides on the sense strand are modified nucleotides, and / or all nucleotides on the antisense strand are modified nucleotides, More preferably, substantially all nucleotides on the sense strand and the antisense strand are modified nucleotides, Even more preferably, all nucleotides on the sense strand and all nucleotides on the antisense strand are modified nucleotides. In particular, the modified nucleotides are selected from 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP modified nucleotides; the inter-strand modifications are selected from phosphorothioate, -OEt, -OME modifications.
4. An shRNA or a salt thereof, wherein the shRNA contains a sense strand, an antisense strand, and a loop sequence separating the sense strand and the antisense strand, and each nucleotide in the shRNA is independently a modified or unmodified nucleotide, wherein, The sense strand contains the nucleotide sequence I, the antisense strand contains the nucleotide sequence II, and the nucleotide sequence I and the nucleotide sequence II are at least partially reverse complementary to form a double-stranded region. The nucleotide sequence I and the nucleotide sequence II are selected from one of the sequences shown in (1)-(72) below: (1) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:2, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:74: ACAGAGCAGUGAUAACUAC(SEQ ID NO:2) GUAGUUAUCACUGCUCUGUdTdT(SEQ ID NO:74); (2) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 3, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 75: GUCUCUUAGGAGUGAGGUA (SEQ ID NO: 3) UACCUCACUCCUAAGAGACdTdT (SEQ ID NO: 75); (3) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 4, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 76: AAUGCAGAUCCAGAGACAA (SEQ ID NO: 4) UUGUCUCUGGAUCUGCAUUdTdT (SEQ ID NO: 76); (4) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 5, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 77: CAACCCUUUUGGCCUACCU (SEQ ID NO: 5) AGGUAGGCCAAAAGGGUUGdTdT (SEQ ID NO: 77); (5) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 6, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 78: UUGGCCUACCUGAGAAGAA (SEQ ID NO: 6) UUCUUCUCAGGUAGGCCAAdTdT (SEQ ID NO: 78); (6) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 7, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 79: UGGCCUACCUGAGAAGAAA (SEQ ID NO: 7) UUUCUUCUCAGGUAGGCCAdTdT (SEQ ID NO: 79); (7) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:8, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:80: GGCCUACCUGAGAAGAAAG(SEQ ID NO:8) CUUUCUUCUCAGGUAGGCCdTdT(SEQ ID NO:80); (8) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:9, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:81: GCCUACCUGAGAAGAAAGU(SEQ ID NO:9) ACUUUCUUCUCAGGUAGGCdTdT(SEQ ID NO:81); (9) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:10, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:82: GUGACAACUGUGGAAGGAA(SEQ ID NO:10) UUCCUUCCACAGUUGUCACdTdT(SEQ ID NO:82); (10) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:11, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:83: UGACAACUGUGGAAGGAAU(SEQ ID NO:11) AUUCCUUCCACAGUUGUCAdTdT(SEQ ID NO:83); (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:12, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:84: GGAAUAGGAAGCACCAAGA(SEQ ID NO:12) UCUUGGUGCUUCCUAUUCCdTdT(SEQ ID NO:84); (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 13, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 85: ACACACUGCUCCGGAAUCA (SEQ ID NO: 13) UGAUUCCGGAGCAGUGUGUdTdT (SEQ ID NO: 85); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 14, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 86: CACCAUGGAGGAGAUUGAG (SEQ ID NO: 14) CUCAAUCUCCUCCAUGGUGdTdT (SEQ ID NO: 86); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 15, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 87: CCAUGGAGGAGAUUGAGAA (SEQ ID NO: 15) UUCUCAAUCUCCUCCAUGGdTdT (SEQ ID NO: 87); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 16, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 88: CAUGGAGGAGAUUGAGAAU (SEQ ID NO: 16) AUUCUCAAUCUCCUCCAUGdTdT (SEQ ID NO: 88); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 17, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 89: UGUGGAGGAGAUGGGAAUA (SEQ ID NO: 17) UAUUCCCAUCUCCUCCACAdTdT (SEQ ID NO: 89); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:18, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:90: GCAUGAACCAGAAGAAAGA (SEQ ID NO:18) UCUUUCUUCUGGUUCAUGCdTdT (SEQ ID NO:90); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:19, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:91: UCUCGCCAUCUUUAUUCAA (SEQ ID NO:19) UUGAAUAAAGAUGGCGAGAdTdT (SEQ ID NO:91); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:20, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:92: CUCGCCAUCUUUAUUCAAA (SEQ ID NO:20) UUUGAAUAAAGAUGGCGAGdTdT (SEQ ID NO:92); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:21, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:93: CCAUUUUUCCCCCAGAGUU (SEQ ID NO:21) AACUCUGGGGGAAAAAUGGdTdT (SEQ ID NO:93); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:22, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:94: CUGGAUCCCUGAGCUGAAU (SEQ ID NO:22) AUUCAGCUCAGGGAUCCAGdTdT (SEQ ID NO:94); The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 23, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 95: UGGAUCCCUGAGCUGAAUU(SEQ ID NO:23) AAUUCAGCUCAGGGAUCCAdTdT(SEQ ID NO:95); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 24, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 96: GGAUCCCUGAGCUGAAUUC(SEQ ID NO:24) GAAUUCAGCUCAGGGAUCCdTdT(SEQ ID NO:96); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 25, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 97: CCCUGAGCAUUGUGGAAAA(SEQ ID NO:25) UUUUCCACAAUGCUCAGGGdTdT(SEQ ID NO:97); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 26, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 98: UCCGUUGGAGGGAACAUCA(SEQ ID NO:26) UGAUGUUCCCUCCAACGGAdTdT(SEQ ID NO:98); (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 99: CCGUUGGAGGGAACAUCAU(SEQ ID NO:27) AUGAUGUUCCCUCCAACGGdTdT(SEQ ID NO:99); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 28, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 100: UCCCUGGCUACAGAAAGAC (SEQ ID NO: 28) GUCUUUCUGUAGCCAGGGAdTdT (SEQ ID NO: 100); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 29, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 101: AGGAGAUACUGCUCUCCAU (SEQ ID NO: 29) AUGGAGAGCAGUAUCUCCUdTdT (SEQ ID NO: 101); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 30, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 102: GGAGAUACUGCUCUCCAUA (SEQ ID NO: 30) UAUGGAGAGCAGUAUCUCCdTdT (SEQ ID NO: 102); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 31, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 103: GAGAUACUGCUCUCCAUAG (SEQ ID NO: 31) CUAUGGAGAGCAGUAUCUCdTdT (SEQ ID NO: 103); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 32, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 104: CCAUAGAGAUCCCCUACAG (SEQ ID NO: 32) CUGUAGGGGAUCUCUAUGGdTdT (SEQ ID NO: 104); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:33, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:105: GGAAGACAAGUGUGGUAAA(SEQ ID NO:33) UUUACCACACUUGUCUUCCdTdT(SEQ ID NO:105); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:34, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:106: GAAGACAAGUGUGGUAAAC(SEQ ID NO:34) GUUUACCACACUUGUCUUCdTdT(SEQ ID NO:106); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:35, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:107: GCCAGUGCAACUUUACUGU(SEQ ID NO:35) ACAGUAAAGUUGCACUGGCdTdT(SEQ ID NO:107); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:36, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:108: CAAGAUCAAGUCCAUAGAU(SEQ ID NO:36) AUCUAUGGACUUGAUCUUGdTdT(SEQ ID NO:108); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:37, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:109: AUGAUGUUCCUGGGAGUAA(SEQ ID NO:37) UUACUCCCAGGAACAUCAUdTdT(SEQ ID NO:109); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:38, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:110: GAAGAACUACCAGCCAUUA(SEQ ID NO:38) UAAUGGCUGGUAGUUCUUCdTdT(SEQ ID NO:110); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:39, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:111: GACCUAAAGAAGGGGUUUU(SEQ ID NO:39) AAAACCCCUUCUUUAGGUCdTdT(SEQ ID NO:111); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:40, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:112: UUCCGAAGCAGAUAAUGUU(SEQ ID NO:40) AACAUUAUCUGCUUCGGAAdTdT(SEQ ID NO:112); (40) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:41, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:113: UCCGAAGCAGAUAAUGUUG(SEQ ID NO:41) CAACAUUAUCUGCUUCGGAdTdT(SEQ ID NO:113); (41) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:42, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:114: CGAAGCAGAUAAUGUUGUG(SEQ ID NO:42) CACAACAUUAUCUGCUUCGdTdT(SEQ ID NO:114); (42) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 43, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 115: GAAGCAGAUAAUGUUGUGU(SEQ ID NO:43) ACACAACAUUAUCUGCUUCdTdT(SEQ ID NO:115); (43) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 44, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 116: GCAGAUAAUGUUGUGUCAG(SEQ ID NO:44) CUGACACAACAUUAUCUGCdTdT(SEQ ID NO:116); (44) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 45, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 117: GAAGACCCAGAGCUUUGUU(SEQ ID NO:45) AACAAAGCUCUGGGUCUUCdTdT(SEQ ID NO:117); (45) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 46, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 118: CGGAUUGUGGUUCGAGUGA(SEQ ID NO:46) UCACUCGAACCACAAUCCGdTdT(SEQ ID NO:118); (46) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 47, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 119: GUGGUUCGAGUGAAGAGAA(SEQ ID NO:47) UUCUCUUCACUCGAACCACdTdT(SEQ ID NO:119); (47) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:48, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:120: CCAGAAGCUUGAGGGUUUC(SEQ ID NO:48) GAAACCCUCAAGCUUCUGGdTdT(SEQ ID NO:120); (48) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:49, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:121: AGGUUGACAAGUUCAACAA(SEQ ID NO:49) UUGUUGAACUUGUCAACCUdTdT(SEQ ID NO:121); (49) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:50, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:122: GGUUGACAAGUUCAACAAG(SEQ ID NO:50) CUUGUUGAACUUGUCAACCdTdT(SEQ ID NO:122); (50) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:51, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:123: ACAAGUUCAACAAGGAGAA(SEQ ID NO:51) UUCUCCUUGUUGAACUUGUdTdT(SEQ ID NO:123); (51) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:52, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:124: GUUGGAAAAAGAGAGGAUU(SEQ ID NO:52) AAUCCUCUCUUUUUCCAACdTdT(SEQ ID NO:124); (52) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:53, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:125: GGAGCCCUACUUCAUGUGU(SEQ ID NO:53) ACACAUGAAGUAGGGCUCCdTdT(SEQ ID NO:125); (53) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:54, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:126: GAGCCCUACUUCAUGUGUA(SEQ ID NO:54) UACACAUGAAGUAGGGCUCdTdT(SEQ ID NO:126); (54) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:55, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:127: CUGAAAAUCCCCACCUCUA(SEQ ID NO:55) UAGAGGUGGGGAUUUUCAGdTdT(SEQ ID NO:127); (55) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:56, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:128: UGAAAAUCCCCACCUCUAA(SEQ ID NO:56) UUAGAGGUGGGGAUUUUCAdTdT(SEQ ID NO:128); (56) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:27, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:129: UGUCAGCGCUGACCUCAAU(SEQ ID NO:57) AUUGAGGUCAGCGCUGACAdTdT(SEQ ID NO:129); (57) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:58, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:130: AAAGGCUGGAACCCUACAA(SEQ ID NO:58) UUGUAGGGUUCCAGCCUUUdTdT(SEQ ID NO:130); (58) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:59, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:131: GGACACAGUGAGCUUGUCU(SEQ ID NO:59) AGACAAGCUCACUGUGUCCdTdT(SEQ ID NO:131); (59) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:60, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:132: CGACUGCCUAACAGGAGAU(SEQ ID NO:60) AUCUCCUGUUAGGCAGUCGdTdT(SEQ ID NO:132); (60) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:61, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:133: CAGUCUAAACCCUGCCAUU(SEQ ID NO:61) AAUGGCAGGGUUUAGACUGdTdT(SEQ ID NO:133); (61) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:62, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:134: ACAGGUGGAAGGGGCAUUU(SEQ ID NO:62) AAAUGCCCCUUCCACCUGUdTdT(SEQ ID NO:134); (62) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 63, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 135: CCCUAGAGGAGCUACACUA (SEQ ID NO: 63) UAGUGUAGCUCCUCUAGGGdTdT (SEQ ID NO: 135); (63) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 64, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 136: AGGCCAUCUAUGCAUCGAA (SEQ ID NO: 64) UUCGAUGCAUAGAUGGCCUdTdT (SEQ ID NO: 136); (64) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 65, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 137: CAUGGAGCAGGAGGAACAU (SEQ ID NO: 65) AUGUUCCUCCUGCUCCAUGdTdT (SEQ ID NO: 137); (65) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 66, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 138: GAGCAGGAGGAACAUACCA (SEQ ID NO: 66) UGGUAUGUUCCUCCUGCUCdTdT (SEQ ID NO: 138); (66) The nucleotide sequence I comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 67, and the nucleotide sequence II comprises at least 15 consecutive nucleotides optionally having no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO: 139: GGAGGAACAUACCACAGAA (SEQ ID NO: 67) UUCUGUGGUAUGUUCCUCCdTdT (SEQ ID NO: 139); (67) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:68, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:140: GAGGAACAUACCACAGAAC (SEQ ID NO:68) GUUCUGUGGUAUGUUCCUCdTdT (SEQ ID NO:140); (68) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:69, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:141: GGAACAUACCACAGAACAU (SEQ ID NO:69) AUGUUCUGUGGUAUGUUCCdTdT (SEQ ID NO:141); (69) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:70, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:142: UGGACAGCCUGUAUAACCU (SEQ ID NO:70) AGGUUAUACAGGCUGUCCAdTdT (SEQ ID NO:142); (70) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:71, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:143: ACAGCCUGUAUAACCUCAA (SEQ ID NO:71) UUGAGGUUAUACAGGCUGUdTdT (SEQ ID NO:143); (71) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:72, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:144: CAGCCUGUAUAACCUCAAG (SEQ ID NO:72) CUUGAGGUUAUACAGGCUGdTdT (SEQ ID NO:144); (72) The nucleotide sequence I comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:73, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that optionally have no more than 3 (preferably no more than 1) nucleotide differences from SEQ ID NO:145: GAUGGUGUCUGUCCUUUGA (SEQ ID NO:73) UCAAAGGACAGACACCAUCdTdT (SEQ ID NO:145).
5. The shRNA or a salt thereof according to claim 4, wherein, The shRNA comprises at least one modified nucleotide and / or at least one inter-strand modification, Preferably, all nucleotides on the sense strand are modified nucleotides, and / or all nucleotides on the antisense strand are modified nucleotides, More preferably, substantially all nucleotides of the sense strand and the antisense strand are modified nucleotides, Even more preferably, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides, In particular, the modified nucleotides are selected from 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP modified nucleotides; the inter-strand modifications are selected from phosphorothioate, -OEt, -OME modifications.
6. A conjugate, the conjugate comprising: The siRNA or its salt as described in any one of claims 1-3 or the shRNA or its salt as described in any one of claims 4-5; And A conjugating group conjugated to the siRNA or shRNA.
7. A pharmaceutical composition, which comprises the siRNA or its salt as described in any one of claims 1-3 and / or the shRNA or its salt as described in any one of claims 4-5 and / or the conjugate as described in claim 6, and optionally a pharmaceutically acceptable carrier.
8. Use of the siRNA or its salt as described in any one of claims 1-3, or the shRNA or its salt as described in any one of claims 4-5, or the conjugate as described in claim 6, or the pharmaceutical composition as described in claim 7 in the preparation of a drug capable of inhibiting the expression of the xanthine dehydrogenase gene.
9. Use of the siRNA or its salt as described in any one of claims 1-3, or the shRNA or its salt as described in any one of claims 4-5, or the conjugate as described in claim 6, or the pharmaceutical composition as described in claim 7 in the preparation of a drug for preventing or treating xanthine dehydrogenase-related diseases or disorders; In particular, the xanthine dehydrogenase-related diseases or disorders refer to diseases or disorders caused by or related to the high expression of the xanthine dehydrogenase gene, in particular, including diseases caused by abnormal uric acid metabolism, especially hyperuricemia, gout, gouty nephropathy, and uric acid stones.
10. A method for inhibiting the expression of xanthine dehydrogenase gene in cells, the method comprising contacting the cells with an effective amount of the siRNA or its salt as described in any one of claims 1-3, and / or the shRNA or its salt as described in any one of claims 4-5, and / or the conjugate as described in claim 6, and / or the pharmaceutical composition as described in claim 7, so as to inhibit the expression of xanthine dehydrogenase gene in the cells.