Rice starch branching enzyme IIb gene promoter mutant allele for regulating starch synthesis and application of rice starch branching enzyme IIb gene promoter mutant allele in breeding

Abstract

The invention belongs to the field of molecular genetics, and discloses a rice starch branching enzyme IIb gene promoter mutant allele for regulating starch synthesis. According to the gene, a base sequence of 852 bp is inserted in front of a base at the upstream of an ATG translation initiation codon of a wild type japonica rice variety Nipponbare SBEIIb gene, meanwhile, a base sequence of 28 bp from-185 to-212 is deleted, a base C at-238 is mutated into T, and the nucleotide sequence of the gene is shown as SEQ ID No: 1. The mutant allele of the rice SBEIIb promoter can be used as a promoter element to start, regulate and control the expression of the rice SBEIIb gene, so that a new strain with changed starch components and characteristics is obtained. The rice starch branching enzyme IIb gene promoter mutant allele disclosed by the invention can be applied to rice quality improvement breeding as an excellent germplasm (gene) resource.

Description

Technical Field

[0001] The present invention relates to a mutant allele of the promoter of the rice starch branching enzyme IIb gene that regulates starch synthesis and its application in breeding, belonging to the field of molecular genetics. Background Art

[0002] Starch is the most important storage substance in the grains of cereal crops such as rice, accounting for about 90% of the dry weight of the endosperm. Rice endosperm starch is mainly composed of amylose and amylopectin. Differences in their composition and structure will affect the physical and chemical properties of starch such as hardness, viscosity, gelatinization, and retrogradation, and thus affect the appearance quality, taste, and glycemic index of rice. The biosynthesis of endosperm starch is an extremely complex biochemical regulation process. Among them, the starch branching enzyme IIb gene (SBEIIb) is responsible for the formation of short side chains of amylopectin, which can change the structure of amylopectin and affect the amylose content at the same time. The rice starch with changed components affects the processing characteristics of starch products, and thus can meet the consumption requirements of more people and the needs of a wider range of food industries. Therefore, the discovery of mutants with changed rice starch components has brought great opportunities for improving rice quality and deepening starch application. At present, breeders at home and abroad have obtained genetic materials with SBEIIb gene deletion or expression inhibition through various means. Although the starch components have changed, it has led to a rice flour quality phenotype and a significant decline in rice quality, seriously restricting its application in production practice. Summary of the Invention

[0003] The present invention aims to provide a mutant allele of the promoter of the rice starch branching enzyme IIb gene that regulates starch synthesis and its application in breeding. This gene can be used as a promoter element to regulate the expression of the rice SBEIIb gene, change the endosperm starch components and starch characteristics, meet the needs of a wider range of production practices, and provide excellent germplasm (gene) resources for rice quality improvement breeding.

[0004] The technical solution provided by the present invention is as follows:

[0005] A mutant allele of the promoter of the rice starch branching enzyme IIb gene that regulates starch synthesis, in which an 852 bp base sequence is inserted before the -184th base upstream of the ATG translation start codon of the SBEIIb gene in the wild-type japonica rice variety Nipponbare, and at the same time, a 28 bp base sequence from -185 to -212 is deleted, and the base C at the -238th position is mutated to T; the nucleotide sequence of the promoter mutant allele is as shown in SEQ ID No:1.

[0006] The mutant allele of the promoter of the rice starch branching enzyme IIb gene provided by the present invention can be used as a promoter element to regulate the SBEIIb gene.

[0007] The present invention also provides the application of the above-mentioned promoter mutant allele of the rice starch branching enzyme IIb gene in rice breeding.

[0008] Furthermore, the promoter mutant allele down-regulates the expression of the SBEIIb gene and reduces the content of the SBEIIb protein.

[0009] Furthermore, the promoter mutant allele increases the amylose content and the proportion of long side chains of amylopectin in rice.

[0010] Furthermore, the promoter mutant allele changes the crystal structure of rice starch.

[0011] Furthermore, the promoter mutant allele increases the gelatinization temperature of rice starch.

[0012] Furthermore, the promoter mutant allele increases the gelatinization resistance of rice.

[0013] The present invention also provides a method for extending the side chains of rice amylopectin. The above-mentioned promoter mutant allele is introgressed into rice to obtain a variety with extended side chains of rice amylopectin.

[0014] The present invention also provides a method for increasing the gelatinization temperature of rice starch. The above-mentioned promoter mutant allele is introgressed into rice to obtain a variety with a higher gelatinization temperature of rice starch.

[0015] The present invention also provides a method for increasing the gelatinization resistance of rice. The above-mentioned promoter mutant allele is introgressed into rice to obtain a variety with high gelatinization resistance of rice starch.

[0016] The present invention provides a promoter mutant allele of the rice starch branching enzyme IIb gene for regulating starch synthesis. An 852-bp base sequence is inserted before the -184th base upstream of the ATG translation initiation codon of the SBEIIb gene (Genebank: AP014958.1, https: / / www.ncbi.nlm.nih.gov / nucleotide / AP014958.1) in the japonica rice Nipponbare background. Meanwhile, a 28-bp base sequence from -185 to -212 is deleted, and the base C at the -238th position is mutated to T. The nucleotide sequence of the gene is as shown in SEQ ID No:1. The promoter mutant allele of the rice starch branching enzyme IIb gene described in the present invention provides excellent germplasm (gene) resources for rice quality improvement breeding.

[0017] Beneficial effects

[0018] There has been no report on the mutant allele of the above-mentioned rice starch branching enzyme IIb gene promoter, which is a new mutant allele of the promoter suitable for the expression of rice SBEIIb. In the present invention, a new mutant allele of the rice starch branching enzyme IIb gene promoter was screened and identified from the non-waxy spontaneous mutation of japonica rice Nipponbare. This allele down-regulates the expression of the SBEIIb gene, significantly reduces the content of SBEIIb protein, changes the endosperm starch components and starch properties, changes the crystal structure of rice starch, and can be used as an excellent germplasm (gene) resource in rice quality improvement breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Screening of the starch component-altered mutant NM28 in the present invention. A shows the comparison of iodine staining colors of Nipponbare grains gelatinized with different concentrations of urea; B shows the primary screening of urea-resistant gelatinized mutant grains from the M2 grains of the Nipponbare mutant library line with 3.5 M urea; C shows the rescreening of the M2 grains of the NM28 line with 3.5 M urea; D shows the homozygous mutation identification of the M3 grains of the NM28 single plant offspring with 3.5 M urea.

[0020] Figure 2 Schematic diagram of SBEIIb gene sequencing and promoter mutation sequence of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention. A shows the schematic diagram of the SBEIIb gene structure and the positions of the sequencing primers; B shows the promoter mutation sequence of SBEIIb, -348~-126 is the partial promoter sequence; -125~-1 is the 5' UTR of exon 1; +1~+100 is the partial sequence of exon 1.

[0021] Figure 3 Amplified gel diagram of the SBEIIb promoter of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention.

[0022] Figure 4 Analysis of cis-acting elements in the promoter mutation region of the SBEIIb promoter of the wild-type rice variety Nipponbare in the present invention.

[0023] Figure 5 Analysis of SBEIIb expression of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention. A shows the relative expression level of SBEIIb; B shows the content of SBEIIb protein.

[0024] Figure 6Association analysis of the urea gelatinization phenotype and genotype of the F2 grains from the cross between the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter and the wild-type rice variety Nipponbare in the present invention. A shows the results of 4.0 M urea gelatinization of F2 grains, and B shows the genotype detection of F2 plants.

[0025] Figure 7 Analysis of the starch components of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention. A is the starch iodine absorption spectrum, B is the apparent amylose content, and C is the amylose content.

[0026] Figure 8 Chain length distribution of amylopectin of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention.

[0027] Figure 9 Analysis of the starch crystal structure of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention.

[0028] Figure 10 Analysis of the gelatinization resistance of the wild-type rice variety Nipponbare and the homozygous mutant NM28 carrying the new allele of the SBEIIb promoter in the present invention. A shows the comparison of urea gelatinization resistance of the grains of the wild-type and its mutant NM28, and B is the DSC profile of starch. Detailed implementation manners

[0029] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of the specific implementation manners of the present invention is given in combination with specific embodiments.

[0030] Many specific details are set forth in the following description in order to fully understand the present invention. However, the present invention can also be implemented in other ways different from those described herein. Those skilled in the art can make similar extensions without departing from the connotation of the present invention. Therefore, the present invention is not limited by the specific embodiments disclosed below.

[0031] Example 1

[0032] The present invention uses the wild-type rice variety Nipponbare and its derived mutant NM28 as experimental materials.

[0033] Mutant NM28 was screened from the non-waxy grain mutant library of Nipponbare using the urea gelatinization semi-grain - iodine staining method. That is, take the cross-cut mature brown rice semi-grain without embryo as the gelatinization sample, horizontally place it in a flat 96-well plate, add 200 μL of urea solution, and place it in an incubator at 24 °C for gelatinization for 16 h. After gelatinization, add 20 μL of iodine solution (0.2% I2, 1% KI, 0.5% Acetic acid) for staining, mix well by pipetting, and then place it on a glass slide (Jizhou Hongguang Rehabilitation Equipment Factory) for color development. The iodine solution color development results showed ( Figure 1 A), 12 randomly selected grains of the wild type of Nipponbare were completely gelatinized in 3.5 M urea solution, showing uniform blue color. Therefore, 3.5 M urea concentration was selected for screening mutant grains with changed starch components. Using 3.5 M urea concentration, primary screening was carried out in the M2 grains of each strain in the non-waxy grain mutant library of Nipponbare in the laboratory. A yellow urea-resistant gelatinized grain appeared in the single plant NM28 of the mutant line ( Figure 1 B). Subsequently, 96 grains were randomly selected from the NM28 mutant line for re-screening, and a total of 9 yellow urea-resistant gelatinized grains were screened out ( Figure 1 C). Take the corresponding half-grain with embryo of the NM28 grains showing yellow resistance in the color development result for sprouting and seed multiplication, and perform 3.5 M urea gelatinization - iodine staining on the mature M3 grains of the single plant. The results showed ( Figure 1 D) that 6 randomly selected M3 grains from each single plant of the NM28 material all showed yellow gelatinization resistance characteristics, indicating that the NM28 mutant had been homozygous.

[0034] Example 2

[0035] SBEIIb Mutation Analysis of NM28

[0036] Rice SBEIIb is mainly responsible for the formation of short side chains of amylopectin. The mutation of SBEIIb will lead to the elongation of the side chains of amylopectin, thereby increasing the gelatinization temperature and enhancing the resistance to urea gelatinization, making its grains show yellow in the urea gelatinization - iodine staining solution. Therefore, in this invention, the coding region and promoter region of the SBEIIb gene of mutant NM28 were sequenced. The genomic DNA of the leaves of Nipponbare and mutant NM28 was extracted using the CTAB method, and corresponding primers were designed for PCR amplification. After the amplified products were identified by agarose gel electrophoresis, they were entrusted to Nanjing Qingke Biotechnology Company for sequencing ( Figure 2 A). The sequencing alignment results of the amplified products of the SBEIIb gene coding region showed that no mutation occurred. However, the agarose gel electrophoresis gel map results of the amplified products of the SBEIIb promoter region showed that the amplified length of the promoter of NM28 was significantly increased compared with the wild type (2256 bp) ( Figure 3 ). Further sequencing alignment showed ( Figure 2B), 852 bp of nucleotide sequence was inserted before the -184th base upstream of the ATG translation start codon in NM28. Meanwhile, 28 bp of nucleotide sequence from -185 to -212 was deleted, and the base C at -238 was mutated to T. The nucleotide sequence of the mutant allele of the rice starch branching enzyme IIb gene promoter is shown in SEQ ID No:1. The amplification primers for the SBEIIb promoter region are shown in SEQ ID No:2 and SEQ ID No:3.

[0037] Promoters can be recognized by RNA polymerase and interact with transcription factors to regulate gene expression. In this invention, PlantPAN 4.0 (https: / / plantpan.itps.ncku.edu.tw / plantpan4 / index.html) was used to analyze the insertion mutation region of the SBEIIb promoter, and it was found that there were multiple cis-acting elements before and after the mutation site, and the TCP and NF-YB family acting elements were disrupted ( Figure 4 ). After consulting the literature and relevant databases, there has been no report on the mutant allele of the above-mentioned rice starch branching enzyme IIb gene promoter. Therefore, the NM28 mutant in the background of the japonica rice variety Nipponbare is a new allelic mutation of the starch branching enzyme IIb gene promoter.

[0038] Example 3

[0039] Analysis of the regulation of the expression of the SBEIIb gene by the NM28 mutant

[0040] The mutant allele of the starch branching enzyme IIb gene promoter in the NM28 mutant can be used as a promoter element to initiate and regulate the expression of the SBEIIb gene. In this invention, RT-qPCR and SBEIIb protein immunoblotting experiments were used to measure the expression at the RNA and protein levels in the developing endosperm of Nipponbare and the mutant NM28 10 days after flowering. Total RNA was extracted using the plant total RNA extraction kit from Tiangen, and cDNA was reverse-transcribed according to the system of the Novizan kit. Amplification was carried out using the fluorescence quantitative kit (ChamQ™ Universal SYBR® qPCR Master Mix, Vazyme) on a fluorescence quantitative PCR instrument (BIO-RAD CFX96, BIORAD). The internal reference gene was the rice ubiquitin gene UBQ5, and the relative expression level of the gene was calculated using the double ΔCt method (2 -ΔΔC)Calculation. The UBQ5 amplification primers are shown as SEQ ID No:4 and SEQ ID No:5, and the SBEIIb amplification primers are shown as SEQ ID No:6 and SEQ ID No:7. The RT-qPCR results show that the relative expression level of SBEIIb in the mutant NM28 is significantly reduced, only 22.5% of the expression level of Nipponbare ( Figure 5 A). Further, the present invention extracts the total protein of developing endosperm and performs an immunoblot experiment of SBEIIb protein using HSP82 as an internal reference. The results observed by the imaging instrument show that the expression level of SBEIIb protein in the mutant NM28 is significantly lower than that of Nipponbare ( Figure 5 B). The above results indicate that the mutant allele of the promoter of the rice starch branching enzyme IIb gene in NM28 significantly down-regulates the expression of the SBEIIb gene and reduces the content of SBEIIb protein.

[0041] Example 4

[0042] The mutant allele of the NM28 SBEIIb promoter co-segregates with the phenotype of grain resistance to urea gelatinization

[0043] The present invention uses NM28 as the female parent and the Nipponbare wild type as the male parent to prepare a hybrid population, and selects 4.0 M urea to perform semi-grain urea gelatinization-iodine staining on the mature grains of the F2 of the hybrid combination. The iodine staining results show ( Figure 6 A) that there is a yellow urea gelatinization-resistant phenotype consistent with the NM28 mutant in the mature grains of the F2 of the hybrid combination. Further, according to the urea gelatinization-iodine staining results, the half grains with embryos corresponding to the phenotypes of Nipponbare and NM28 are germinated, the leaf DNA is extracted and the SBEIIb promoter is amplified. According to the agarose gel electrophoresis results ( Figure 6 B), it can be observed that all the grains showing yellow iodine staining solution amplify a promoter band of about 3100 bp in size, which is exactly the same as that of NM28; the grains with blue iodine staining solution amplify a wild-type promoter band of about 2300 bp in size, or two heterozygous bands of 2300 bp and 3100 bp in size respectively. This result indicates that the resistance phenotype of NM28 grains to urea gelatinization is associated with the mutant gene of the SBEIIb promoter. By using conventional technical means such as hybridization and backcrossing, this gene can be transferred into other rice varieties and used as an excellent germplasm (gene) resource in the breeding for improving rice quality.

[0044] Example 5

[0045] Analysis of starch components in NM28

[0046] The starch iodine absorption spectrum can reflect the changes in starch components. Both amylose and the long side chains of amylopectin can bind to iodine and have an absorption value at 620 nm. Therefore, the apparent amylose content (AAC) is usually evaluated using OD620. The iodine colorimetric determination results showed that the AAC of the mutant NM28 (29.0%) was significantly higher than that of Nipponbare (18.1%) ( Figure 7 A,B). In addition, the content of true amylose (AC) was measured using the amylose / amylopectin assay kit from Megazyme, Ireland. ConA can specifically bind to amylopectin and form a precipitate, thereby enabling the determination of the percentage of amylose in the total amount of amylose and amylopectin, excluding the effects of starch purity and the long side chains of amylopectin. The determination results showed that the AC content of the mutant NM28 (14.66%) was significantly higher than that of Nipponbare (12.87%) ( Figure 7 C). The AC and AAC of the mutant NM28 were both significantly higher than those of Nipponbare, and the increase in AAC was more significant, indicating an increase in the proportion of the long side chains of amylopectin in the mutant NM28. Further, fluorescence-assisted capillary electrophoresis (FACE) was used to compare the chain length distribution of amylopectin in Nipponbare and NM28, and it was found that the proportion of short side chains in NM28 was significantly reduced, while the proportion of long side chains was significantly increased ( Figure 8 A,B). The above results indicate that compared with the wild type, both the amylose content and the proportion of long side chains of amylopectin in NM28 are significantly increased.

[0047] Example 6

[0048] Analysis of starch characteristics of NM28

[0049] Changes in starch components can affect the starch structure and functional properties. In this invention, an X-ray diffractometer (XRD) was used to analyze the crystal structures of the starches of Nipponbare and the mutant NM28. According to the XRD spectral results, starches can be classified into three different types: A-type, B-type, and C-type starch containing both A and B crystal types. The results showed that the wild type of Nipponbare exhibited typical A-type starch X-ray diffraction peaks, namely strong diffraction peaks at 2θ 15° and 23°, and continuous double peaks at 2θ 17° and 18°; while NM28 showed a typical B-type crystal characteristic peak at 2θ 5.6°, and the crystal structure was C A -type, with an increase in B-type crystals composed of long chains of amylopectin ( Figure 9 ).

[0050] In this invention, a urea concentration gradient of 2.5 - 8.0 M was set, and the wild type of Nipponbare and the mutant NM28 were gelatinized. The iodine staining results showed that the grains of Nipponbare were completely gelatinized in 3.5 M urea, while NM28 started to gelatinize in 4.5 M urea solution and was completely gelatinized in 5.5 M urea solution, and the urea gelatinization resistance was significantly higher than that of the wild type of Nipponbare.Figure 10 A). Further using a differential scanning calorimeter (DSC) to compare the thermal properties of the starch of Nipponbare and the mutant NM28, it was found that the gelatinization temperature of the starch of the mutant NM28 (73.4 °C) was higher than that of Nipponbare (69.3 °C). ( Figure 10 B). The above results indicate that significant changes have occurred in both the starch structure and functional properties of the mutant NM28.

[0051] SEQ ID No:1

[0052] New allelic DNA of the SBEIIb promoter (the underlined part is the mutated base):

[0053] t cactctcgcgtgaggggttcgctcc gctcacggatc tatcgatacatcaaaaatcaaattcaaattcaatgtacatctcaaggaaaaaaatgcatatgtgaatagtatgcta ctattcataagctgaatttgtttttttatatctcgacgtgtgagatgaattcaaacctgagattttgtggagttgt atagatatgttgtatgagtagcatcaaatttttttagaatttttcataacatgatttttaagaaaatgaggaaata ttctctcgacaaatcaaaatagtttcccgttaagtctcgctcgtcctagctgcaacgcatgtggtcatgtggagtt atcatcacgcaaccctgcacattatcacaaggttggctcgaccgattcatgggcctgtgcatgggcctggccaaga catgatattttggaaaaagtacaccgaaggtcctcaacttgtcatcgagttacaaaatcgtcccccaaatgcaaaa ccagatatccggcgtcccttaactaatcaaaactagtcccaataggttcttcggtggttttggctctagttttgtt ctacgtgatggctagtgtctaaaagtaccgtaataaattcaatctgcatgccttttgtaattttttttgctcatgt gtttatatacatgtggccaaatatgcatttgatgcactagctatcatttttgtcattttgtagttattccttttcc tttcctttttttttcctttttctttttgttgtcactagaggattcatatcctctcgattcctctatgaaacgtcgg cgttttctgcctcttttctgaagaatctgtatacctatataagaatcaaaaatgtcactctagttttggctctagt tttgg ctctatatagcgcggcgccctccgctcctcctagcttcagcaccagtgcacccgcacgc。

[0054] SEQ ID No:2

[0055] Catgattacgaattcgagctccagcaagtgacggtgttcgg。

[0056] SEQ ID No:3

[0057] Tccatggtacctgcaggatccttccacctaaaccctcctcacg。

[0058] SEQ ID No:4

[0059] Accacttcgaccgccactact。

[0060] SEQ ID No:5

[0061] Acgcctaagcctgctggtt。

[0062] SEQ ID No:6

[0063] Atgctagagtttgaccgc。

[0064] SEQ ID No:7

[0065] Agtgtgatggatcctgcc。

Claims

1. A mutant allele of the rice starch branching enzyme IIb gene promoter that regulates starch synthesis, characterized in that, An 852 bp base sequence was inserted before the -184th base upstream of the ATG translation start codon of the SBEIIb gene in the wild-type japonica rice variety Nipponbare. Meanwhile, a 28 bp base sequence from -185 to -212 was deleted, and the base C at the -238th position was mutated to T. The nucleotide sequence of the promoter mutant allele is as shown in SEQ ID No:

1.

2. Use of the promoter mutant allele according to claim 1 in rice breeding.

3. The application according to claim 2, characterized in that The promoter mutant allele down-regulates the expression of the SBEIIb gene and reduces the content of the SBEIIb protein.

4. The application according to claim 2, characterized in that, The promoter mutant allele increases the amylose content of rice and increases the proportion of long side chains of amylopectin.

5. The application according to claim 2, wherein The promoter mutant allele changes the crystal structure of rice starch.

6. The application according to claim 2, characterized in that, The promoter mutant allele increases the gelatinization temperature of rice starch.

7. The application according to claim 2, characterized in that, The promoter mutant allele increases the gelatinization resistance of rice flour.

8. A method for increasing the side chains of amylopectin in rice during elongation, characterized in that, Transfer the promoter mutant allele according to claim 1 into rice to obtain a variety of rice with extended amylopectin side chains.

9. A method for increasing the gelatinization temperature of rice starch, characterized in that, Transfer the promoter mutant allele according to claim 1 into rice to obtain a variety of rice with a higher gelatinization temperature of rice starch.

10. A method for improving the gelatinization resistance of rice rice, characterized in that, Transfer the promoter mutant allele according to claim 1 into rice to obtain a variety of rice with high gelatinization resistance of rice starch.

Images