Molecular markers related to soybean culm strength and their applications

By developing the InDel marker Gm_Chr17_39690797 on soybean chromosome 17 and using PCR amplification and electrophoresis detection, the problem of difficult screening of soybean stem strength was solved, and rapid and accurate identification and improved breeding efficiency were achieved.

CN120290786BActive Publication Date: 2025-09-16SHANDONG AGRICULTURAL UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510787132.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-13
Publication Date
2025-09-16
Estimated Expiration
2045-06-13

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively screen and identify soybean stalk strength, resulting in a high risk of lodging, affecting photosynthesis and yield, and low efficiency of the breeding process.

Method used

An InDel marker, Gm_Chr17_39690797, located on soybean chromosome 17, was developed to identify soybean culm strength through PCR amplification and electrophoresis detection, and a dedicated kit was provided for rapid screening and identification.

Benefits of technology

It has achieved rapid and accurate identification of soybean stem strength, reduced the risk of lodging, shortened the breeding cycle, improved breeding efficiency, and increased soybean yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120290786B_ABST
    Figure CN120290786B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of molecular marker technology and discloses a molecular marker related to soybean culm strength and its application. The present invention uses GWAS genome-wide association analysis combined with molecular marker development to analyze soybean culm strength and obtains a polymorphic, stable and reliable InDel molecular marker Gm_Chr17_39690797 that is tightly linked to culm strength. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.5. The molecular marker is an insertion / deletion fragment TTGTACTAACGGTTTTAATTTTTTTATAGTTTATCAGGTG on soybean chromosome 17, and a primer pair corresponding to the molecular marker Gm_Chr17_39690797 is designed. The present invention also provides a method for identifying soybean culm strength using the molecular marker. The method is simple, rapid, and accurate in identification results, and has good prospects for promotion and application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a molecular marker related to soybean stalk strength and an application thereof. Background Art

[0002] Soybean (Glycine max (L.) Merr.) is a vital grain and oilseed crop, occupying a dominant position in the global food and oil system. According to statistics, cultivated soybeans meet approximately 50% of global vegetable oil demand and 25% of plant protein demand, and in a variety of processed forms, they permeate the modern diet. With population expansion and the continuous decline of available arable land, the supply and demand of soybeans is becoming increasingly strained, and increasing soybean yields on limited arable land is an urgent task. Numerous factors influence soybean yields. While cultivation experts focus on external factors such as the natural environment and growing conditions, breeders focus on ideal plant type, seed size, pod-setting potential, and growing period. The ideal plant type is the optimal solution for increasing yields. Soybean plant type influences a range of yield components, including pod-setting habit, pod quantity, seed distribution, and seed size, making it a key avenue for increasing yields. From the perspective of soybean pod-setting habits, semi-dwarf breeding may reduce the amount of pods. On the contrary, more branches and nodes seem to imply higher fertility potential, but it will also bring about the problem of lodging, affect seed distribution, and restrict seed development.

[0003] Lodging is a complex agronomic phenomenon, closely related to crop species, physiological characteristics, hydrological and meteorological conditions, and cultivation conditions, often resulting in significant yield losses. For soybeans, lodging severely impacts seed distribution and yield. Research by Woods et al. (1977) showed that lodging can reduce soybean yield by 10%. It also disrupts canopy structure, affecting photosynthesis and dry matter production, and creating conditions for pod and stem diseases. From the perspective of agricultural production, in today's highly mechanized world, lodging is a key factor limiting harvesting efficiency. Insufficient soybean stem strength can easily lead to lodging, impairing photosynthesis and nutrient transport, resulting in yield losses. Identifying lodging-related genes and selecting varieties with high stem strength through molecular markers can directly reduce the risk of lodging, ensure stable yields, and enhance soybean adaptability to climate change.

[0004] Genome-Wide Association Study (GWAS) can simultaneously detect genetic variation within large populations across the entire genome, thereby identifying key genes or loci associated with traits. Molecular markers are selected based on the association between genetic markers and target traits, thereby identifying individuals or genotypes with target traits. Currently, a large number of molecular markers have been successfully developed and applied to crop genetic breeding and genetic diversity analysis. Among them, InDel (insertion or deletion fragments in the genome) markers use specific primers designed based on the sequences on both sides of the target site for PCR amplification, showing polymorphism in the length of the amplified fragment. These markers have the characteristics of clear bands, strong stability, and economical and convenient application, and are being used in an increasing number of crops.

[0005] Therefore, this study combined whole-genome association analysis to develop molecular markers related to stem strength, which is one of the effective means to accelerate the breeding process of new soybean materials and is conducive to promoting the cultivation of new high-yield and high-quality soybean varieties. Summary of the Invention

[0006] One of the objectives of the present invention is to provide a molecular marker related to soybean stalk strength.

[0007] A second object of the present invention is to provide the application of the above-mentioned molecular markers related to soybean stalk strength.

[0008] To achieve the above object, the present invention adopts the following technical solutions:

[0009] The stalk strength-related molecular marker disclosed in the present invention is located on soybean chromosome 17, and the molecular marker is named Gm_Chr17_39690797.

[0010] Preferably, the above molecular marker is an InDel marker.

[0011] The primer pair for amplifying a molecular marker related to soybean culm strength is as follows:

[0012] Gm_Chr17_39690797-F:ACAAAATTGTTCTCTCATCTGAC (shown in SEQ ID NO. 1);

[0013] Gm_Chr17_39690797-R: TGGAAGAATCCTTAATAACTGAAGA (shown in SEQ ID NO. 2).

[0014] The present invention also discloses the use of the aforementioned molecular marker primer pair in marker-assisted breeding for soybean culm strength. Specifically, the molecular markers of the present invention can be used in future marker-assisted breeding. By extracting DNA from seedling leaves and detecting the presence of the molecular markers of the present invention, the culm strength of the soybean material can be identified. This detection can be performed using PCR, specifically the aforementioned molecular marker primer pair. Sequencing can also be used for this detection.

[0015] The present invention also discloses the use of the above molecular markers in identifying soybean stalk strength, particularly in screening and identifying soybean stalk strength. Specifically, the specific steps for identifying soybean stalk strength are as follows:

[0016] (1) The DNA of the test germplasm was used as a template for PCR amplification, and the primer pairs corresponding to the above molecular markers were used for PCR amplification. The PCR amplification reaction system is shown in Table 1:

[0017] Table 1 PCR amplification reaction system

[0018]

[0019] Pre-denaturation at 94°C for 4 min; 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 24 s, and extension at 72°C for 24 s; extension at 72°C for 10 min; and storage at 4°C.

[0020] (1) Agarose gel electrophoresis detection of PCR products: Take 2.5 μL and judge the strength of soybean stalks based on the results of the bands.

[0021] Specifically: PCR amplification is performed using primers Gm_Chr17_39690797-F and Gm_Chr17_39690797-R. If the PCR amplification product has only one characteristic band with a length of 307 bp as shown in SEQ ID NO.4, the soybean is a homozygous high stalk strength type; or if there is a characteristic band with a length of 347 bp as shown in SEQ ID NO.5, the soybean is a homozygous low stalk strength type; if there are both of the above bands, the soybean is a heterozygous high stalk strength type.

[0022] In addition, the present invention also protects a kit for identifying soybean stalk strength, comprising the primer pair Gm_Chr17_39690797-F and Gm_Chr17_39690797-R. The other components of the kit are conventional reagents, including 10×PCR Buffer, dNTPs, and Taq DNA polymerase. The present invention does not impose any particular restrictions on the concentration of the primer pair; primer concentrations well known in the art may be employed. The present invention does not impose any particular restrictions on the sources of the 10×PCR Buffer, dNTPs, and Taq DNA polymerase; conventional PCR amplification reagents well known in the art may be employed.

[0023] The kit of the present invention can be used to quickly identify soybean stalk strength and the stalk strength genotype of the soybean. The specific method is similar to the specific steps for identifying the high and low stalk strength of soybeans. The PCR amplification product is subjected to electrophoresis detection and / or sequencing. If the PCR amplification product has only one characteristic band of 307 bp in length as shown in SEQ ID NO.4, the soybean is a homozygous high stalk strength genotype; if the PCR amplification product has only one characteristic band of 347 bp in length as shown in SEQ ID NO.5, the soybean is a homozygous low stalk strength genotype; if the PCR amplification product has both bands, the soybean is a heterozygous high stalk strength genotype.

[0024] The present invention has the following advantages:

[0025] (1) The inventors of the present invention have screened out a molecular marker Gm_Chr17_39690797 related to soybean stalk strength. The molecular marker is located on chromosome 17. The molecular marker Gm_Chr17_39690797 of the present invention can be used to quickly identify the stalk strength of soybeans. It has been verified that the amplification product of the molecular marker is stable, highly specific, and has a high identification accuracy rate. It can simply and quickly identify the strength of soybean stalks.

[0026] (2) Screening using markers linked to stem strength is beneficial for molecular marker-assisted selection breeding. It can accurately identify target traits in the early stages of breeding, shorten the breeding cycle, and improve breeding efficiency.

[0027] (3) Molecular markers related to soybean culm strength are a key link between basic research and applied breeding. Through molecular technology, we can precisely improve agronomic traits and achieve a synergistic improvement in soybean yield, quality, and stress resistance. This research not only provides an efficient tool for soybean genetic improvement, but also provides a reference for culm trait research in other crops (such as corn and wheat). BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1This is the genome-wide association analysis result of soybean culm strength, which is a Manhattan plot obtained based on GEMMA software analysis. The red signal area shows the InDel position associated with the present invention.

[0029] Figure 2 This is a box plot of the stalk strength distribution corresponding to the genotype of the Gm_Chr17_39690797 locus of the soybean population in Example 1 of the present invention. 0 / 0 means that the genotype of the Gm_Chr17_39690797 locus is a homozygous high stalk strength genotype, 1 / 1 means that the genotype of the Gm_Chr17_39690797 locus is a homozygous low stalk strength genotype, and 0 / 1 means that the Gm_Chr17_39690797 locus is a heterozygous genotype. The dots show the data distribution, and **** represents P <0.0001, * represents P <0.05.

[0030] Figure 3 This is the partial sequence alignment result of high stem strength materials and low stem strength materials in the stem strength related region.

[0031] Figure 4 This is the electrophoresis diagram of the molecular marker amplified at the Chr17_39690797 site of 19 soybean germplasm resources. The concentration of the agarose gel is 4%. DETAILED DESCRIPTION

[0032] The present invention will be further described below with reference to specific examples, and the advantages and features of the present invention will become more apparent as the description proceeds. However, the specific experimental methods involved in the following examples, unless otherwise specified, are all conventional methods or are performed under the conditions recommended by the manufacturer's instructions.

[0033] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. Unless otherwise specified, the reagents and materials used can be purchased from the market.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meanings as those familiar to those skilled in the art. Furthermore, any methods and materials similar or equivalent to those described herein can be applied to the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0035] Example 1 Development of molecular markers related to soybean culm strength

[0036] The present invention measures soybean stalk strength by the bending strength of the stem base (1-2 nodes of the ground stem) at the soybean R4 growth stage. The higher the value, the higher the stalk strength of the soybean material; the lower the value, the lower the stalk strength of the soybean material. The stalk strength of 238 soybean populations at the R4 stage was measured, and through GWAS analysis, a linkage region ( Figure 1 The red site contains a 40bp InDel site in the linkage region, named Gm_Chr17_39690797. This site is located in the soybean reference genome ( Glycine max Wm82.a4.v1: https: / / phytozome-next.jgi.doe.gov / info / Gmax_Wm82_a4_v1) at locus 39690797 on chromosome 17, where the first allele type is 0 / 0; the second allele type is 1 / 1; and the third allele type is 0 / 1. Figure 2 The box plot of the stalk strength distribution corresponding to the genotype of the Gm_Chr17_39690797 locus in the GWAS population is shown, indicating that the stalk strength of soybean materials with genotype 1 / 1 is significantly different from that of soybeans with genotype 0 / 0. After analysis, the insertion / deletion fragment TTGTACTAACGGTTTTAATTTTTTTATAGTTTATCAGGTG (shown in SEQ ID NO.3) on chromosome 17 of the soybean reference genome was found. Figure 3 ), which has an impact on soybean stalk strength. The soybean with the fragment shown in SEQ ID NO.3 inserted is a soybean with low stalk strength; the soybean without the fragment shown in SEQ ID NO.3 is a soybean with high stalk strength.

[0037] Based on the InDel variant and its upstream and downstream sequences, the following primers were designed using SnapGene:

[0038] Gm_Chr17_39690797-F:ACAAAATTGTTCTCTCATCTGAC (shown in SEQ ID NO. 1);

[0039] Gm_Chr17_39690797-R: TGGAAGAATCCTTAATAACTGAAGA (shown in SEQ ID NO. 2).

[0040] The primers were used to perform PCR amplification on the test samples. The results showed that the PCR product of the homozygous soybean material with high stalk strength had only a characteristic band of 307bp, the PCR product of the homozygous soybean material with low stalk strength had a characteristic band of 347bp, and the heterozygous had both bands.

[0041] Example 2 Verification of the Accuracy of the Molecular Markers Described in the Present Invention

[0042] In order to verify the accuracy of the molecular markers of the present invention, 42 germplasms were used for analysis and identification in this experiment. The specific germplasm materials used are shown in Table 2:

[0043] Table 2 Stalk strength of 42 germplasm materials at R4 stage and the genotype corresponding to the Chr17_39690797 locus

[0044]

[0045] 1) using the genomic DNA of the soybean to be identified as a template, performing PCR amplification using the primer pair to obtain a PCR product;

[0046] The PCR amplification reaction system is as follows: 10–100 ng of template DNA, 1 μL of 10 μM forward primer, 1 μL of 10 μM reverse primer, 10 μL of 2× Taq PCR Master Mix, and deionized water to 20 μL. The PCR amplification reaction procedure is preferably as follows: pre-denaturation at 94°C for 4 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 24 s, and extension at 72°C for 20 s, followed by extension at 72°C for 10 min, and storage at 4°C. Separation was performed by electrophoresis on a 3% agarose gel. After spotting, the samples were electrophoresed at 120 V DC for 60 min, and the PCR banding pattern of each sample was determined.

[0047] 2) Determine the stalk strength of the soybean based on the size of the PCR product. Specifically, when the fragment represented by SEQ ID NO. 3 is missing from the PCR product of the soybean to be identified, the PCR product band length is 307 bp (SEQ ID NO. 4), indicating that the soybean to be identified is homozygous for high stalk strength.

[0048] The sequence of SEQ ID NO.4 is as follows:

[0049] ACAAAATTGTTCTCTCATCTGACTTTTTTTTTCAATTTAGTCTCTTAAATTTAAAAAATTAAAAATTTGTCCTTAAAATTTCTCATTTAGACCAATTAACCTTTCAGACAATTGTTTACTAAATTAATTAAGTTGGTGCGTGAAGCTGATAT AATGACCAACTTAGTCTAATATAATTTAAAAATTAAAGTAAAATTTTAAAATTTAAGAGACTGTATTGATGAAACAAAAAAATCGAAGGGACCAAATTGTAGTTTAAAACAAAATAACATTCAAGAGATTCTTCAGTTATTAAGGATTCTTCCA

[0050] When the PCR product of the soybean to be identified is a band inserted into the fragment shown in SEQ ID NO. 3, and the length of the PCR product band is 347 bp (SEQ ID NO. 4), the soybean to be identified is a homozygous low stalk strength soybean.

[0051] The sequence of SEQ ID NO.5 is as follows:

[0052] ACAAAATTGTTTCCTCATCTGACTTTTTTTTTCAATTTAGTCTCTTAAATTTAAAAAATTAAAAATTTGTCCTTAAAATTTCTCATTTAGACCAATTAACCTTTCAGACAATTGTTTGTACTAACGGTTTTAATTTTTTATAGTTTATCAGGTGTTACTAAATTAATTAAG TTGGTGCGTGAAGCTGATAATAATGACCAACTTAGTCTAATAATAATTTAAAAATTAAAGTAAAATTTTAAAATTTAAGAGACTGTATTGATGAAACAAAAAAATCGAAGGGACCAAATTGTAGTTTAAAACAAAATAACATTCAAGAGATTCTTCAGTTATTAAGGATTCTTCCA

[0053] When the above two bands appear at the same time, it indicates that the soybean to be identified is a hybrid soybean with high stalk strength.

[0054] Furthermore, as can be seen from Table 2, of the 42 soybean materials identified in this study, 31 had a 0 / 0 genotype at the Chr17_39690797 locus. The average stalk strength of these 31 soybean materials was 312.38 N, indicating high stalk strength soybeans. Eight had a 1 / 1 genotype at the Chr17_39690797 locus. The average stalk strength of these eight soybean materials was 201.61 N, indicating low stalk strength soybeans. The T-test showed that the difference in stalk strength between low and high stalk strength soybeans was extremely significant ( P <0.0001). There were also 3 soybean materials with genotypes of 0 / 1 type. 18 germplasms were randomly selected ('Yushan Big Black Bean', 'Anyi Small Black Bean', 'Xiping Brown Bean', 'Chifeng Green Peel Bean', 'Small White Soybean', 'Lianyang Big Black Soybean', 'Moshi Soybean', 'Jinhua Soybean', 'Guanyun Sixty Days', 'Anlu Small Soybean', 'Tian'e Sixty-Month Yellow', 'Small Winter Bean', 'Ant Egg', 'Qionghai Small Black Bean', 'Dahua Bean', 'Jinqing No. 1', 'Green Bean No. 12', 'Nantong Dayangqing') and subjected to PCR testing. The test results were consistent with the genotype at the Chr17_39690797 locus and the actual stalk strength measurement results ( Figure 4 ), so the InDel molecular marker of the present invention can effectively identify the strength of soybean stalks and can be used for the prediction and screening of high stalk strength soybean materials.

[0055] The embodiments described above are only preferred embodiments of the present invention and are only used to explain the present invention, not to limit the scope of implementation of the present invention. For those skilled in the art, it is of course possible to easily make other implementation methods by replacing or changing the technical content disclosed in this specification. Therefore, all changes and improvements made on the principles of the present invention should be included in the scope of the patent application of the present invention.

Claims

1. A molecular marker associated with soybean culm strength, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.4 or SEQ ID NO.

5. The molecular marker is an insertion / deletion fragment TTGTACTAACGGTTTTAATTTTTTTATAGTTTATCAGGTG on soybean chromosome 17. The primer pair sequence corresponding to the molecular marker is: Gm_Chr17_39690797-F: ACAAAATTGTTCTCTCATCTGAC; Gm_Chr17_39690797-R:TGGAAGAATCCTTAATAACTGAAGA.

2. Use of the molecular marker according to claim 1 in identifying or assisting in identifying soybean stalk strength.

3. A method for identifying soybean stalk strength, characterized in that: The steps include: (1) Extracting soybean genomic DNA; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) Determine based on the electrophoresis bands and / or sequencing results of step (2). The specific criteria are: PCR amplification was performed using primer pairs Gm_Chr17_39690797-F and Gm_Chr17_39690797-R. If the PCR amplification product had only one characteristic band with a length of 307 bp as shown in SEQ ID NO.4, the soybean was a homozygous high stalk strength type; if the PCR amplification product had only one characteristic band with a length of 347 bp as shown in SEQ ID NO.5, the soybean was a homozygous low stalk strength type; if the PCR amplification product had both a characteristic band with a length of 307 bp as shown in SEQ ID NO.4 and a characteristic band with a length of 347 bp as shown in SEQ ID NO.5, the soybean was a heterozygous high stalk strength type.

4. A kit for identifying soybean stalk strength genotypes, characterized in that: The kit comprises a primer pair corresponding to the molecular marker described in claim 1, and the method for identifying soybean stalk strength genotype using the kit is as follows: (1) Extracting soybean genomic DNA; (2) using the genomic DNA extracted in step (1) as a template, performing PCR amplification using the primer pair of the molecular marker described in claim 1, and performing electrophoresis detection and / or sequencing on the PCR amplification product; (3) The PCR amplification products were subjected to electrophoresis detection and / or sequencing. If the PCR amplification product had only one characteristic band of 307 bp in length as shown in SEQ ID NO.4, the soybean was a homozygous high stalk strength genotype; if the PCR amplification product had one characteristic band of 347 bp in length as shown in SEQ ID NO.5, the soybean was a homozygous low stalk strength genotype; if the PCR amplification product had both one characteristic band of 307 bp in length as shown in SEQ ID NO.4 and one characteristic band of 347 bp in length as shown in SEQ ID NO.5, the soybean was a heterozygous high stalk strength genotype.

Citation Information

Patent Citations

  • Standard plasmid molecules applicable to specific detection of three transgenic soybean lines

    CN102586309A

  • InDel molecular marker for identifying close planting resistance of soybeans and application of InDel molecular marker

    CN116555471A