Populus tomentosa salt-tolerant rhab1a gene and application thereof

Abstract

This invention provides a salt-tolerant Populus tomentosa RHB1A This invention relates to genes and their applications, belonging to the field of genetic engineering technology. The salt-tolerant gene from Populus tomentosa provided by this invention... RHB1A The nucleotide sequence is shown in SEQ ID NO.1, and the encoded amino acid sequence is shown in SEQ ID NO.2. This invention screened an E3 ubiquitin ligase RHB1A and cloned its full-length CDS sequence. This was then demonstrated by overexpression in Populus tomentosa plants. RHB1A The gene significantly improved the plant's salt tolerance, providing theoretical support for the breeding and widespread promotion of salt-tolerant tree varieties.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more particularly to a species of Populus tomentosa. RHB1A Genes and their applications. Background Technology

[0002] Poplar is an important timber and shelterbelt species in my country, as well as a crucial afforestation and greening tree species. During its growth, it is subject to various abiotic stresses, such as cold stress, drought stress, and salt stress, which severely impact the growth and development of woody plants. Effectively utilizing saline-alkali land for afforestation not only maximizes land resource utilization but also plays a vital role in achieving carbon peaking and carbon neutrality goals.

[0003] Ubiquitination modification not only affects plant stress resistance and is associated with plant responses to abiotic stress, but also influences plant disease resistance, playing a crucial role in the regulation of biotic stress. Recent studies have shown that E3 ubiquitin ligases play a vital role in plant salt tolerance.

[0004] Therefore, how to clone the key genes encoding salt response and verify their related functions to improve the tolerance of poplar to salt stress is an important problem that needs to be solved by those skilled in the art. Summary of the Invention

[0005] The purpose of this invention is to provide a salt-responsive gene for poplar trees to improve their tolerance to salt stress.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides a poplar tree RHB1A Genes, the ones mentioned RHB1A The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] The present invention also provides the aforementioned Populus tomentosa. RHB1A The gene-encoded E3 ubiquitin ligase, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] The present invention also provides an expression vector, comprising the aforementioned Populus tomentosa. RHB1A Gene.

[0010] Preferably, the expression vector is an overexpression vector.

[0011] The present invention also provides a recombinant bacterium, comprising the aforementioned RHB1A Gene or the expression vector described herein.

[0012] The present invention also provides the aforementioned Populus tomentosa. RHB1AThe application of the gene, the E3 ubiquitin ligase, the expression vector, or the recombinant bacteria in regulating the salt tolerance of Populus tomentosa.

[0013] Preferably, the method for regulating the salt tolerance of Populus tomentosa is to overexpress the [specific ingredient] in Populus tomentosa plants. RHB1A Gene.

[0014] Preferably, the salt tolerance characteristic is to promote Na+ absorption. + External drainage, increasing the relative water content of leaves, reducing malondialdehyde content, and decreasing electrical conductivity.

[0015] This invention is the first to discover an E3 ubiquitin ligase gene that responds to salt stress. RHB1A And cloned its full-length CDS sequence, using the constructed RHB1A Gene overexpression vectors in Populus tomentosa RHB1A The gene was overexpressed, giving the poplar plant greater salt tolerance. Attached Figure Description

[0016] Figure 1 for RHB1A Results of GMO identification;

[0017] Figure 2 The phenotypic results of the control group and the experimental group after treatment with NaCl are shown.

[0018] Figure 3 Na in the leaves of the control group and experimental group + Results of the determination of physiological indicators including content (A), conductivity (B), relative water content (C), and malondialdehyde content (D). Detailed Implementation

[0019] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0020] Example 1

[0021] Acquiring Populus tomentosa RHB1A CDS sequence of the gene

[0022] The nucleotide sequence is shown in SEQ ID NO.1:

[0023] ATGGGAGGTTGCTGTTGTTCTTCAAGGAAACCTCATTTACACGGAACGCCCGTGTATTACTATTGTCCACCAGCTTTGGAAGAGCATGGATCCTTAACGTCTCACAACGGCGCGGCCTCTGCATTCACTGCAGGTCTCCTGGTCGAATTGCATTTGAATACATCAACGCCTGATACTTTCCGCCCCCCTCCTGCACCTCTGCCATATGATGTGATTTTGGGATGTCCACAGTCACCGTATTCTGAATCTGTTCAAGAAACAATTAGTCGCAGTAGTTTTGGAACGTTGGCAATGAGTGAAGATCTTGATGAATTGGACTGCAAAACTCAAGCCAGTTCATTGCTTGTCTCTCCAAGGAAGTCAGAAGTGACAAAATTACATGAACCTGTTGCGTCCGCAACAGAAGAGGAAGATGCTTGTCCCATTTGCCTTGAAGAATATGACTTGGAGAATCCAAAACACATAACAAACTGCGAACATCATTTTCACCTCTCCTGCATTCTAGAGTGGATGGAAAGGAGTGACACCTGCCCCATATGTGACCAGGAAGTAATATTGACCACAACTTCATTTAGTTGTTGTTAA。

[0024] The amino acid sequence is shown in SEQ ID NO.2

[0025] MGGCCCSSRKPHLHGTPVYYYCPPALEEHGSLTSHNGAASAFTAGLLVELHLNTSTPDTFRPPPAPLPYDVILGCPQSPYSESVQETISRSSFGTLAMSEDLDELDCKTQASSLLVSPRKSEVTKLHEPVASATEEEDACPICLEEYDLENPKHITNCEHHFHLSCILEWMERSDTCPICDQEVILTTTSFSCC*。

[0026] Healthy Populus tomentosa plants were collected, and RNA was extracted from the Populus tomentosa plants using the BIOFIT kit. Then, the RNA was reverse transcribed into cDNA using the reverse transcription kit from Yisheng Biotechnology Co., Ltd. The cDNA was used as a template and PCR amplification was performed using overexpression primers (program: pre-denaturation 98℃, 30s; denaturation 98℃, 15s; annealing 55℃, 5s; extension 72℃, 20s; 34 cycles; 72℃, 1min).

[0027] Populus tomentosa RHB1A Gene overexpression primer + vector ligation primer F (SEQ ID NO.3): ACTCGAGGGGGATCCCCAATACTTGTATGGATGGGAGGTTGCTGTTGTT (Based on the overexpression primer, an Xcm I restriction site and a recombinant homologous fragment from the vector are added)

[0028] overexpression primer for Populus tomentosa RHB1A gene + vector ligation primer R (SEQ ID NO.4): TTCGCTAGTGGATCCCCAATACTTGTATGGTTAACAACAACTAAATGAAGTTGT (with Xcm I restriction site and recombinant homologous fragment on the vector added to the overexpression primer).

[0029] PCR amplification was performed using cDNA as a template, and the product was recovered.

[0030] This experiment used the pCXSN vector, which was digested with XcmI restriction endonuclease, and the vector backbone was recovered and ligated with the PCR-recovered product. The resulting vector was then transformed into DH5α *E. coli* and screened on antibiotic-resistant medium (LB solid medium containing 50 mg / L kanamycin) to construct a vector containing... RHB1A Overexpression vector of full-length CDS.

[0031] Positive E. coli colonies were selected, plasmids were extracted, and the sequence was verified to be correct.

[0032] The plasmid was transformed into Agrobacterium GV3101 strain, and screening was performed on LB solid medium (containing 50 mg / L kanamycin and 50 mg / L rifampin). Positive strains were selected, expanded, and preserved.

[0033] The expanded culture of Agrobacterium strain was aliquoted into 50 mL sterile centrifuge tubes and centrifuged at 5000 rpm for 10 min. The liquid in the tubes was discarded, and the bacterial cells were retained. 20 mL of pre-prepared WPM solution was added to the centrifuge tubes to obtain a resuspended bacterial solution for later use.

[0034] Young leaves of approximately one-month-old Populus tomentosa were used for infection to obtain overexpression strains.

[0035] The infection process is as follows:

[0036] 1. Select tender young leaves from the top of the sterile seedling and cut them into 0.5 × 0.5 cm pieces on a clean bench. 2 Place small pieces into the resuspended bacterial solution and incubate for 15 minutes, shaking the solution every 3 minutes during this period.

[0037] 2. Carefully remove the infected material with tweezers and place it on a plate containing sterile filter paper to absorb the bacterial solution. Lay the leaf blades flat on WPM co-culture medium with the back side down and incubate in the dark at 28°C for 2 days.

[0038] 3. After 2 days, the transformed explants were transferred to WPM selective medium and cultured in the dark at 25°C for 15 days.

[0039] 4. When white, loose callus tissue appears around the leaves, transfer it to WPM budding medium and induce budding in a light incubator at 25°C and 10,000 Lux for about 4 to 5 weeks, changing the medium every 15 days.

[0040] 5. When the adventitious buds grow to 3-4cm, cut them off and transfer them to WPM rooting medium. After the seedlings have rooted, take leaves to identify positive plants. Transplant the positive seedlings into soil for further cultivation and subsequent treatment.

[0041] Example 2

[0042] Normal control group (WT) and transgenic lines (RHB1A-OE-1, RHB1A-OE-11) were selected. RNA was extracted and reverse transcribed into cDNA. qPCR detection was performed using Populus tomentosa UBQ as an internal reference primer. RHB1A Gene expression levels.

[0043] qPCR primers, all primer sequences below are oriented 5'-3':

[0044] Table 1 qPCR primers

[0045] Q-PtoRHB1A-F CGGAACGCCCGTGTATTACT SEQ ID NO.5 Q-PtoRHB1A-R TGCAATTCGACCAGGAGACC SEQ ID NO.6 Q-PtoUBQ-F CCAAGCCCAAGAAGATCAAGC SEQ ID NO.7 Q-PtoUBQ-R GCACCGCACTCAGCATTAGG SEQ ID NO.8

[0046] The results are as follows Figure 1 As shown. From Figure 1 As can be seen, compared with the normal control group, the overexpression transgenic lines showed... RHB1A The gene expression level was significantly higher than that of the normal control group, indicating that the overexpression transgenic line was successfully constructed.

[0047] Example 3

[0048] Wild-type (WT) and overexpression (RHB1A-OE-1) lines with uniform rooting and growth were transplanted to a greenhouse for one month. After stabilization, they were treated with salt. Phenotypic observation after salt treatment revealed that the overexpression plants exhibited lower levels of leaf wilting. Figure 2 ), and its salt stress tolerance is stronger than that of WT plants.

[0049] The salt treatment method is as follows: Add 300mM NaCl solution to the tray until it covers the small pot containing the plant. Observe and take pictures after the plant shows signs of wilting.

[0050] Physiological indicators related to both were measured, and the results showed that, compared with WT plants, the overexpressing lines had higher Na content in their leaves. + Content reduced by 30% Figure 3 A), conductivity decreased by 85% ( Figure 3 B), the relative water content of the leaves increased by 10% ( Figure 3 C), malondialdehyde (MDA) content decreased by 60% ( Figure 3 D). The above results confirm that RHB1A Genes that are key to responding to salt stress.

[0051] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A type of white poplar RHB1A Genes, or white poplar RHB1A Gene-encoded E3 ubiquitin ligase, or overexpression of Populus tomentosa RHB1A Gene expression vectors, or overexpression of Populus tomentosa RHB1A Application of recombinant bacteria in improving the salt tolerance of Populus tomentosa; RHB1A The nucleotide sequence of the gene is shown in SEQ ID NO.1; the Populus tomentosa... RHB1A The amino acid sequence of the gene-encoded E3 ubiquitin ligase is shown in SEQ ID NO.2.

Images