Method for in situ detection of antigen-specific t cells and uses thereof

By using primer exchange reactions and DNA origami in DNA nanotechnology, combined with programmable pMHC polymers containing fluorescent groups, the problem of rapid and sensitive detection of antigen-specific T cells has been solved. This enables highly sensitive detection of high and low affinity T cells, providing key information on the location and development mechanism of tumor responses.

CN120294326BActive Publication Date: 2025-12-05EAST CHINA NORMAL UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510284113.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-11
Publication Date
2025-12-05
Estimated Expiration
2045-03-11

AI Technical Summary

Technical Problem

Existing technologies are limited in their ability to detect antigen-specific T cells quickly, directly, and sensitively, especially in detecting low-affinity T cells in the tumor microenvironment. Furthermore, in situ protein detection is subject to interference from non-specific T cell markers.

Method used

By employing programmable pMHC polymers (such as DOS-pMHCs) based on DNA nanotechnology, and combining them with fluorescent groups through primer exchange reactions and DNA origami techniques, highly sensitive and controllable signal amplification in situ detection of antigen-specific T cells can be achieved.

Benefits of technology

This technology enables visualization of the spatial distribution and abundance of antigen-specific T cells, improves the detection sensitivity and specificity of high and low affinity T cells, and provides key information on the location and mechanism of tumor response.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120294326B_ABST
    Figure CN120294326B_ABST
Patent Text Reader

Abstract

The application discloses an antigen-specific T cell in-situ detection method and application, wherein pMHC monomers (peptide-MHC complexes) are nano-spatially organized on a DNA origami scaffold, the valence of pMHC is significantly improved, and stable combination with low-affinity T cells in a tissue slice is realized. Meanwhile, the precise addressing ability of the DNA origami and the design of a signal capture chain are utilized, and the amplification efficiency of a detection signal is greatly improved. In addition, a primer exchange reaction (PER reaction) is utilized to generate a single-stranded DNA product with repeated primer sequences (primer 1 and primer 2), a dendritic structure is formed on the DNA origami scaffold to combine multiple fluorescent groups, and antibody-independent high-fluorescence-intensity in-situ detection is realized, so that the experimental process is simplified and the detection cost is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of nucleic acid molecule nanotechnology and immunodetection, and relates to an antigen-specific T cell in-situ detection method and application. BACKGROUND

[0002] Inflammation and cancer-induced adaptive immune responses are closely related to the number and distribution of antigen-specific T cells. In immunotherapy, the unpredictability of disease progression is often related to the heterogeneity of inflammatory microenvironments and the phenotypic characteristics of antigen-specific T cells. Therefore, in-situ detection of antigen-specific T cells is crucial for disease prediction and treatment. By visualizing the spatial distribution and abundance changes of antigen-specific T cells in tissues, the dynamic process of immune responses can be accurately tracked, providing key clues for tumor development and helping to evaluate treatment effects.

[0003] Currently, in-situ detection of antigen-specific T cells mainly relies on mRNA and protein level analysis. In terms of mRNA detection, existing methods can analyze TCR VDJ sequences to identify a large number of TCR clones, but it is difficult to directly and quickly obtain antigen-specific information. Protein in-situ detection faces the problem of marker expression interference of non-specific T cells in the tumor microenvironment, therefore, direct detection of specific TCR proteins is needed. As a gold standard, MHC tetramer performs well in detecting high-affinity TCRs for known antigens, but has limitations in detecting low-affinity T cells. Therefore, there is an urgent need for a highly sensitive and direct in-situ detection method for accurate identification of antigen-specific T cells. SUMMARY

[0004] The purpose of the present application is to provide an antigen-specific T cell in-situ detection method for visualizing the spatial distribution and abundance of antigen-specific T cells in tissues, thereby accurately tracking and recording the expansion and contraction stages of antigen-specific cytotoxic reactions, and providing important information for the location of in vivo anti-tumor responses and the mechanism of tumor development.

[0005] The present application is based on the combination of DNA nanotechnology and immunodetection technology, and establishes an antigen-specific T cell in-situ detection method with high binding affinity, strong staining efficiency, low background and controllable signal amplification.

[0006] <First aspect>

[0007] An antigen-specific T cell in-situ detection method based on primer exchange reaction and DNA origami programmable pMHC multimers P-DOS-pMHCs, comprising the following steps:

[0008] S1, pretreating the tissue sample to be tested;

[0009] S2, reacting the programmable pMHC multimer P-DOS-pMHCs based on primer exchange reaction and DNA origami with the pretreated tissue sample of step S1 for a period of time; fixing, quenching and washing the tissue sample;

[0010] S3, adding short single-stranded DNA coupled with a fluorescent group to the tissue sample treated in step S2 and reacting;

[0011] S4, staining and mounting the tissue sample treated in step S3, and imaging and analyzing.

[0012] In step S3, the short single-stranded DNA coupled with a fluorescent group is a short DNA strand coupled with AF488, and the sequence is shown in SEQ ID NO. 21.

[0013] In step S1, the pretreatment of the tissue sample is to fix the tissue sample in 4-6% paraformaldehyde at 2-8°C overnight, then incubate in 15-20% sucrose solution for 6-12h, further incubate in 25-35% sucrose solution at 4°C overnight, then embed in embedding agent (such as OCT compound), quickly freeze in liquid nitrogen, and slice using a cryostat to prepare tissue sample sections.

[0014] In step S2, the preparation method of the P-DOS-pMHCs includes the following steps:

[0015] S21, generating single-stranded DNA products containing repeated primer sequences by PER reaction, and constructing biotinylated DNA origami;

[0016] S22, incubating the biotinylated DNA origami and the single-stranded DNA products containing repeated primer sequences together to obtain DNA origami based on PER reaction;

[0017] S23, incubating the biotinylated pMHC monomer and the DNA origami based on PER reaction to obtain P-DOS-pMHCs.

[0018] Forming a dendritic structure on DNA origami through primer exchange reaction (PER reaction) to achieve antibody-independent high-fluorescence in situ detection: using P-DOS-pMHCs to specifically recognize antigen-specific T cells on frozen tissue sections; adding short single-stranded DNA coupled with a fluorescent group to achieve in situ visualization.

[0019] In step S23, the biotinylated pMHC monomer includes H-2Kb&B2M&OVA (SIINFEKL) and H-2Kd&B2M&InsB (LYLVCGERL).

[0020] In steps S22 and S23, the incubation conditions are incubation at room temperature for 4-8 hours.

[0021] The method for preparing the biotinylated DNA origami in S22 comprises the following steps:

[0022] S221, mixing M13mp18 DNA and several DNA strands constituting the framework structure to form a reaction system;

[0023] S222, performing thermal cycle treatment on the reaction system; and gradiently cooling;

[0024] S223, purifying the product after step S222 (for example, an ultrafilter with a molecular weight cutoff value of 50-200 kDa can be used) to obtain the biotinylated DNA origami.

[0025] In step S221, the several DNA strands constituting the framework structure comprise:

[0026] The several DNA short sequences constituting the first side of the framework structure comprise sequences from A01 to A31, A33 to A65 as recorded in pages S11-S12 in the Supporting online information of Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, R. N., & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249, and the sequence shown in SEQ ID NO. 18 (A32-P);

[0027] Several short DNA sequences that constitute the second side of the framework structure include the sequences from B01 to B31 and B33 to B65 recorded on pages S12-S14 of the Supporting online information of the paper Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249, and the sequence shown in SEQ ID NO.19;

[0028] Several short DNA sequences forming the third side of the framework structure, including the sequences from C01 to C31 and C33 to C65 recorded on pages S14-S15 of the Supporting online information of the paper Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249, and the sequence shown in SEQ ID NO.20;

[0029] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0030] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, CO4, C20, C49, and C61 are biotinylated to form biotin-modified single-stranded DNA (Biotin-DNA).

[0031] In one embodiment of the present invention, in step S21, the biotinylated DNA origami is streptavidin SA-labeled biotinylated DNA origami.

[0032] The method for preparing the streptavidin SA-labeled biotinylated DNA origami includes the following steps:

[0033] M13mp18 DNA and several DNA strands that make up the framework structure are mixed to form a reaction system; the reaction system is subjected to thermal cycling; and then gradually cooled to room temperature; the product is purified using an ultrafilter with a molecular weight cutoff value of 50-200 kDa; the purified product is co-incubated with streptavidin SA at room temperature to obtain SA-labeled biotinylated DNA origami.

[0034] The reaction system described above also includes TAE-Mg 2+ The buffer solution consisted of 40 mM Tris, 20 mM acetic acid, 2 mM EDTA, and 12.5 mM MgCl2, with a pH of 7.5–8.5. The total volume of the reaction system was 50–200 μL.

[0035] The specific steps of the above-mentioned thermal cycling treatment and gradient cooling are as follows: maintain at 90-100℃ for 3-7 minutes, and then gradually cool down to 20-30℃ at a rate of 0.05-0.2℃ / min.

[0036] In S21, the step of generating a single-stranded DNA product containing repeating primer sequences via the PER reaction includes the following steps:

[0037] a. Prepare a reaction system containing the following components:

[0038] 10ul 10xPBS;

[0039] The final concentration is 10 mM MgSO4;

[0040] 400-1000 U / ml Bst DNA polymerase;

[0041] 600uM dATP, dCTP, dTTP;

[0042] 100 nM Clean-G Hairpin DNA, the sequence of which is shown in SEQ ID NO. 17;

[0043] 0.5 μM Hairpin1 and / 0.3 μM Hairpin2; the sequence of Hairpin1 is shown in SEQ ID NO. 14; the sequence of Hairpin2 is shown in SEQ ID NO. 16;

[0044] Add double-distilled water to bring the volume to 90ul;

[0045] b. Perform incubation and primer addition, including:

[0046] Incubate at 37°C for 15 minutes, add 10 μL of 10 μM primer 1 or primer 2, continue incubating at 37°C for 1-3 hours, then raise the temperature to 80°C and hold for 20 minutes to obtain the product; the sequence of primer 1 is shown in SEQ ID NO. 13, and the sequence of primer 2 is shown in SEQ ID NO. 17.

[0047] In step S2, the concentration of P-DOS-pMHCs is 10-20 nM, the reaction time with tissue samples is 10-24 hours, and the reaction conditions are 4-8 degrees Celsius. Programmable pMHC multimers can enhance the recognition ability of antigen-specific T cells through their highly tunable structural design, and improve their sensitivity and specificity in immunoassays through multimerization.

[0048] The second aspect:

[0049] This invention provides a method for in situ detection of antigen-specific T cells using programmable pMHC multimers DOS-pMHCs based on a two-dimensional DNA origami scaffold, comprising the following steps:

[0050] A. Preprocessing of the tissue sample to be tested;

[0051] B. After reacting the programmable pMHC polymer DOS-pMHCs based on DNA origami with the tissue sample pretreated in step A for a period of time, the tissue sample is fixed, quenched, and washed.

[0052] C. The tissue samples processed in step B are incubated with primary antibody and secondary antibody;

[0053] D. The tissue samples processed in step C are stained, mounted, and then imaged and analyzed.

[0054] In step A, the pretreatment steps for tissue samples are as follows: fix the tissue samples overnight in 4-6% paraformaldehyde at 2-8°C, then incubate them in 15-20% sucrose solution for 6-12 hours, and further incubate them overnight in 25-35% sucrose solution at 4°C. Then embed them in an embedding agent (such as an OCT compound), rapidly freeze them in liquid nitrogen, and slice them using a cryostat to prepare tissue sample sections.

[0055] The programmable pMHC polymers DOS-pMHCs based on DNA origami are prepared by a method including the following steps:

[0056] (i) Construct biotinylated DNA origami with overhang sequences;

[0057] (ii) Co-incubate PE-labeled poly(A) DNA with the biotinylated DNA having the overhang sequence;

[0058] (iii) Combine streptavidin SA with the product obtained in step (ii);

[0059] (iv) The biotinylated pMHC monomer is combined with the product obtained in step (iii) to form DOS-pMHCs.

[0060] In (i), the steps for pretreatment of tissue samples are to fix the tissue samples overnight in 4-6% paraformaldehyde at 2-8°C, then incubate them in 15-20% sucrose solution for 6-12 hours, further incubate them overnight in 25-35% sucrose solution at 4°C, then embed them in an embedding agent (such as an OCT compound), rapidly freeze them in liquid nitrogen, and section them using a cryostat.

[0061] In (ii), the preparation method of PE-labeled poly(A) DNA is as follows: biotinylated poly(A) DNA short chain is incubated with R-phycoerythrin-labeled streptavidin (PE-SA) in the dark (incubated at room temperature for 30-60 min) to obtain PE-labeled poly(A) DNA.

[0062] The sequence of the biotinylated poly(A) DNA short chain is shown in SEQ ID NO.22.

[0063] In step B, the programmable pMHC multimers DOS-pMHCs based on DNA origami are diluted in incubation buffer and reacted with the tissue samples pretreated in step A at 2-8°C for 10-24 hours.

[0064] (i) The method for preparing biotinylated DNA origami with overhang sequences includes the following steps:

[0065] (i-1) Mix M13mp18 DNA and several DNA strands that make up the framework structure to form a reaction system;

[0066] (i-2) The reaction system is subjected to thermal cycling and then gradually cooled to room temperature;

[0067] (i-3) The product after step (i-2) is purified using an ultrafilter with a molecular weight cutoff value of 50-100 kDa to obtain biotinylated DNA origami with an overhang sequence.

[0068] In (i-2), the reaction system also includes TAE-Mg 2+ The buffer solution consisted of 40 mM Tris, 20 mM acetic acid, 2 mM EDTA, and 12.5 mM MgCl2, with a pH of 7.5–8.5. The total volume of the reaction system was 50–200 μL.

[0069] In (i-2), the specific steps of thermal cycling and gradient cooling are as follows: hold at 90-100℃ for 3-7 minutes, and then gradually cool down to 20-30℃ at a rate of 0.05-0.2℃ / min.

[0070] In (i-3), the product after thermal cycling was purified using an ultrafilter with a molecular weight cutoff of 50-200 kDa. The product was centrifuged at 3000-10000 g for 2-5 minutes, and repeated 2-5 times. After inverting the filter, the biotinylated DNA origami with an overhang sequence was collected by centrifugation at 1000-5000 g for 2-5 minutes.

[0071] In (i-1), the plurality of DNA strands constituting the framework structure include:

[0072] The short single-stranded DNA that makes up the nucleic acid framework structure includes:

[0073] Several short DNA sequences that make up the first side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from A01 to A65 are recorded on pages S11-S12 of the Supporting online information of the paper.

[0074] Several short DNA sequences that make up the second side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from B01 to B65 are recorded on pages S12-S14 of the Supporting online information of the paper.

[0075] Several short DNA sequences that form the third side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from C01 to C65 are recorded on pages S14-S15 of the Supporting online information of the paper.

[0076] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0077] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, CO4, C20, C49, and C61 are biotin-modified to form biotin-modified single-stranded DNA.

[0078] Overhang (TTTTTTTTTTTT) sequences were ligated into A05, B05, and C05 to form DNA strands with overhangs (the overhangs are poly(T)DNA sequences), and these were denoted as A05-Poly(T). 12 B05-Poly(T) 12 C05-Poly(T) 12 .

[0079] A05-Poly(T) 12 The sequence is shown in SEQ ID NO. 1.

[0080] B05-Poly(T) 12 The sequence is shown in SEQ ID NO. 2.

[0081] C05-Poly(T) 12 The sequence is shown in SEQ ID NO. 3; the number of DOS-pMHCs phycoerythrin bound in this embodiment is 3.

[0082] As one embodiment of the present invention, the short single-stranded DNA constituting the nucleic acid framework structure includes:

[0083] Several short DNA sequences that make up the first side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. Pages S11-S12 of the Supporting online information of the paper are listed from A01 to A65.

[0084] Several short DNA sequences that make up the second side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from B01 to B65 are recorded on pages S12-S14 of the Supporting online information of the paper.

[0085] Several short DNA sequences that form the third side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from C01 to C65 are recorded on pages S14-S15 of the Supporting online information of the paper.

[0086] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0087] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, CO4, C20, C49, and C61 are biotin-modified to form biotin-modified single-stranded DNA.

[0088] Overhang (TTTTTTTTTTTT) sequences were ligated into A05, A31, B05, B31, C05, and C31 to form DNA strands with overhangs (the overhangs are poly(T)DNA sequences), and these strands were denoted as A05-Poly(T). 12 A31-Poly(T) 12 B05-Poly(T) 12 B31-Poly(T) 12 C05-Poly(T) 12 C31-Poly(T) 12 .

[0089] A05-Poly(T) 12 The sequence is shown in SEQ ID NO. 1.

[0090] B05-Poly(T) 12 The sequence is shown in SEQ ID NO. 2.

[0091] C05-Poly(T) 12 The sequence is shown in SEQ ID NO. 3.

[0092] A31-Poly(T) 12The sequence is shown in SEQ ID NO. 4.

[0093] B31-Poly(T) 12 The sequence is shown in SEQ ID NO. 7.

[0094] C31-Poly(T) 12 The sequence is shown in SEQ ID NO. 10; the number of DOS-pMHCs phycoerythrin bound in this embodiment is 6.

[0095] In another embodiment of the present invention, the short single-stranded DNA constituting the nucleic acid framework structure includes:

[0096] Several short DNA sequences that make up the first side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. Pages S11-S12 of the Supporting online information of the paper are listed from A01 to A65.

[0097] Several short DNA sequences that make up the second side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from B01 to B65 are recorded on pages S12-S14 of the Supporting online information of the paper.

[0098] Several short DNA sequences that form the third side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from C01 to C65 are recorded on pages S14-S15 of the Supporting online information of the paper.

[0099] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0100] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, C04, C20, C49, and C61 are biotin-modified to form biotin-modified single-stranded DNA.

[0101] Overhang sequences (TTTTTTTTTTTT) were ligated into A05, A31, A42, A63, B05, B31, B42, B63, C05, C31, C42, and C63 to form DNA strands with overhangs (the overhang being a poly(T)DNA sequence), and these were denoted as A05-Poly(T). 12 A31-Poly(T) 12 A42-Poly(T) 12A63-Poly(T) 12 B05-Poly(T) 12 B31-Poly(T) 12 B42-Poly(T) 12 B63-Poly(T) 12 C05-Poly(T) 12 C31-Poly(T) 12 C42-Poly(T) 12 C63-Poly(T) 12 The number of DOS-pMHCs phycoerythrins bound in this embodiment is 12.

[0102] In step C, rabbit anti-PE and rat anti-CD8α antibodies were added during primary antibody incubation; goat anti-rabbit-AF488 and donkey anti-rat-AF568 antibodies were added during secondary antibody incubation.

[0103] DOS-pMHCs were used to specifically identify antigen-specific T cells on frozen tissue sections; antigen-specific T cells were visualized in situ by sequentially applying anti-PE antibody and fluorescently conjugated secondary antibody.

[0104] The thickness of the tissue sections is 8-10 μm;

[0105] In step (ii), the number of phycoerythrin bindings ranges from 1 to 12; the pendant strands on the DNA origami control the number of phycoerythrin bindings to regulate the amplification factor of the in situ signal.

[0106] The application of the antigen-specific T cell in situ detection method described above in the in situ detection of OVA-specific CD8+ T cells, or in the in situ detection of autoimmune CD8+ T cells, is also within the scope of protection of this invention.

[0107] This invention uses the T cell antigen receptor protein (TCR) of CD8+ T cells as the target protein, designs DNA origami that specifically recognizes the TCR, establishes a method for in situ detection of antigen-specific T cells, and verifies that the method has high specificity and high sensitivity. It enables the visual detection of the spatial distribution and abundance of antigen-specific T cells in tissues, thereby accurately tracking and recording the expansion and contraction phases of antigen-specific cytotoxic responses, providing important information for the location of in vivo anti-tumor immune responses and the mechanisms of tumor development and progression.

[0108] The significant advantages of this invention are:

[0109] (1) Sensitivity and signal intensity: Compared with the pMHC tetramer in situ staining method, DOS-pMHCs in situ staining technology can show higher sensitivity and stronger detection signal for both conventional high-affinity antigen-specific T cells and low-affinity antigen-specific T cells.

[0110] (2) Controllable staining signal intensity amplification: The highly programmable properties of the nucleic acid in DNA origami itself also enable DOS-pMHCs to achieve precise and controllable staining signal intensity amplification by combining DNA signal amplification strategies, which is something that pMHC tetramers cannot achieve. Attached Figure Description

[0111] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings involved in the description will be briefly introduced below.

[0112] Figure 1 This is a schematic diagram illustrating the construction of programmable pMHC polymers (DOS-pMHCs) based on DNA origami according to the present invention;

[0113] Figure 2 This is a structural characterization diagram of biotinylated DNA with an overhang sequence obtained by origami atomic force microscopy (AFM) in Example 1.

[0114] Figure 3 This refers to DOS-pMHCs-3X-OVA in Example 1. 257-264 Atomic force microscopy (AFM) imaging of structural characterization;

[0115] Figure 4 For DOS-pMHCs-3X-OVA 257-264 The feasibility of in situ detection of OVA-specific CD8+ T cells was demonstrated and compared with the classic pMHC tetramer T-Select H-2Kb OVA Tetramer-SIINFEKL-PE in situ staining method, where a represents DOS-pMHCs-3X-OVA. 257-264 , b is T-Select H-2Kb OVA Tetramer-SIINFEKL-PE;

[0116] Figure 5 To verify DOS-pMHCs-3X-InsB 15-23 The feasibility of in situ detection of autoimmune CD8+ T cells was demonstrated and compared with the pMHC tetramer H-2Kd InsB Tetramer-LYLVCGERL-PE in situ staining method, where a represents DOS-pMHCs-3X-InsB. 15-23b is H-2Kd InsB Tetramer-LYLVCGERL-PE).

[0117] Figure 6 This invention relates to DOS-pMHCs-3X-OVA, which generates phycoerythrin based on the control of phycoerythrin binding by the pendant chain. 257-264 DOS-pMHCs-6X-OVA 257-264、 DOS-pMHCs-12X-OVA 257-264 Structural characterization diagram of DOS-pMHCs;

[0118] Figure 7 To verify the different signal intensities generated by different versions of DOS-pMHCs generated based on the control of phycoerythrin binding by the pendant chain for in situ detection of OVA-specific CD8+ T cells;

[0119] Figure 8 A flowchart illustrating the technical process for constructing programmable pMHC polymers (P-DOS-pMHCs) based on PER reaction and DNA origami, as described in Example 6.

[0120] Figure 9 This invention relates to a programmable pMHC polymer, P-DOS-pMHCs-OVA, based on the PER reaction and DNA origami. 257-264 and intermediates DNA origami, P1-DNA origami, and P-DNA origami;

[0121] Figure 10 To demonstrate the feasibility of P-DOS-pMHCs in in situ detection of OVA-specific CD8+ T cells, and to compare it with DOS-pMHCs-3X-OVA 257-264 Compare with the in situ staining method for pMHC tetramer (Tetramer). Detailed Implementation

[0122] To facilitate a better understanding of the present invention, the technical solution of the present invention will be further described below in conjunction with specific embodiments, but the present invention is not limited thereto.

[0123] The basic nucleotide sequence of the staple single-stranded DNA (each short single-stranded DNA that makes up the nucleic acid framework structure) involved in this invention refers to the DNA sequence from A01 to Loop described in pages S11-S16 of the Supporting online information of the paper entitled "Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNAOrigami. Journal of the American Chemical Society, 132(10), 3248-3249" published on February 17, 2010 in J. AM. CHEM. SOC., 132(10), 3248-3249.

[0124] Example 1: Construction of programmable pMHC multimers based on DNA origami (DOS-pMHCs)

[0125] This embodiment includes the origami assembly of biotinylated DNA and the preparation of DOS-pMHCs. Figure 1 ).

[0126] 1. Origami assembly of biotinylated DNA with overhang sequences

[0127] M13mp18 single-stranded DNA and various short single-stranded DNAs that make up the nucleic acid framework structure were mixed in a 1xTAE buffer system containing magnesium ions. The mixture was subjected to gradient cooling. By designing precise DNA sequences and complementary pairing rules, different DNA strands were allowed to spontaneously combine and fold into specific triangular structures, thus preparing biotinylated DNA origami assemblies with overhang sequences.

[0128] 1.1 Material Preparation

[0129] M13mp18 DNA (purchased from New England Biotechnology (Beijing) Co., Ltd.).

[0130] 1×TAE buffer system containing magnesium ions (1× TAE-Mg2+ buffer): 40 mM Tris, 20 mM acetic acid, 2 mM EDTA, 12.5 mM MgCl2, pH 8.0 (purchased from Sangon Biotech (Shanghai) Co., Ltd.).

[0131] The short single-stranded DNA that makes up the nucleic acid framework structure includes:

[0132] Several short DNA sequences that make up the first side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from A01 to A65 are recorded on pages S11-S12 of the Supporting online information of the paper.

[0133] Several short DNA sequences that make up the second side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from B01 to B65 are recorded on pages S12-S14 of the Supporting online information of the paper.

[0134] Several short DNA sequences that form the third side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from C01 to C65 are recorded on pages S14-S15 of the Supporting online information of the paper.

[0135] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0136] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, CO4, C20, C49, and C61 are biotin-modified to form biotin-modified single-stranded DNA.

[0137] Overhang (TTTTTTTTTTTT) sequences were ligated into A05, B05, and C05 to form DNA strands with overhangs (the overhangs are poly(T)DNA sequences), and these were denoted as A05-Poly(T). 12 B05-Poly(T) 12 C05-Poly(T) 12 The sequences are shown in Table 1 below, all starting from the 5' end:

[0138] Table 1

[0139]

[0140] 1.2 Thermal Cycling

[0141] 5 μL of 400 nM M13mp18 was mixed with 10 μL of 1 μM biotin-modified DNA strand, 10 μL of 1 μM overhang-DNA strand, and 20 μL of other 500 nM DNA strands that form the framework (each strand concentration was 100 μM, 0.1 μL of each was added). The mixture was then thermally cycled in a total volume of 100 μL of 1× TAE-Mg2+ buffer (40 mM Tris, 20 mM acetic acid, 2 mM EDTA, 12.5 mM MgCl2, pH 8.0): after 95 °C for 5 minutes, the temperature was reduced to 25 °C in increments of 0.1 °C.

[0142] 1.3 Purification

[0143] PCR products were purified using a 100 kDa Milipore Amicon Ultra filter (to remove excess short oligonucleotides or proteins), centrifuged at 5000 g for 3 minutes, repeated 3 times. After inverting the filter, biotinylated DNA with overhang sequences was collected by centrifugation at 2000 g for 5 minutes. The structure was characterized by atomic force microscopy (AFM). Figure 2 (As shown). Finally, the absorbance was measured at a wavelength of 260 nm using a Cary 60 UV-Vis spectrophotometer and stored at 4°C.

[0144] 2. Preparation of DOS-pMHCs

[0145] 2.1 Preparation of PE-labeled poly(A) DNA

[0146] PE-SA (R-phycoerythrin-labeled streptavidin, purchased from BIOLEGEND (Beijing) Biotechnology Co., Ltd.):

[0147] 5-fold biotinylated poly(A) DNA short chain (sequence: SEQ ID NO.22: Biotin-AAAAAAAAAAAA, purchased from Sangon Biotech (Shanghai) Co., Ltd.).

[0148] Calculate the required amount of PE-SA based on the yield of biotinylated DNA origami with an overhang sequence, and mix it with 5 molar amounts of biotinylated poly(A) DNA short strands. Incubate at room temperature in the dark for 30 minutes. Purify through a 100 kDa Milpore Amicon Ultra filter to remove excess biotinylated DNA, centrifuge at 2000 g for 5 minutes, and collect the PE-labeled poly(A) DNA.

[0149] 2.2 Preparation of programmable pMHC polymers based on DNA origami (DOS-pMHCs)

[0150] 2.2.1. The PE-labeled poly(A) DNA from step 2.1 and the biotinylated DNA with the overhang sequence from step 1.3 were folded and incubated at 4°C in the dark for 4 hours. 5 times the amount of SA (streptavidin) was added, and the mixture was incubated at room temperature for 30 minutes. The mixture was purified through a 100kDa Milipore Amicon Ultra filter to remove excess SA, centrifuged at 2000 g for 5 minutes to obtain the complex, and the absorbance of the complex at 260 nm was measured.

[0151] 2.2.2 Load OVA 257-264 H-2K of peptide (SIINFEKL) b DOS-pMHCs made from MHC

[0152] In step 2.2.1, 1.5 times the amount of biotinylated pMHC monomer (H-2Kb & B2M & OVA (SIINFEKL), purchased from ACROBiosystems) was added to the complex, and the mixture was incubated at room temperature for 30 minutes to obtain OVA-loaded OVA. 257-264 H-2K of peptide (SIINFEKL) b DOS-pMHCs (phycoerythrin-bound number 3, denoted as DOS-pMHCs-3X-OVA) produced from MHC 257-264 Store at 4℃ for later use. Structural characterization was performed using atomic force microscopy (AFM) imaging (e.g., Figure 3 ).

[0153] 2.2.3, Load InsB 15-23 H-2K of peptide (LYLVCGERL) d MHC-based (DOS-pMHCs)

[0154] The above complex was added with 1.5 times the amount of biotinylated pMHC monomer (H-2Kd&B2M&InsB (LYLVCGERL), purchased from ACROBiosystems), and incubated at room temperature for 30 minutes to obtain InsB-loaded compound. 15-23 H-2K of peptide (LYLVCGERL) d DOS-pMHCs (phycoerythrin-bound number 3, denoted as DOS-pMHCs-3X-InsB) produced from MHC 15-23 Store at 4℃.

[0155] Example 2: Construction of an antigen-specific T cell in situ detection method based on a two-dimensional DNA origami scaffold

[0156] This embodiment aims to provide a highly specific and sensitive method for in situ detection of antigen-specific T cells.

[0157] Target protein selection: The T cell antigen receptor protein (TCR) of OVA-specific CD8+ T cells was selected as the target protein.

[0158] Rabbit anti-PE antibody (Cat# PA5-35006, purchased from Thermo Fisher Scientific (China) Co., Ltd.), rat anti-CD8α antibody (Cat# MA1-10301, purchased from Thermo Fisher Scientific (China) Co., Ltd.), goat anti-rabbit-AF488 antibody (Cat# ab150077, purchased from Abogen (Shanghai) Trading Co., Ltd.), and donkey anti-rat-AF568 antibody (Cat#ab175475, purchased from Abogen (Shanghai) Trading Co., Ltd.).

[0159] Establishment of in-situ detection method: The technical process is as follows: fix and dehydrate the tissue sample, and perform frozen sectioning; use loaded OVA... 257-264 H-2K of peptide (SIINFEKL) b DOS-pMHCs prepared from MHC specifically recognize antigen-specific T cells on frozen tissue sections; antigen-specific T cells are visualized in situ by sequentially applying anti-PE antibody and fluorescently conjugated secondary antibody, as follows:

[0160] 1. Preparation of tissue sections

[0161] Animal model: 6-8 week old OT-1 mice were purchased from the Shanghai Model Organisms Center.

[0162] OT-1 mice aged 6-8 weeks were euthanized, and spleen tissue was immediately collected. The spleen was washed with sterile PBS to remove residual blood and stored in RPMI medium (RPMI 1640) for further processing. Fresh spleen tissue was fixed overnight at 4°C in 4% paraformaldehyde (purchased from Sangon Biotech (Shanghai) Co., Ltd.), and then incubated overnight at 4°C in 15v / v% and 30v / v% sucrose solutions, respectively. The tissue was embedded in OCT embedding medium, rapidly frozen in liquid nitrogen, and sectioned using a cryostat (tissue section thickness 8 μm).

[0163] 2. Identification process

[0164] 2.1 Add 2% bovine serum albumin (BSA, Sigma-Aldrich) and 10% normal goat serum to the tissue sections processed in step 2 and react at room temperature for 60 minutes;

[0165] 2.2. DOS-pMHCs-3X-OVA prepared in Example 1 257-264After being diluted to 10 nM in incubation buffer (40 mM Tris, 20 mM acetate, 12.5 mM MgCl2, 2 mM EDTA), the tissue sections were reacted with the tissue sections treated in step 2.2.1 at 4 °C for 12 h. After warming to room temperature for 30 min, the tissue sections were fixed in 1 v / v% paraformaldehyde (diluted with PBS from 4% paraformaldehyde) for 30 min, and reacted with 50 uM NH4Cl at room temperature for 10 min; T-Select H-2KbOVA Tetramer-SIINFEKL-PE (TS-5001-1C, purchased from Beijing Bomei Biotechnology Co., Ltd.) at the same concentration was used as a control.

[0166] 2.3 Signal Amplification Process

[0167] 2.3.1 Primary Antibody Incubation: Add 100 μL of rabbit anti-PE diluted in PBS (1:300) and rat anti-CD8 α antibody diluted in PBS (1:500) to the tissue sections treated in step 2.2 and react at room temperature for 1 hour. Afterward, wash the sections once with PBST and then twice with PBS.

[0168] 2.3.2 Secondary Antibody Incubation: Add 100 μL of goat anti-rabbit-AF488 antibody (dilution ratio 1:2000) and donkey anti-rat-AF568 antibody (dilution ratio 1:1000) diluted in PBS to the product treated in step 2.3.1, and incubate at room temperature for 1 hour. Wash the tissue sections once with PBST and twice with PBS. Stain the tissue sections with 100 μL of nuclear marker DAPI (purchased from Sangon Biotech (Shanghai) Co., Ltd.), incubate at room temperature for 10 min, and then wash three times with PBS.

[0169] 2.4 Imaging Process: After applying anti-fluorescence attenuation mounting medium (purchased from Sangon Biotech (Shanghai) Co., Ltd.) to the slides, coverslips were installed. Finally, in situ detection of antigen-specific T cells was achieved using a Leica SP8 scanning confocal microscope. DAPI was excited with a 405 nm laser, Alexa Fluor 488 with a 488 nm laser, and Alexa Fluor 568 with a 552 nm laser. Emissions were detected using a PMT detector. Images were acquired using a 63x oil immersion objective (NA=1.4), ensuring consistent exposure settings for all samples. The final image resolution was 1024×1024 pixels, with a pixel size of 180.38×180.38 nm.

[0170] Observe and analyze the in situ detection signals of antigen-specific T cells: such as Figure 4 As shown, the load OVA 257-264 H-2K of peptide (SIINFEKL)b DOS-pMHCs (DOS-pMHCs-3X-OVA) made from MHC 257-264 This method amplifies the in situ detection signal for T cells specific to conventional high-affinity tumor-associated antigens, and exhibits significant advantages in terms of high specificity and high sensitivity compared to in situ staining methods using the same concentration of pMHC tetramer (T-Select H-2KbOVA Tetramer-SIINFEKL-PE).

[0171] This embodiment uses the T cell antigen receptor protein (TCR) of OVA-specific CD8+ T cells as the target protein, and loads OVA... 257-264 H-2K of peptide (SIINFEKL) b DOS-pMHCs, made from MHC, enabled the visualization and detection of the spatial distribution and abundance of antigen-specific T cells in tissues.

[0172] Example 3: In situ detection method of autoimmune CD8+ T cells based on two-dimensional DNA origami scaffold

[0173] This embodiment provides a highly sensitive and direct in situ detection method for low-affinity antigen-specific T cells (autoimmune CD8+ T cells).

[0174] 1. Target protein selection: The T cell antigen receptor protein (TCR) of autoimmune CD8+ T cells from non-obese diabetic mice (NOD mice) was selected as the target protein. NOD mice are an important animal model for studying autoimmune diseases, especially type 1 diabetes.

[0175] 2. Establishment of in-situ detection methods

[0176] 2.1 Preparation of tissue sections:

[0177] Animal model: NOD mice purchased from Beijing Model Animal Research Center. The remaining steps are the same as step 2.1 of Example 2.

[0178] 2.2 Identification Process: The steps are basically the same as step 2.2 in Example 2, except that step 2.2.2 uses a load InsB. 15-23 H-2K of peptide (LYLVCGERL) d DOS-pMHCs (DOS-pMHCs-3X-InsB) made from MHC 15-23 The same concentration of pMHC tetramer H-2Kd InsB Tetramer-LYLVCGERL-PE (TS-M554-1, purchased from Beijing Bomei Biotechnology Co., Ltd.) was used as a control; the in situ detection signal of antigen-specific T cells was observed and analyzed: the results are as follows. Figure 5As shown, this embodiment achieves highly sensitive in-situ detection of low-affinity antigen-specific T cells. This is in contrast to the near-detection of InsB. 15-23 Compared to in situ staining of antigen-specific TCR pMHC tetramers (H-2Kd InsB Tetramer-LYLVCGERL-PE), this method exhibits significant advantages such as high binding affinity, strong staining efficiency, and low background. This embodiment uses antigen-specific TCRs as target proteins to achieve visualized detection of the spatial distribution and abundance of antigen-specific T cells in tissues, thereby accurately tracking and recording the expansion and contraction phases of antigen-specific cytotoxic responses, providing important information for understanding the location and mechanisms of autoimmune responses in vivo.

[0179] Example 4: Detection of in situ visualization effect of DOS-pMHCs on antigen-specific T cells based on the molecular number enhancement of pendant chains.

[0180] This embodiment uses the T-cell antigen receptor protein (TCR) of OVA-specific CD8+ T cells as the target protein. By precisely controlling the number of hanging strands on the triangular DNA origami scaffold, the number of bound phycoerythrin molecules is adjusted, thereby achieving effective regulation of the in-situ signal amplification in antigen-specific T cell detection. The preparation method of DOS-pMHCs based on the molecular number enhancement of hanging strands is as follows:

[0181] 1) Preparation of DOS-pMHCs with phycoerythrin binding number 6

[0182] The basic steps are the same as in Example 1, except that the short single-stranded DNA that makes up the nucleic acid framework structure includes:

[0183] Several short DNA sequences that make up the first side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. Pages S11-S12 of the Supporting online information of the paper are listed from A01 to A65.

[0184] Several short DNA sequences that make up the second side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from B01 to B65 are recorded on pages S12-S14 of the Supporting online information of the paper.

[0185] Several short DNA sequences that form the third side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from C01 to C65 are recorded on pages S14-S15 of the Supporting online information of the paper.

[0186] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0187] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, CO4, C20, C49, and C61 are biotin-modified to form biotin-modified single-stranded DNA.

[0188] Overhang (TTTTTTTTTTTT) sequences were ligated into A05, A31, B05, B31, C05, and C31 to form DNA strands with overhangs (the overhangs are poly(T)DNA sequences), and these strands were denoted as A05-Poly(T). 12 A31-Poly(T) 12 B05-Poly(T) 12 B31-Poly(T) 12 C05-Poly(T) 12 C31-Poly(T) 12 .

[0189] During the addition of SA protein, the molar mass of SA protein is 5 times that of the corresponding phycoerythrin binding sites on different DNA origami. In this embodiment, the biotinylated pMHC monomer used is H-2Kb&B2M&OVA (SIINFEKL). , DOS-pMHCs with enhanced molecular number based on pendant chains were prepared (denoted as: DOS-pMHCs-6X-OVA). 257-264 ).

[0190] 2) Preparation of DOS-pMHCs with 12 binding numbers of phycoerythrin

[0191] The basic steps are the same as in Example 1, except that the short single-stranded DNA that makes up the nucleic acid framework structure includes:

[0192] Several short DNA sequences that make up the first side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. Pages S11-S12 of the Supporting online information of the paper are listed from A01 to A65.

[0193] Several short DNA sequences that make up the second side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from B01 to B65 are recorded on pages S12-S14 of the Supporting online information of the paper.

[0194] Several short DNA sequences that form the third side of the framework structure include Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequences from C01 to C65 are recorded on pages S14-S15 of the Supporting online information of the paper.

[0195] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0196] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, C04, C20, C49, and C61 are biotin-modified to form biotin-modified single-stranded DNA.

[0197] Overhang sequences (TTTTTTTTTTTT) were ligated into A05, A31, A42, A63, B05, B31, B42, B63, C05, C31, C42, and C63 to form DNA strands with overhangs (the overhang being a poly(T)DNA sequence), and these were denoted as A05-Poly(T). 12 A31-Poly(T) 12 A42-Poly(T) 12 A63-Poly(T) 12 B05-Poly(T) 12 B31-Poly(T) 12 B42-Poly(T) 12 B63-Poly(T) 12 C05-Poly(T) 12 C31-Poly(T) 12 C42-Poly(T) 12 C63-Poly(T) 12 .

[0198] Furthermore, during the addition of SA protein, the molar mass of SA protein was 5 times that of the corresponding phycoerythrin binding sites on different DNA origami. In the example, the biotinylated pMHC monomer was H-2Kb&B2M&OVA (SIINFEKL), which was used to prepare DOS-pMHCs based on the pendant chain with enhanced molecular number (denoted as: DOS-pMHCs-12X-OVA). 257-264 ).

[0199] In this embodiment, the DNA strand sequences involved are shown in Table 2 below, all starting from the 5' end:

[0200] Table 2

[0201]

[0202] The prepared DOS-pMHCs-6X-OVA was imaged using atomic force microscopy (AFM). 257-264 and DOS-pMHCs-12X-OVA 257-264 Perform structural characterization ( Figure 7 ).

[0203] Establishment of in-situ detection method:

[0204] 1. Preparation of tissue sections: Same as in Example 2.

[0205] 2. Identification process: The difference from Example 2 lies in step 2.2, where DOS-pMHCs-3X-OVA... 257-264 Replace with DOS-pMHCs-6X-OVA 257-264 Or DOS-pMHCs-12X-OVA 257-264 .

[0206] The results are as follows Figure 7 As shown, after increasing the number of phycoerythrin-bound cells, DOS-pMHCs exhibited a trend of greater sensitivity for in situ detection of antigen-specific T cells. Compared with the in situ staining method for pMHC tetramers, DOS-pMHCs with different numbers of phycoerythrin-bound cells all showed significant advantages in terms of high specificity and high sensitivity.

[0207] This spatially precise design based on DNA origami significantly improves the detection sensitivity of antigen-specific T cells expressing low-affinity TCRs, making in-situ detection more reliable and sensitive. This method provides new technical support for the study of low-affinity T cells and can be widely applied in fields such as tumor immune surveillance, autoimmune disease analysis, and vaccine development, opening up new possibilities for precision medicine and personalized immunotherapy.

[0208] Example 5: Construction of programmable pMHC polymers (P-DOS-pMHCs) based on PER reaction and DNA origami

[0209] This embodiment constructs programmable pMHC polymers (P-DOS-pMHCs) based on primer exchange reaction (PER reaction) and DNA origami to achieve antibody-independent high fluorescence intensity in situ detection, overcome steric hindrance limitations, improve fluorescence signal amplification efficiency, and simplify the operation process. The specific method includes the following steps:

[0210] 1. Preparation of single-stranded DNA

[0211] A single-stranded DNA product containing repeating primer sequences is generated through a PER reaction.

[0212] Configure the reaction system:

[0213] 10ul 10xPBS

[0214] Final concentration: 10mM MgSO4

[0215] 400-1000U / ml Bst LF polymerase

[0216] 600uM dATP, dCTP, dTTP

[0217] 100nM Clean-G Hairpin

[0218] 0.5uM Hairpin1 / 0.3uM Hairpin2

[0219] Add ddH2O to 90ul

[0220] Incubation and primer addition: Incubate at 37℃ for 15 minutes, add 10ul of 10uM primer 1 (Primer1) or primer 2 (Primer2). Primers 1 and 2 were purchased from Sangon Biotech (Shanghai) Co., Ltd. Incubate at 37℃ for 1-3 hours, then raise the temperature to 80℃ and hold for 20 minutes. The product is recorded as P1 (corresponding to Primer1) or P2 (corresponding to Primer2) and then stored at -20℃ for later use.

[0221] The product of reaction P1 is a sequence α terminally paired with the overhang sequence α. * The reaction product of P1 and P2 is a long chain with multiple repeating sequences b, which is a sequence b terminally paired with sequence b. * P2 is a long chain with multiple repeating sequences c.

[0222] In this embodiment, each sequence is shown in Table 3 below, all starting from the 5' end:

[0223] Table 3

[0224]

[0225] 2. P-DOS-pMHCs

[0226] 2.1 DNA Origami Assembly

[0227] The basic operation is the same as step 1 of Example 1, except that the short DNA strands required for the DNA origami synthesis process need to be replaced: replace A32 with A32-P, B32 with B32-P, and C32 with C32-P in the DNA sequence from A01 to Loop described on pages S11-S16 of the Supporting online information of the paper Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249; thus obtaining biotinylated DNA origami.

[0228] That is: add 1× TAE-Mg to the PCR reaction system 2+ Buffer (40 mM Tris, 20 mM acetic acid, 2 mM EDTA, 12.5 mM MgCl2, pH 8.0), M13mp18, biotinylated DNA strands, and DNA strands forming the framework structure were annealed and purified using ultrafiltration tubes. SA was added, and the mixture was incubated at room temperature for 30 minutes and purified using ultrafiltration tubes. Biotinylated pMHC monomers were added and bound to the PER products P1 and P2 from step (2) to form programmable pMHC polymers (P-DOS-pMHCs) based on the PER reaction and DNA origami.

[0229] The short single-stranded DNA that makes up the nucleic acid framework structure includes:

[0230] Several short DNA sequences that constitute the first side of the framework structure include the sequences from A01 to A31 and A33 to A65 recorded on pages S11-S12 of the Supporting online information of the paper Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249, and the sequence shown in SEQ ID NO.18 (A32-P);

[0231] Several short DNA sequences that constitute the second side of the framework structure include the sequences from B01 to B31 and B33 to B65 recorded on pages S12-S14 of the Supporting online information of the paper Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249, and the sequence shown in SEQ ID NO.19 (B32-P);

[0232] Several short DNA sequences that constitute the third side of the framework structure include the sequences from C01 to C31 and C33 to C65 recorded on pages S14-S15 of the Supporting online information of the paper Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249, and the sequence shown in SEQ ID NO.20 (C32-P);

[0233] Multiple link sequences, including those from Ding, B., Deng, Z., Yan, H., Cabrini, S., Zuckermann, RN, & Bokor, J. (2010). Gold Nanoparticle Self-Similar Chain Structure Organized by DNA Origami. Journal of the American Chemical Society, 132(10), 3248-3249. The sequence from Link-A1C to Loop is described on pages S15-S16 of the Supporting online information of the paper. For example, Link-A1C is the first DNA strand responsible for connecting the first side to the second side; the loop structure is used to complete the overall structure of the DNA framework.

[0234] Furthermore, based on the above, A04, A20, A49, A61, B04, B20, B49, B61, CO4, C20, C49, and C61 are biotinylated to form biotin-modified single-stranded DNA (Biotin-DNA).

[0235] In this embodiment, the DNA strand sequences involved are shown in Table 4 below, all starting from the 5' end:

[0236] Table 4

[0237]

[0238] 2.2 Preparation of P-DOS-pMHCs:

[0239] 2.2.1 Preparation of SA-labeled DNA origami

[0240] The product from step 2.1 was added with 5 molar amounts of SA, incubated at room temperature for 30 minutes, and excess SA was removed by ultrafiltration. The absorbance of the complex at 260 nm was measured to obtain the SA-labeled DNA origami.

[0241] 2.2 Preparation of programmable pMHC polymers (DOS-pMHCs) based on PER reaction and DNA origami

[0242] 2.2.1. The SA-labeled DNA origami from step 2.1 was incubated with 1.5 times the amount of biotinylated pMHC monomer (H-2Kb&B2M&OVA(SIINFEKL)) and excess PER products P1 and P2 generated in step 1 at room temperature for 4 hours. First, P1 was ligated onto the DNA origami (to obtain P1-DNA origami), and then P2 was bound to P1 to obtain P-DNA origami; the product included biotinylated DNA origami with P1 ligated (P1-DNA origami) and biotinylated DNA origami with P1 and P2 ligated (P-DNA origami).

[0243] 2.2.2 Load OVA 257-264 DOS-pMHCs made from the H-2Kb MHC of peptide (SIINFEKL)

[0244] 1.5-fold biotinylated pMHC monomers (H-2Kb & B2M & OVA (SIINFEKL), purchased from ACROBiosystems) were added to p-DNA origami and incubated at room temperature for 30 minutes to obtain OVA-loaded products. 257-264 Programmable pMHC multimers (P-DOS-pMHCs-OVA) based on PER reaction and DNA origami, made from the H-2Kb MHC of peptide (SIINFEKL). 257-264 Store at 4℃ for later use.

[0245] 3. Structural Characterization

[0246] The P-DOS-pMHCs-OVA prepared in step 2 was analyzed using atomic force microscopy (AFM). 257-264 The biotinylated DNA origami prepared in step 1, the biotinylated DNA origami connected to P1 (P1-DNA origami), and the biotinylated DNA origami connected to P1 and P2 (P-DNA origami) were structurally characterized.

[0247] like Figure 9Biotinylated DNA origami forms a triangular structure. Biotinylated DNA origami connected to P1 will extend a line from the triangle. Biotinylated DNA origami connected to P1 and P2 will extend a line with multiple branches from the triangle. P-DOS-pMHCs can be seen as small white dots on the sides of the triangle due to the binding of pMHC proteins.

[0248] Example 6: Construction of an antigen-specific T cell in situ detection method based on PER reaction and DNA origami programmable pMHC multimers (P-DOS-pMHCs).

[0249] This embodiment aims to design a programmable pMHC multimer (P-DOS-pMHCs) based on the PER reaction and DNA origami technology prepared in Example 5, for in situ detection of antigen-specific T cells, using the T cell antigen receptor protein (TCR) of OVA-specific CD8+ T cells as the target protein. The technical process is as follows (e.g.) Figure 8 Tissue samples are fixed, dehydrated, and frozen sectioned; single-stranded DNA products with repetitive primer sequences (primer 1 and primer 2) are generated through primer exchange reaction (PER reaction); programmable pMHC multimers (P-DOS-pMHCs) based on PER reaction and DNA origami are constructed using a triangular DNA origami scaffold; P-DOS-pMHCs are used to specifically recognize antigen-specific T cells on frozen tissue sections; and short single-stranded DNA with a fluorescent group is added to achieve in situ visualization.

[0250] Establishment of in-situ detection methods

[0251] 1. Tissue section preparation: Same as in Example 2;

[0252] 2. Identification process: Basically the same as in Example 2, except that step 2.2 uses (P-DOS-pMHCs-OVA). 257-264 ).

[0253] 3. Signal amplification process:

[0254] Add a short DNA strand conjugated with AF488 to the tissue sections treated in step 2.2, react at room temperature for 1 hour, wash once with PBST, and then wash twice with PBS. Stain the tissue sections with the nuclear marker DAPI, react at room temperature for 10 minutes, and then wash three times with PBS.

[0255] The short DNA strand conjugated with AF488 is: / AF488 / TTGTTAAGTTGTGTTAAGTTGT (SEQ ID NO.21)

[0256] 4. Imaging process: Same as in Example 2

[0257] Single-stranded DNA products with repetitive primer sequences (primer 1 and primer 2) are generated by primer exchange reaction (PER reaction). These products form dendritic structures on DNA origami scaffolds to bind multiple fluorescent groups, thereby enabling antibody-independent in situ detection with high fluorescence intensity. This simplifies the experimental procedure and reduces detection costs.

[0258] like Figure 10 As shown, this invention amplifies the in situ detection signal for T cells specific to conventional high-affinity tumor-associated antigens. Compared with both the DOS-pMHCs in situ staining method and the classic pMHC tetramer staining method, it exhibits a significant advantage in sensitivity and improves the fluorescence signal amplification efficiency.

[0259] This invention discloses an in situ detection method for antigen-specific T cells based on a two-dimensional DNA origami scaffold. By nanoscale spatial organization of pMHC monomers (peptide-MHC complexes) on a DNA origami scaffold, the valence state of pMHC is significantly improved, thereby achieving stable binding with low-affinity T cells in tissue sections. Simultaneously, utilizing the precise addressing capability of DNA origami and the design of the signal trapping strand, the amplification efficiency of the detection signal is greatly improved. Furthermore, Figure 10 To demonstrate the feasibility of P-DOS-pMHCs in in situ detection of OVA-specific CD8+ T cells, and to compare it with DOS-pMHCs-3X-OVA 257-264 Compare with the in situ staining method for pMHC tetramer (Tetramer).

[0260] This invention can be used for in situ detection of tumor antigen-specific CD8+ T cells in lymphoid organs. Compared with the classic pMHC tetramer in situ staining method, this method has higher specificity and stronger fluorescence signal intensity, providing a highly efficient new tool for immunological research and clinical applications.

[0261] The specific embodiments of the present invention have been described above. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art can make various modifications or variations within the scope of the claims, which do not affect the essence of the present invention.

Claims

1. A method for in situ detection of antigen-specific T cells based on programmable pMHC multimers P-DOS-pMHCs using a primer exchange reaction and DNA origami, characterized in that, The method comprises the following steps: S1, pretreatment of the tissue sample to be tested; S2, reacting the programmable pMHC multimer P-DOS-pMHCs based on the primer exchange reaction and DNA origami with the tissue sample pretreated in step S1 for a period of time, and then fixing, quenching and washing the tissue sample; S3, adding short single-stranded DNA coupled with a fluorescent group to the tissue sample treated in step S2 and reacting; the short single-stranded DNA coupled with a fluorescent group is short DNA chain coupled with AF488, and its sequence is shown in SEQ ID NO. 21; S4, staining and mounting the tissue sample treated in step S3, and imaging and analyzing; In S2, the P-DOS-pMHCs are obtained by a method comprising the following steps: S21, generating single-stranded DNA products containing repeated primer sequences by a PER reaction, and constructing biotinylated DNA origami; In S21, the step of generating single-stranded DNA products containing repeated primer sequences by a PER reaction comprises the following steps: a, configuring a reaction system containing the following components: 10ul 10xPBS; 10mM MgSO4 final concentration; 400-1000U / ml Bst DNA polymerase; 600uM dATP, 600uMdCTP, 600uM dTTP; 100nM Clean-G Hairpin DNA, the sequence of which is shown in SEQ ID NO. 17; 0.5uM Hairpin1 and 0.3uM Hairpin2; the sequence of Hairpin1 is shown in SEQ ID NO. 14; the sequence of Hairpin2 is shown in SEQ ID NO. 16; Supplemented with double distilled water to 90ul; b, incubation and primer addition, including: Incubate at 37℃ for 15 minutes, add 10ul 10uM of primer 1 or primer 2, continue to incubate at 37℃ for 1-3 hours, and then heat to 80℃ for 20 minutes; the sequence of primer 1 is shown in SEQ ID NO. 13, and the sequence of primer 2 is shown in SEQ ID NO. 15; In S21, the biotinylated DNA origami is streptavidin SA labeled biotinylated DNA origami; The preparation method of the streptavidin SA labeled biotinylated DNA origami comprises the following steps: Mix M13mp18 DNA and several DNA chains constituting a frame structure to form a reaction system, heat cycle the reaction system, and gradiently cool to room temperature; purify using an ultrafilter with a molecular weight cutoff value of 50-200 kDa, and co-incubate the purified product with streptavidin SA at room temperature to obtain SA labeled biotinylated DNA origami; S22, co-incubating the streptavidin SA labeled biotinylated DNA origami and the single-stranded DNA products containing repeated primer sequences to prepare DNA origami based on the PER reaction; specifically as follows: The streptavidin SA labeled biotinylated DNA origami and single-stranded DNA products containing repeated primer sequences are incubated together to form dendritic structures containing repeated sequences on the surface of the DNA origami through base complementary hybridization; wherein the single-stranded DNA product generated by primer 1 and Hairpin 1 is denoted as long single-stranded DNA-1; the single-stranded DNA product generated by primer 2 and Hairpin 2 is denoted as long single-stranded DNA-2; the streptavidin SA labeled biotinylated DNA origami is sequentially hybridized with long single-stranded DNA-1, DNA-2 through a preset overhang sequence to form dendritic structures containing repeated sequences on the surface of the DNA origami; S23, incubate the biotinylated pMHC monomer and the PER reaction based DNA origami together to obtain P-DOS-pMHCs; the biotinylated pMHC monomer includes H-2Kb&B2M&OVA or H-2Kd&B2M&InsB.

2. The method of claim 1, wherein the antigen-specific T cells are detected in situ. The specific steps of the thermal cycle treatment and gradient cooling are: maintaining at 90-100℃ for 3-7 minutes, and then gradient cooling to 20-30℃ at a rate of 0.05-0.2℃ / minute.

3. Use of the antigen-specific T cell in situ detection method according to claim 1 or 2 for in situ detection of OVA-specific CD8+ T cells, or for in situ detection of autoimmune CD8+ T cells.

Citation Information

Patent Citations

  • Cat CD3 protein antibodies and uses thereof

    CN118725079A