Molecular marker related to soybean stalk strength and application thereof

Abstract

The invention belongs to the technical field of molecular markers, and discloses a molecular marker related to soybean stalk strength and application thereof. GWAS whole genome association analysis is combined with molecular marker development, the soybean stem strength is analyzed, the stable and reliable InDel molecular marker GmChr1739690797 which is closely linked with the stem strength and has polymorphism is obtained, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.4 or SEQ ID NO.5, the molecular marker is obtained by inserting / deleting a fragment TTGTACTAACGGTTTTAATTTTTATAGTTTATCAGGTG on the No.17 chromosome of a soybean, and the nucleotide sequence of the molecular marker is shown as SEQ ID NO.4 or SEQ ID NO.5. In addition, a primer pair corresponding to the molecular marker GmChr1739690797 is designed in the invention. The invention further provides a method for identifying the soybean stalk strength by using the molecular marker, and the method is simple, convenient and rapid, accurate in identification result and has good popularization and application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a molecular marker related to soybean stem strength and its application. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is an important food and oil crop, occupying an absolute position in the world's grain and oil system. According to statistics, cultivated soybeans meet about 50% of the world's vegetable oil demand and 25% of the plant protein demand, and penetrate the modern diet structure in various processed forms. With the expansion of the population and the continuous reduction of available arable land, the supply and demand relationship of soybeans is becoming increasingly tense; it is urgent to increase soybean yield on limited arable land. There are many factors affecting soybean yield per unit. Cultivation experts focus on external factors such as the natural environment and cultivation conditions, while ideal plant type, seed size, pod-setting potential, and growth period are the key concerns of breeders. The ideal plant type has become the optimal solution for increasing yield per unit. The soybean plant type affects a series of yield components such as pod-setting habit, pod number, seed distribution, and seed size, and is an important way to increase yield per unit. In terms of the pod-setting habit of soybeans, semi-dwarf breeding may reduce the pod number. On the contrary, more branches and stem nodes seem to imply higher growth potential, but it will also bring the problem of lodging, affecting seed distribution and restricting seed development.

[0003] Lodging is a complex agronomic phenomenon, which is closely related to crop species, physiological characteristics, and hydrographic, meteorological, and cultivation conditions, and is usually accompanied by serious yield reduction. For soybeans, lodging seriously affects seed distribution and yield. The research by Woods et al. (1977) showed that lodging can reduce the yield of cultivated soybeans by 10%; at the same time, lodging destroys the canopy structure, affects photosynthesis and dry matter production, and creates conditions for pod and stem diseases. From the perspective of agricultural production, in today's highly mechanized era, lodging is a key factor restricting the efficiency of mechanical harvesting. Insufficient soybean stem strength is likely to lead to lodging, affecting photosynthesis and nutrient transportation, resulting in yield reduction. Exploring lodging-related genes and screening varieties with high stem strength through molecular markers can directly reduce the lodging risk, ensure stable yield, and improve the adaptability of soybeans under climate change.

[0004] Genome-Wide Association Study (GWAS) can simultaneously detect genetic variations within a large-scale population across the whole genome, thereby identifying key genes or loci related to traits. Molecular markers are used for selection based on the association between genetic markers and target traits, so as to identify individuals or genotypes with target traits. Currently, a large number of molecular markers have been successfully developed and applied to the genetic breeding and genetic diversity analysis of crops. Among them, InDel (inserted or deleted fragments in the genome) markers design specific primers according to the sequences on both sides of the target locus and perform PCR amplification, showing polymorphisms in the lengths of amplified fragments. These markers have the characteristics of clear bands, strong stability, economy and convenience, and are applied in more and more crops.

[0005] Therefore, this study combines genome-wide association analysis to develop molecular markers related to stem strength, which is one of the effective means to accelerate the breeding process of new soybean materials and is conducive to promoting the cultivation of new high-yield and high-quality soybean varieties. Summary of the Invention

[0006] One of the objectives of the present invention is to provide a molecular marker related to soybean stem strength.

[0007] Another objective of the present invention is to provide the application of the above-mentioned molecular marker related to soybean stem strength.

[0008] To achieve the above objectives, the present invention adopts the following technical solutions: The molecular marker related to stem strength disclosed by the present invention is located on chromosome 17 of soybean, and the molecular marker is named Gm_Chr17_39690797.

[0009] Preferably, the above-mentioned molecular marker is an InDel marker.

[0010] The primer pair for amplifying the molecular marker related to soybean stem strength has the following sequences: Gm_Chr17_39690797-F: ACAAAATTGTTCTCTCATCTGAC (shown in SEQ ID NO.1); Gm_Chr17_39690797-R: TGGAAGAATCCTTAATAACTGAAGA (shown in SEQ ID NO.2).

[0011] The present invention also discloses the application of the above molecular marker primer pairs in molecular marker-assisted breeding related to soybean stem strength. That is to say, the molecular markers of the present invention can be used in future molecular marker-assisted breeding. By extracting the DNA of seedling-stage leaves and detecting whether the molecular markers of the present invention exist, the stem strength of soybean materials can be identified. The detection can use the PCR detection method, specifically, the above molecular marker primer pairs can be used, and the detection can also be carried out by sequencing.

[0012] The present invention also discloses the application of the above molecular markers in identifying soybean stem strength, especially in screening and identifying high and low soybean stem strength. Specifically, the specific steps for identifying high and low soybean stem strength are as follows: (1) Using the DNA of the tested germplasm as the template for PCR amplification, and performing PCR amplification with the primer pairs corresponding to the above molecular markers. The reaction system for PCR amplification is shown in Table 1: Table 1 Reaction system for PCR amplification

[0013] Pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 24 s, extension at 72°C for 24 s, 40 cycles; extension at 72°C for 10 min; preservation at 4°C.

[0014] (1) Agarose gel electrophoresis detection of PCR products: Take 2.5 μL and judge the high and low of soybean stem strength according to the band results.

[0015] Specifically: Perform PCR amplification using the primer pairs Gm_Chr17_39690797-F and Gm_Chr17_39690797-R. If the PCR amplification product has only one characteristic band with a length of 307 bp as shown in SEQ ID NO.4, then the soybean is a homozygous high-stem-strength type; or if it has a characteristic band with a length of 347 bp as shown in SEQ ID NO.5, then the soybean is a homozygous low-stem-strength type; if there are the above two bands, then the soybean is a heterozygous high-stem-strength type.

[0016] In addition, the present invention also protects a kit for identifying the stem strength of soybeans. The kit contains the primer pair Gm_Chr17_39690797-F and Gm_Chr17_39690797-R. Other components of the kit are all conventional reagents. Specifically, it also includes 10×PCR Buffer, dNTP, and Taq DNA polymerase. The present invention has no special limitation on the concentration of the primer pair, and the primer concentration well-known in the art can be used. The present invention has no special limitation on the sources of the 10×PCR Buffer, dNTP, and Taq DNA polymerase, and the common reagents for ordinary PCR amplification well-known in the art can be used.

[0017] Using the kit of the present invention, the stem strength of soybeans can be quickly identified, and the stem strength genotype of soybeans can also be quickly identified. For the specific method, refer to the specific steps for identifying the stem strength of soybeans. By performing electrophoresis detection and / or sequencing on the PCR amplification product, if the PCR amplification product has only one characteristic band with a length of 307 bp as shown in SEQ ID NO.4, then the soybean is a homozygous high-stem strength genotype; if the PCR amplification product has only one characteristic band with a length of 347 bp as shown in SEQ ID NO.5, then the soybean is a homozygous low-stem strength genotype; if there are the above two bands, then it is a heterozygous high-stem strength genotype.

[0018] The present invention has the following advantages: (1) The inventors of the present invention screened out a molecular marker Gm_Chr17_39690797 related to the stem strength of soybeans. This molecular marker is located on chromosome 17. Using the molecular marker Gm_Chr17_39690797 of the present invention, the stem strength of soybeans can be quickly identified. After verification, the amplification product of this molecular marker is stable, has high specificity, and has a high identification accuracy rate, and can simply and quickly identify the high or low stem strength of soybeans.

[0019] (2) Screening using markers linked to stem strength is beneficial for marker-assisted selection breeding. It can accurately identify target traits at the early stage of breeding, shorten the breeding cycle, and improve breeding efficiency.

[0020] (3) The molecular marker related to the stem strength of soybeans is a key link connecting basic research and applied breeding. By precisely improving agronomic traits through molecular techniques, the coordinated improvement of soybean yield, quality, and stress resistance can be achieved. This research not only provides an efficient tool for soybean genetic improvement but also provides a reference for the research on stem traits of other crops (such as corn and wheat). Description of the Drawings

[0021] Figure 1The results of the genome-wide association analysis of soybean stem strength are Manhattan plots obtained based on the analysis of GEMMA software. The InDel positions associated with the present invention are shown in the red signal regions.

[0022] Figure 2 This is the box plot of the stem strength distribution corresponding to the genotypes at the Gm_Chr17_39690797 locus in the soybean population in Example 1 of the present invention. 0 / 0 means that the genotype at the Gm_Chr17_39690797 locus is a homozygous high-stem-strength genotype, 1 / 1 means that the genotype at the Gm_Chr17_39690797 locus is a homozygous low-stem-strength genotype, and 0 / 1 means that the Gm_Chr17_39690797 locus is a heterozygous genotype. The dots show the data distribution, **** represents P <0.0001, * represents P <0.05.

[0023] Figure 3 This is the partial sequence alignment result of the high-stem-strength materials and low-stem-strength materials in the stem strength association region.

[0024] Figure 4 This is the electrophoresis map of the amplified molecular markers of 19 soybean germplasm resources at the Chr17_39690797 locus. The concentration of the agarose gel is 4%. Detailed implementation mode

[0025] The present invention will be further described below in conjunction with specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the specific experimental methods involved in the following embodiments are all conventional methods or are implemented according to the conditions recommended in the manufacturer's instructions unless otherwise specified.

[0026] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art. The test methods in the following embodiments are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be obtained by purchasing from the market.

[0027] Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to the described content can be applied to the present invention. The preferred implementation methods and materials described herein are only for demonstration purposes.

[0028] Example 1 Development of molecular markers related to soybean stem strength The present invention measures the stem strength of soybeans by the breaking resistance of the base of the soybean stem at the R4 growth stage (the first and second nodes of the ground stem). The higher this value, the higher the stem strength of the soybean material; the lower the value, the lower the stem strength of the soybean material. The stem strength of 238 soybean populations at the R4 stage was measured, and through GWAS analysis, a linkage region ( Figure 1 red locus) was mapped in soybeans. There is a 40bp InDel locus in the linkage region, named Gm_Chr17_39690797. This locus is located at the 39690797 locus on chromosome 17 of the soybean reference genome ( Glycine max Wm82.a4.v1: https: / / phytozome-next.jgi.doe.gov / info / Gmax_Wm82_a4_v1). The first allele genotype is 0 / 0; the second allele genotype is 1 / 1; the third allele genotype is 0 / 1. Figure 2 Figure 1 shows the box plot of the stem strength distribution corresponding to the genotypes of the Gm_Chr17_39690797 locus in the GWAS population, indicating that the stem strength of soybean materials with the genotype of 1 / 1 is extremely significantly different from that of soybean materials with the genotype of 0 / 0. After analysis, the insertion / deletion fragment TTGTACTAACGGTTTTAATTTTTTTATAGTTTATCAGGTG (shown in SEQ ID NO.3) ( Figure 3 ) on chromosome 17 of the soybean reference genome has an impact on the stem strength of soybeans. Soybeans with the inserted fragment shown in SEQ ID NO.3 are low-stem-strength soybeans; soybeans lacking the fragment shown in SEQ ID NO.3 are high-stem-strength soybeans.

[0029] According to this InDel variation and its upstream and downstream sequences, the following primers were designed using SnapGene: Gm_Chr17_39690797-F: ACAAAATTGTTCTCTCATCTGAC (shown in SEQ ID NO.1); Gm_Chr17_39690797-R: TGGAAGAATCCTTAATAACTGAAGA (shown in SEQ ID NO.2).

[0030] Using these primers for PCR amplification of the test samples, it was found that the PCR product of the homozygous high-stem-strength soybean material only had a characteristic band of 307bp, while the PCR product of the homozygous low-stem-strength soybean material had a characteristic band of 347bp, and the heterozygote had both bands.

[0031] Example 2 Verification of the accuracy of the molecular marker of the present invention To verify the accuracy of the molecular markers of the present invention, 42 germplasms were used for analysis and identification in this experiment. The specific germplasm materials used are shown in Table 2: Table 2 Stem strength at the R4 stage and genotypes corresponding to the Chr17_39690797 locus of 42 germplasm materials

[0032] 1) Using the genomic DNA of the soybean to be identified as a template, PCR amplification was carried out using the primer pair to obtain a PCR product; The reaction system for PCR amplification is as follows: 10 - 100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2 × Taq PCR Master Mix, and made up to 20 μL with deionized water; The reaction program for the PCR amplification is preferably: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 24 s, extension at 72°C for 20 s, 40 cycles; extension at 72°C for 10 min; preservation at 4°C. Electrophoretic separation was carried out on a 3% agarose gel. After loading the samples, electrophoresis was carried out at a direct current voltage of 120 V for 60 min, and then the PCR band patterns of each sample were read.

[0033] 2) The stem strength level of the soybean was judged according to the size of the PCR product. Specifically, when the fragment shown in SEQ ID NO.3 is missing in the PCR product of the soybean to be identified and the band length of the PCR product is 307 bp (SEQ ID NO.4), the soybean to be identified is a homozygous soybean with high stem strength.

[0034] The sequence of SEQ ID NO.4 is as follows: ACAAAATTGTTCTCTCATCTGACTTTTTTTTTTCAATTTAGTCTCTTAAATTTAAAAAATTAAAAATTTGTCCTTAAAATTTCTCATTTAGACCAATTAACCTTTCAGACAATTGTTTACTAAATTAATTAAGTTGGTGCGTGAAGCTGATATAATGACCAACTTAGTCTAATATAATTTAAAAATTAAAGTAAAATTTTAAAATTTAAGAGACTGTATTGATGAAACAAAAAAATCGAAGGGACCAAATTGTAGTTTAAAACAAAATAACATTCAAGAGATTCTTCAGTTATTAAGGATTCTTCCA When the PCR product of the soybean to be identified is a band inserted with the fragment shown in SEQ ID NO.3, and the length of one of the bands of the PCR product is 347 bp (SEQ ID NO.4), then the soybean to be identified is a homozygous soybean with low stem strength.

[0035] The sequence of SEQ ID NO.5 is as follows: ACAAAATTGTTCTCTCATCTGACTTTTTTTTTTCAATTTAGTCTCTTAAATTTAAAAAATTAAAAATTTGTCCTTAAAATTTCTCATTTAGACCAATTAACCTTTCAGACAATTGTTTGTACTAACGGTTTTAATTTTTTTATAGTTTATCAGGTGTTACTAAATTAATTAAGTTGGTGCGTGAAGCTGATATAATGACCAACTTAGTCTAATATAATTTAAAAATTAAAGTAAAATTTTAAAATTTAAGAGACTGTATTGATGAAACAAAAAAATCGAAGGGACCAAATTGTAGTTTAAAACAAAATAACATTCAAGAGATTCTTCAGTTATTAAGGATTCTTCCA When the above two bands appear simultaneously, it indicates that the soybean to be identified is a heterozygous soybean with high stem strength.

[0036] Moreover, as can be seen from Table 2, in this study, 42 soybean materials were identified. Among them, 31 soybean materials had a genotype of 0 / 0 at the Chr17_39690797 locus. After measurement, the average stem strength of these 31 soybean materials was 312.38 N, which were high-stem-strength soybeans; 8 soybean materials had a genotype of 1 / 1 at the Chr17_39690797 locus. After measurement, the average stem strength of these 8 soybean materials was 201.61 N, which were low-stem-strength soybeans. The T-test showed that the difference in stem strength between low-stem-strength and high-stem-strength soybeans was extremely significant ( P(<0.0001). The genotypes of 3 soybean materials showed the 0 / 1 type. Then, arbitrarily select 18 germplasms ('Yushan Big Black Bean', 'Anyi Small Black Bean', 'Xiping Brown-Faced Bean', 'Chifeng Green-Skinned Bean', 'Small White Soybean', 'Liyang Big Black Soybean', 'Millstone Soybean', 'Jinhua Soybean', 'Guanyun Sixty Days', 'Anlu Small Yellow Bean', 'Tian'e June Yellow', 'Small Winter Bean', 'Ant Egg', 'Qionghai Small Seed Black', 'Dahua Bean', 'Jinqing No. 1', 'Mung Bean No. 12', 'Nantong Big Green') and conduct PCR detection on them. The detection results correspond to the genotypes at the Chr17_39690797 locus and the actual determination results of the stem strength ( Figure 4 ), so the InDel molecular marker of the present invention can effectively identify the high and low of soybean stem strength and can be used for the prediction and screening of soybean materials with high stem strength.

[0037] The above embodiments are only the preferred embodiments of the present invention, which are only used to explain the present invention and do not limit the scope of the present invention. For those skilled in the art of this technology, of course, other implementation manners can be easily made by means of substitution or change according to the technical content disclosed in this specification. Therefore, all changes and improvements made on the principle of the present invention should be included within the scope of the patent application of the present invention.

Claims

1. A molecular marker related to the strength of soybean stalks, characterized in that, The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment TTGTACTAACGGTTTTAATTTTTTTATAGTTTATCAGGTG on chromosome 17 of soybean. The primer pair sequence corresponding to the molecular marker is as follows: Gm_Chr17_39690797-F: ACAAAATTGTTCTCTCATCTGAC; Gm_Chr17_39690797-R: TGGAAGAATCCTTAATAACTGAAGA.

2. The molecular marker related to the soybean stem strength according to claim 1, characterized in that The molecular marker is an InDel marker.

3. Application of the molecular marker according to claim 1 in identifying or assisting in identifying the stem strength of soybean.

4. A method for identifying the stem strength of soybeans, characterized in that, It includes the following steps: (1) Extract the genomic DNA of the soybean to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification with the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification product; (3) Make a determination according to the electrophoresis band and / or sequencing result in step (2). The specific criteria are as follows: When performing PCR amplification with the primer pair Gm_Chr17_39690797-F and Gm_Chr17_39690797-R, if the PCR amplification product has only one characteristic band with a length of 307bp as shown in SEQ ID NO.4, then the soybean is of the homozygous high stem strength type; if the PCR amplification product has only one characteristic band with a length of 347bp as shown in SEQ ID NO.5, then the soybean is of the homozygous low stem strength type; if the PCR amplification product has both a characteristic band with a length of 307bp as shown in SEQ ID NO.4 and a characteristic band with a length of 347bp as shown in SEQ ID NO.5, then the soybean is of the heterozygous high stem strength type.

5. Use of a kit in identifying soybean stem strength genotypes, characterized in that, The kit contains the primer pair corresponding to the molecular marker described in claim 1.

6. The application according to claim 5, wherein The method for identifying the stem strength genotype of soybean using the kit is as follows: (1) Extract the genomic DNA of the soybean to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification with the primer pair of the molecular marker described in claim 1, and perform electrophoresis detection and / or sequencing on the PCR amplification product; (3) Perform electrophoresis detection and / or sequencing on the PCR amplification product. If the PCR amplification product has only one characteristic band with a length of 307bp as shown in SEQ ID NO.4, then the soybean is of the homozygous high stem strength genotype; if the PCR amplification product has a characteristic band with a length of 347bp as shown in SEQ ID NO.5, then the soybean is of the homozygous low stem strength genotype; if the PCR amplification product has both a characteristic band with a length of 307bp as shown in SEQ ID NO.4 and a characteristic band with a length of 347bp as shown in SEQ ID NO.5, then the soybean is of the heterozygous high stem strength genotype.

Images