Pcdh15 gene enhancer and application thereof

Abstract

The invention discloses a Pcdh15 gene enhancer sequence and application thereof, and belongs to the field of gene engineering, and the nucleotide sequence of the enhancer is shown as SEQ ID No.1. A mouse embryo microinjection system is used for verifying that the sequence is an enhancer, and the transcriptional activity of EGFP protein genes in hair cells can be remarkably enhanced in inner ears. Compared with other sequences with similar sizes, the enhancer sequence fragment can drive the expression ability of a reporter gene or a Pcdh15 gene to be obviously enhanced in inner ear hair cells, is specifically expressed in inner and outer hair cells, is suitable for biological materials such as recombinant DNA (Deoxyribonucleic Acid), vectors or adenoviruses and the like, and has a wide application prospect. The method is used for promoting transcription of EGFP genes or other genes in internal and external hair cells of inner ears.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering, and particularly relates to a Pcdh15 gene enhancer and its application. Background Art

[0002] Protocadherin 15 (PCDH15) encoded by PCDH15 is an important component of adherens junctions. Protocadherin 15 is a member of the cadherin superfamily of calcium-dependent intercellular adhesion molecules. In higher vertebrates, protocadherin is involved in various functions such as neural circuit formation and synapse formation. When PCDH15 undergoes splicing mutations or nonsense mutations, it leads to the loss of PCDH15 protein function, causing Usher syndrome type 1F (USH1F). Usher syndrome type 1 is an autosomal recessive disease characterized by progressive retinitis pigmentosa and congenital sensorineural hearing loss. When PCDH15 undergoes missense mutations, it results in amino acid substitutions in the PCDH15 protein. The mutated PCDH15 protein still retains some functions, ultimately causing recessive nonsyndromic deafness DFNB23, and patients present with congenital bilateral severe to profound deafness.

[0003] As a characteristic regulatory element of the eukaryotic genome, enhancers play a central role in the regulation of spatio-temporal specific gene expression. The realization of its function mainly depends on the spatial interaction mechanism with the promoter of the target gene. This interaction mode can be divided into two types: when the regulatory element and the target gene are located on the same chromosome, it is called cis-regulation; if they are distributed on different chromosomes, it belongs to trans-regulation. From the perspective of molecular composition characteristics, the enhancer region is rich in various regulatory elements. Among them, the transcription factor binding site, as the core functional unit, precisely regulates the gene transcription activation process through the synergistic action with transcription complex cofactors and chromatin remodeling complexes.

[0004] In the field of gene therapy vector development, the application of enhancers has shown significant advantages. A number of studies have shown that integrating tissue-specific enhancers into the adeno-associated virus (AAV) vector system can effectively improve the transgenic expression efficiency and enhance tissue targeting. For example, by optimizing the combination of liver-specific promoters and mini-enhancers, researchers successfully constructed a recombinant AAV (rAAV) vector with high transduction efficiency. Experimental data show that the exogenous gene expression level of this vector containing composite regulatory elements is 10 - 100 times higher than that of the single-promoter vector in mouse models. This synergistic effect mainly stems from the three-dimensional chromatin interaction structure formed by the enhancer and the transcription factor network, as well as the resulting change in chromatin openness.

[0005] In summary, the Pcdh15 gene is a pathogenic gene for deafness. By using the inner ear Pcdh15 enhancer, the expression of this gene can be regulated to be activated at specific developmental stages or in specific cell types, ensuring the expression of the Pcdh15 gene at the appropriate time and location. Currently, there is no relevant research and application on the Pcdh15 gene enhancer. Summary of the Invention

[0006] The technical problem to be solved by the present invention is to provide a Pcdh15 gene enhancer.

[0007] The technical solution of the present invention is: a Pcdh15 gene enhancer, the nucleotide sequence of which is shown in SEQ ID No.1.

[0008] A primer pair for amplifying the above-mentioned enhancer, the nucleotide sequences of the primer pair are shown in SEQ ID No.2 and SEQ ID No.3.

[0009] A method for amplifying the above-mentioned enhancer, using mouse genomic DNA as a template and performing PCR amplification with the primer pair shown in SEQ ID No.2 and SEQ ID No.3 to obtain the enhancer of the Pcdh15 gene shown in SEQ ID No.1.

[0010] A biological material containing the above-mentioned enhancer.

[0011] Furthermore, the biological material is recombinant DNA, vector, adenovirus or engineered bacteria.

[0012] The application of the above-mentioned enhancer or biological material in enhancing the gene-specific expression of inner and outer hair cells.

[0013] Furthermore, the gene is the Pcdh15 gene or the EGFP gene.

[0014] The application of the above-mentioned enhancer or biological material in preparing a product for enhancing the gene-specific expression of inner and outer hair cells.

[0015] Furthermore, the gene is the Pcdh15 gene or the EGFP gene.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] It is confirmed by the mouse microinjection system that this sequence is an enhancer, which can significantly enhance the transcriptional activity of the EGFP protein gene in the inner ear. Compared with other sequences of similar size, the enhancer sequence fragment can significantly enhance the expression ability of the reporter gene or Pcdh15 in the inner ear and specifically express in inner and outer hair cells. It is applicable to biological materials such as recombinant DNA, vector or adenovirus, and is used to promote the transcription of the EGFP gene or other genes in the inner ear. Brief Description of the Drawings

[0018] Figure 1 : Schematic diagram of the vector structure after the Pcdh15 enhancer and EGFP were cloned into the pWHERE plasmid;

[0019] Figure 2 : Comparison of the fluorescence effects in the inner ear of mice when using different enhancers; among them: Group A empty vector - EGFP had no fluorescence signal in the cochlea of mice; Group B Pcdh15 gene enhancer - EGFP had fluorescence signal in the cochlea of mice, (upper: the basilar membrane of the whole inner ear cochlea; lower: enlarged view). Detailed Implementation Manner

[0020] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all obtained from commercial channels unless otherwise specified.

[0021] Example 1 Cloning and Activity Analysis of the Pcdh15 Gene Enhancer Sequence

[0022] (1) The Hsp68 promoter sequence was cloned upstream of the reporter gene EGFP, and the activity of the enhancer was detected by detecting the expression of the EGFP gene. The vector obtained by successfully ligating the pWHERE vector and the gene promoter sequence was named the pWHERE - promoter vector.

[0023] (2) The DNA of the inner ear tissue of mice was extracted, and the Pcdh15 gene enhancer sequence (shown in SEQ ID No.1, with a sequence length of 508bp) was amplified.

[0024] SEQ ID No.1:

[0025] CACAGTCCTGCGACTGAAATCAAATATACCTTTCAGTGAGACACACTTCTGAAACTCTATAGCTTTGAAAATGGACTTTATATAATGAAACCCATATTTACATAGACGCTAGCAGACTGAAGCCACTGTTGACATATGAGTAGTGTGTTCCTTTTGTGTGGTGTTTAATCAGAAAGTAATCTAATAGTGATTGTGTTCTGATACCTGTCCATTAAAGTTATATTTAGGCTCAAAGCTTAAAAAAAAGTCTTGGAAATAAGTTAGTACTTTCTTCCTCAATAGTTTATTCCCAAACGCATTGTGAACAATCAATAAAGAAACAGTGGATTCATTTGCAAATAAATCTTGTCCTCGGATAGGAGACGTGTGTGAACCAGCATGGAGTACTCATACATGAAGAGATGAACAGGAAAGGCTTTAGCAAGTACAAAGCACATCTTTCACCTTATCTTATTGCACGTTTTTAATGGTCTCTGTGGACAATAGAGTCCTGGCTTCACTTTACAAC

[0026] The primer pairs used for PCR amplification of the Pcdh15 gene enhancer region are as follows:

[0027] Pcdh15-F: 5’-CGCGGATCCCACAGTCCTGCGACTGAAAT-3’ (SEQ ID No.2)

[0028] Pcdh15-R: 5’-CCGCTCGAGGTTGTAAAGTGAAGCCAGG-3’ (SEQ ID No.3).

[0029] (3) Subsequently, the enhancer sequence was transferred into the pWHERE-promoter vector using the BamHI and XhoI restriction sites. The constructed plasmid is shown in Figure 1 .

[0030] (4) Preparation of linearized transgenic DNA: The plasmid was cut with the appropriate restriction enzymes BamHI and XhoI to linearize the foreign DNA from the vector, and then the foreign DNA was purified to remove impurities and enzymes. Finally, the purified DNA was dissolved in TE buffer and adjusted to a concentration of 1-2 ng / μL and stored at 4°C for later use.

[0031] (5) Obtaining mouse fertilized eggs: Select healthy female mice of appropriate age (usually 3 - 4 weeks old) for superovulation treatment. 12 - 14 hours after superovulation, mate these female mice with healthy, sexually mature male mice. Dissect the female mice the next morning and collect the fertilized eggs from their oviducts. The fertilized eggs cultured in vitro should have two distinct pronuclei (male and female) and be ready for injection.

[0032] (6) Microinjecting exogenous DNA: Place the collected fertilized eggs in a culture medium containing HEPES buffer. Use a microinjection needle to directly inject the DNA solution into the pronucleus (usually the larger male pronucleus). After the injection is completed, transfer the fertilized eggs into a culture dish containing an appropriate medium and continue incubation. Until they are implanted into the oviducts of pseudopregnant female mice, usually 10 - 20 fertilized eggs are implanted into each female mouse. After the transplantation is completed, raise the female mice separately and observe their pregnancy status.

[0033] (7) Identifying transgenic mice: After successful embryo transplantation, wait for the required period to take mouse embryos for detection. Cut off the heads of the mouse embryos, open the skulls, remove the brain tissues, and expose the temporal bones to take out the cochleas. After the cochleas are taken out, transfer them into a culture dish containing pre-cooled 1X PBS in advance; under a dissecting microscope, use a sharp needle to pick open the bone wall of the cochlear apex of the cochlea, and then peel off the cochlear shell along the gap between the spiral ligament and the cochlear shell until the complete spiral ligament is fully exposed; then use a sharp needle or forceps to separate and take out the entire spiral ligament, immediately transfer it into a 2 ml centrifuge tube containing 4% paraformaldehyde, and fix it at 4°C for 30 min. After 30 min, remove the spiral ligament under a dissecting microscope, and lay the whole cochlear basilar membrane flat on a glass slide, add DAPI (4',6-diamidino-2-phenylindole) and then seal the slide. Finally, under a fluorescence microscope, select the DAPI fluorescence channel to observe the nuclear signal of the basilar membrane, the 488 nm laser excitation channel to observe the EGFP signal, and take pictures of the entire complete basilar membrane, as well as local basilar membrane pictures of the apex, middle, and base.

[0034] It can be seen that the Pcdh15 enhancer can enhance the specific expression of the EGFP gene in inner and outer hair cells ( Figure 2 in B)

[0035] Example 2 Activity analysis of the vector without the Pcdh15 gene enhancer sequence

[0036] Microinject the vector without the Pcdh15 gene enhancer sequence, and other operation steps are the same as in Example 1. It can be seen that the vector without the Pcdh15 gene enhancer sequence has no EGFP expression (no fluorescence signal) in inner and outer hair cells ( Figure 2 in A).

Claims

1. The Pcdh15 gene enhancer, whose nucleotide sequence is shown in SEQ ID No.

1.

2. The primer pair for amplifying the Pcdh15 enhancer described in claim 1, characterized in that, The nucleotide sequences of the primer pair are shown in SEQ ID No.2 and SEQ ID No.

3.

3. A method for amplifying the enhancer according to claim 1, characterized in that, Using mouse genomic DNA as a template and performing PCR amplification with the primer pair shown in SEQ ID No.2 and SEQ ID No.3, the sequence shown in SEQ ID No.1 is obtained as the enhancer of the Pcdh15 gene.

4. A biological material containing the enhancer described in claim 1.

5. The biomaterial according to claim 4, wherein, The biological material is recombinant DNA, a vector, an adenovirus or an engineered bacterium.

6. The application of the enhancer described in claim 1 or the biological material described in claim 4 or 5 in enhancing the gene-specific expression of inner and outer hair cells.

7. The application according to claim 6, characterized in that, The gene is the Pcdh15 gene or the EGFP gene.

8. The application of the enhancer described in claim 1 or the biological material described in claim 4 or 5 in the preparation of a product for enhancing the gene-specific expression of inner and outer hair cells.

9. The application according to claim 8, wherein The gene is the Pcdh15 gene or the EGFP gene.

Images