Recombinant Marek's Disease Virus And Uses Thereof

By introducing β-globin 3' supersensitive site 1 insulators into the recombinant Marek's disease virus, the problem of instability of exogenous antigen expression in the prior art was solved, and efficient and stable exogenous antigen expression and avian immune protection were achieved.

CN120302993APending Publication Date: 2025-07-11CEVA SANTE ANIMALE SA
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202380083191.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2022-11-18
Filing Date
2023-11-17
Publication Date
2025-07-11

AI Technical Summary

Technical Problem

The existing recombinant Marek's disease virus vectors have problems with poor stability and expression levels when expressing exogenous antigens, making it difficult to effectively protect avians from pathogens.

Method used

Recombinant Marek's disease virus (rMDV) was developed in which exogenous genes are associated with specific insulators, especially β-globin 3' supersensitive site 1 (3'HS1) insulators, which improve expression levels and stability by introducing insulators upstream of the promoter to stabilize the expression of exogenous genes.

Benefits of technology

It achieves efficient and stable expression of exogenous antigens, provides effective immune protection against avians, and significantly improves the immune effect and stability of the vaccine.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005431233800000261
    Figure BDA0005431233800000261
  • Figure BDA0005431233800000281
    Figure BDA0005431233800000281
  • Figure BDA0005431233800000311
    Figure BDA0005431233800000311
Patent Text Reader

Abstract

The present invention relates to a recombinant Marek's disease virus, the manufacture of the recombinant Marek's disease virus, a composition comprising the recombinant Marek's disease virus and the use of the recombinant Marek's disease virus, the recombinant Marek's disease virus comprising at least one recombinant nucleotide sequence encoding an antigen inserted into at least one insertion site, the at least one recombinant nucleotide sequence is operably linked to a promoter and an insulator.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present invention relates to novel recombinant Marek's disease virus (rMDV) capable of improving the expression of foreign antigens and uses thereof. More specifically, the present invention relates to novel rMDV comprising at least one foreign gene, the expression of which is regulated by insulator elements. The present invention also relates to the use of such rMDV for inducing protective immunity against avian pathogens or diseases. BACKGROUND OF THE INVENTION

[0002] Poultry meat and eggs are important food sources and their consumption is constantly increasing due to the growth of the population and their great cost-effectiveness. To ensure poultry health as well as food safety and security, poultry vaccine technology has become a matter of worldwide concern.

[0003] Viral vectors expressing pathogen proteins are commonly used as poultry vaccines against targeted pathogens. Vaccines comprising such viral vectors induce the expression of foreign pathogen proteins in the infected host, which can lead to protective immunity.

[0004] Many different classes of viruses have been investigated as candidate vectors for poultry vaccination, such as adenoviruses, AAVs, fowlpox virus and avian herpesviruses. In particular, Marek's disease virus (MDV) serotypes 1, 2 and 3 (also known as turkey herpesvirus (HVT)) have been used as recombinant vectors to express antigens from various avian pathogens.

[0005] The most common problems encountered with recombinant viruses are the stability of the foreign antigen within the vector and the expression level of said antigen to allow protective immunity against the corresponding pathogen. Therefore, there is still a need for vectors, particularly MDV vectors, which are able to express foreign genes efficiently and stably and thereby protect poultry from pathogens. SUMMARY OF THE INVENTION

[0006] By studying improvements to vectors suitable for avian vaccination, the inventors have developed novel rMDVs for inserting and expressing one or more foreign genes to serve as highly efficient immune mediators for protection against various avian pathogens. More specifically, the inventors have developed recombinant Marek's disease viruses in which at least one foreign gene is associated with a specific insulator that is suitable for positively influencing the gene expression of the associated foreign gene, i.e., enhancing the stability and / or level of expression. The inventors have more specifically developed an insulator derived from the β-globin 3' hypersensitive site 1 (3'HS1) and including a CTCF motif. An expression cassette including such an insulator associated with a recombinant nucleotide sequence encoding an antigen can be stably introduced into the insertion site of the rMDV, thereby allowing for the production of large amounts of the corresponding foreign antigen and inducing protective immunity against the corresponding avian pathogen. The rMDV of the present invention is particularly suitable for use in vaccine compositions to immunize avian species (such as poultry) against one or more avian pathogens.

[0007] Accordingly, an object of the present invention is to provide a recombinant Marek's disease virus (rMDV) that includes a recombinant nucleotide sequence encoding an antigen inserted into an insertion site, the recombinant nucleotide sequence being operably linked to a promoter and an insulator, wherein the insulator is located upstream of the promoter.

[0008] Monovalent rMDVs and multivalent rMDVs can be developed in which at least one foreign gene is associated with an insulator.

[0009] Specifically, the present invention provides an rMDV that includes a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and wherein the second recombinant nucleotide sequence is operably linked to a promoter. In such constructs, the second recombinant nucleotide sequence is not associated with an insulator.

[0010] Accordingly, an object of the present invention is to provide a multivalent rMDV in which a single foreign genetic gene is associated with an insulator located upstream of a promoter driving the expression of the foreign genetic gene.

[0011] The present invention also relates to a nucleic acid molecule that includes, consists essentially of, or consists of the genome of a recombinant MDV as defined above, and the present invention relates to a vector (such as a plasmid) containing such a nucleic acid.

[0012] The present invention further relates to a host cell including a recombinant MDV, nucleic acid, or vector as defined above.

[0013] The present invention also relates to a method for generating or replicating a recombinant MDV as defined above, the method comprising infecting a competent host cell with a recombinant MDV or nucleic acid molecule as defined above and collecting the rMDV.

[0014] Another object of the present invention is a composition, such as a vaccine composition, which comprises a recombinant MDV, nucleic acid and / or host cell as defined above, and optionally suitable excipients and / or adjuvants.

[0015] Another object of the present invention is a recombinant MDV, nucleic acid, host cell, composition or vaccine as defined above for vaccinating birds such as poultry against at least one avian pathogen and / or associated disease.

[0016] Another object of the present invention is a recombinant MDV, nucleic acid, host cell, composition or vaccine as defined above for inducing early immunity in birds such as poultry against at least one avian pathogen.

[0017] Another object of the present invention is a recombinant MDV, nucleic acid, host cell, composition or vaccine as defined above for inducing protective immunity in birds such as poultry against at least one avian pathogen.

[0018] Another object of the present invention is a method for vaccinating birds, the method comprising: administering to the birds a composition, vaccine or recombinant MDV as defined above.

[0019] The present invention also provides a vaccination kit for immunizing birds such as poultry against avian pathogens, the vaccination kit comprising the following components:

[0020] a. An effective amount of a vaccine as defined above, and

[0021] b. A device for administering the vaccine to the birds.

[0022] The present invention can be used with any bird, particularly poultry, such as chickens. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1(a) illustrates the genomic structures of recombinant HVT / IBD according to the prior art (FW169; FW260) and according to embodiments of the present invention (FW285; FW311).

[0024] Figure 1(b) shows a diagram of the recombinant HVT / IBD (FW285) genome, which shows a portion amplified in a PCR reaction to confirm the genomic structure of the virus.

[0025] Figure 1(c) shows the PCR analysis results of FW285, confirming the expression of IBDV VP2 protein. FW285 was harvested after virus purification and sampled for PCR analysis. M: BioMarker TM 10Kb (BioVentures, Inc., #M10KB), N.C.: FC126 (negative control), and P.C.: homologous plasmid (positive control).

[0026] Figure 2(a) is a Western blot analysis showing the VP2 protein expression in CEF cells infected with FW285, FW181, or FW169. Three days after each recombinant HVT was infected into CEF at an MOI = 0.1, each sample was harvested and subjected to SDS-PAGE, followed by Western blot assay. To detect the VP2 protein, anti-VP2 mouse mAb R63 was used as the primary antibody in the Western blot. As Figure 3 (a) shows, a protein band of 40 kilodaltons (kDa) was observed in the lanes with FW285 and FW169, which is the expected size of the VP2 protein.

[0027] Figure 2(b) visualizes Figure 3 (a) the relative density of the bands from the VP2 protein in the Western blot assay, which was measured for FW169 and shown as a bar graph. This quantification was performed by ImageJ. The results demonstrated that FW285 showed better VP2 protein expression compared to FW169.

[0028] Figure 3 Illustrated is the mean anti-IBDV VP2 antibody titers in blood samples of SPF chickens inoculated with recombinant HVT / IBD (FW169 or FW285) using a commercial IBD ELISA kit. NIC: uninfected control. The results showed that the immunity of FW285 (at 2 weeks) was generated earlier and stronger compared to FW169 (at 3 weeks).

[0029] Figure 4(a) shows a diagram of the recombinant HVT / IBD-LT (FW311) genome, indicating the regions amplified in the PCR reaction to confirm the viral genomic structure.

[0030] Figure 4(b) shows the PCR analysis results of FW311. FW311 was harvested after virus purification and sampled for PCR analysis. N.C.: negative control, and P.C.: positive control.

[0031] Figure 4(c) is a Western blot analysis showing the expression of VP2 protein in CEF cells infected with FW260, FW311, FW181, or FW169. Three days after each recombinant HVT was infected into CEF at an MOI of 0.1, each sample was harvested and subjected to SDS-PAGE, followed by Western blot assay. To detect the VP2 protein, anti-VP2 mouse mAb R63 was used as the primary antibody in the Western blot. As Figure 3 shown in (a), a protein band of 40 kilodaltons (kDa) was observed for FW260, FW311, and FW169, which is the expected size of the VP2 protein.

[0032] Figure 5 The relative density of the band from the VP2 protein in the Western blot assay of Figure 4(c) was visualized, which was measured against the vaccine control FW 169 and shown as a bar graph. This quantification was performed by ImageJ. The results demonstrated that FW311 showed better VP2 protein expression compared to both FW169 and FW260.

[0033] Figure 6 Illustrated are the average anti-IBDV VP2 antibody titers in blood samples of SPF chickens inoculated with the bivalent recombinant HVT / IBD-LT according to an embodiment of the present invention (FW311) compared with FW169 and FW260 using a commercial IBD ELISA kit. NIC: uninfected control.

[0034] Figure 7 Illustrated is the genomic structure of the recombinant bivalent HVT / IBD-LT according to a further embodiment of the present invention (FW313) compared with the genomic structures of the recombinant HVT / LT control negative and positive controls (FW181; FW261).

[0035] Figure 8(a) is a Western blot analysis showing the expression of VP2 protein in CEF cells infected with FW313, FW261, or FW181. Three days after each recombinant HVT was infected into CEF at an MOI of 0.1, each sample was harvested and subjected to SDS-PAGE, followed by Western blot assay. To detect the VP2 protein, anti-VP2 mouse mAbR63 was used as the primary antibody in the Western blot. A protein band of 40 kilodaltons (kDa) was observed in the lanes with FW313 and FW261, which is the expected size of the VP2 protein.

[0036] Figure 8(b) visualizes the relative density of the band from the VP2 protein in the Western blot assay of Figure 8(a) and shows it as a bar graph. This quantification was performed by ImageJ. The results demonstrated that FW313 showed better VP2 protein expression compared to FW261.

[0037] Figure 9 Illustrates the genomic structure of recombinant HVT / NDV according to another embodiment (FW348) of the present invention, compared to the genomic structure of recombinant HVT / NDV lacking an insulator according to FW26.

[0038] Figure 10 Shows NDV-F protein expression evaluated by black plaque, where the first antibody is anti-NDV-F mouse mAb (#77-2), and the second antibody is biotinylated anti-mouse IgG.

[0039] Figure 11 Is a Western blot analysis showing NDV-F protein expression in CEF cells infected with FW348, FW026, or FW169. Three days after infecting CEF with each recombinant HVT at an MOI = 0.01, each sample was harvested and subjected to SDS-PAGE, followed by Western blot assay. To detect the NDV-F protein, anti-NDV-F mouse mAb (#77-2) was used as the first antibody in the Western blot. A protein band of 60 kilodaltons (kDa) was observed in the lanes with FW348 and FW026, which is the expected size of the NDV-F protein. Detailed Description

[0040] The present invention generally relates to recombinant Marek's disease viruses comprising an expression cassette, the production of such recombinant Marek's disease viruses, compositions comprising such recombinant Marek's disease viruses, and the use of such recombinant Marek's disease viruses, particularly for immunizing avians against avian pathogens, the expression cassette comprising a recombinant nucleotide sequence operably linked to a promoter and an insulator sequence. The rMDV of the present invention is particularly stable, shows good expression of foreign genes in vitro, and provides effective immunoprotection to avians. Thus, the rMDV of the present invention is particularly suitable for generating effective vaccines. Indeed, the rMDV of the present invention shows strong expression of foreign genes, allowing for efficient immune production (OOI), while maintaining the stability and efficacy of the vaccine over time.

[0041] Definition

[0042] The present invention will be best understood by reference to the following definitions:

[0043] The term "recombinant" in relation to a sequence means a sequence, nucleic acid, or unit that does not occur naturally and / or has been engineered using recombinant DNA techniques (also known as gene cloning or molecular cloning).

[0044] The term "recombinant" in relation to a virus means that the genome of the virus has been modified by the insertion of at least one nucleotide sequence (e.g., DNA, such as a gene), which is not naturally found in the genome of said virus, or is naturally found in the genome but in a different form or at a different location. It should be understood that recombinant viruses can be made by various methods (such as the recombinant DNA techniques described herein), and once made, can be replicated without further use of recombinant DNA techniques.

[0045] In this specification, the terms "nucleic acid", "nucleic acid sequence" and "nucleotide sequence" refer to a nucleic acid molecule having a defined sequence, which can be deoxyribonucleotides and / or ribonucleotides. A nucleotide sequence can be prepared first by, for example, recombinant, enzymatic and / or chemical techniques and subsequently replicated in a host cell or an in vitro system. The nucleotide sequence preferably contains an open reading frame encoding a molecule (e.g., a peptide or a protein). The nucleotide sequence can contain additional sequences, such as a promoter, a transcription terminator, a signal peptide, an IRES, etc.

[0046] In this specification, the terms "polypeptide", "peptide" and "protein" refer to any molecule that is a polymer comprising at least 10 contiguous amino acids.

[0047] An "immunogenic fragment" or "antigenic fragment" of an antigen, peptide or protein means any fragment that can elicit an immune response, preferably any fragment that contains an epitope (preferably an antigen-specific epitope). Immunogenic fragments generally contain 5 to 50 contiguous amino acid residues of the antigen, such as 5 to 40, or 10 to 40, or 10 to 30, 10 to 25, or 10 to 20.

[0048] The term "avian" or "avian species" is intended to cover all kinds of birds, such as birds of the class Aves, i.e., feathered, winged, bipedal, warm-blooded and egg-laying vertebrates. In the context of the present invention, the avian or avian species more particularly refers to birds of economic and / or agronomic interest, such as poultry (such as chickens and turkeys), waterfowl poultry (such as ducks and geese) and ornamental birds (such as swans and parrots).

[0049] The term "vaccine" or "vaccine composition" as used herein means a reagent that can be used to induce, stimulate or enhance an immune response in an organism.

[0050] The term "multivalent" in relation to a recombinant virus or a vaccine as used herein means a recombinant virus or a vaccine that contains at least two recombinant nucleotide sequences or antigens, said sequences or antigens being the same or different and from the same or different pathogens.

[0051] Recombinant MDV

[0052] The Marek's disease viruses of the present invention include, but are not limited to, serotype 1 Marek's disease virus, preferably the CV1988 / Rispens strain, serotype 2 Marek's disease virus, preferably the SB1 strain, and serotype 3 Marek's disease virus, preferably turkey herpesvirus (HVT). The preferred Marek's disease viruses of the present invention are derived from serotypes or strains that are non-pathogenic to the targeted avian species.

[0053] An object of the present invention is to provide an rMDV that includes a recombinant nucleotide sequence encoding an antigen inserted into an insertion site, the recombinant nucleotide sequence being operably linked to a promoter and an insulator, wherein the insulator is located upstream of the promoter.

[0054] The presence of the insulator upstream of the promoter driving the expression of the recombinant nucleotide sequence allows for enhanced expression of the recombinant nucleotide sequence, resulting in strong expression of the corresponding antigen.

[0055] Compared to the production of the same antigen by an rMDV lacking an insulator, the rMDV of the present invention allows for increased production of the antigen.

[0056] In certain embodiments, early immune onset and / or strong immune responses are observed in avians inoculated with the rMDV of the present invention. In particular, earlier immune onset can be observed compared to the immune response in avians inoculated with the same vector lacking such an insulator.

[0057] In the context of the present invention, "onset of immunity (OOI)" refers to the time point, typically described in the days or weeks following vaccination, when active immunity is obtained that allows vaccinated avians to be protected against avian pathogens or diseases. "Early immune onset" refers to the attainment of protection that is at least 2 days earlier, preferably at least 4 days earlier, 6 days earlier, and more preferably at least 1 week earlier than the OOI obtained with a reference vaccine (e.g., the same vector, the same antigen, the same insertion site, but lacking an insulator). For example, the early OOI with rMDV / ND according to the present invention can correspond to immunity acquired approximately 3 weeks after vaccination, while the corresponding reference vaccine requires 4 weeks to induce complete protection (Palya V et al. Vet Immunol Immunopathol. 2014. PMID: 24368086).

[0058] According to the present invention, the rMDV can include one or more recombinant nucleotide sequences.

[0059] In certain embodiments, the rMDV comprises a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and wherein the second recombinant nucleotide sequence is operably linked to a promoter. That is, the second recombinant nucleotide sequence is not associated with an insulator.

[0060] The multivalent rMDV of the present invention allows for efficient and stable expression of two recombinant nucleotide sequences.

[0061] Insulator

[0062] According to the present invention, the rMDV comprises at least one insulator associated with a recombinant nucleotide sequence of interest, the insulator being located upstream of the promoter driving the expression of the recombinant nucleotide sequence.

[0063] In fact, by studying improved rMDVs capable of stably expressing recombinant antigens, the inventors have shown that insulators can advantageously be associated with recombinant nucleotide sequences to provide efficient expression of the corresponding antigens. The inventors have developed rMDVs incorporating such insulators that express the associated recombinant nucleotide sequences in a stable manner (i.e., even after 10, preferably 15 or 20 passages in cell culture).

[0064] As used herein, the term "insulator" or "insulator element" refers to a DNA sequence that insulates the transcription of a gene placed within its sphere of action, thereby protecting the transcription of said gene from the negative effects of, such as enhancer blocking activity and chromatin position effect. Insulators are able to protect a gene of interest from inappropriate signals originating from the surrounding environment by acting as a physical barrier or boundary. A nucleotide sequence or gene "associated" with an insulator refers to a nucleotide sequence or gene placed within the sphere of action of said insulator.

[0065] In the context of the present invention, "located upstream" means being positioned at or towards the 5' end of the gene of interest in the coding strand relative to the transcription direction. When considering double-stranded DNA, "upstream" generally refers towards the 5' end of the coding strand of the gene of interest, and "downstream" towards the 3' end. Some genes on the same DNA molecule can be transcribed in opposite directions. This means that the upstream and downstream regions of the DNA molecule can vary depending on the gene of interest.

[0066] The insulator of the present invention is a DNA sequence introduced into an expression cassette, which is located upstream of a promoter driving the expression of a recombinant nucleotide sequence of interest, to prevent or reduce the interference of viral genomes and / or other recombinant expression cassettes with the expression of the recombinant nucleotide sequence of interest. The insulator may further help protect the recombinant nucleotide sequence from integration side effects, which can be mediated by cis-acting elements present in the viral genome and lead to dysregulation of the expression of the transferred sequence. In particular, the insulator allows prevention of potential interruption of promoter activity by viral sequences without interfering with its activity.

[0067] In certain embodiments, the insulator of the present invention allows for stable and / or increased expression of an associated antigen.

[0068] Preferably, the insulator is not obtained from or derived from an avian insulator. More preferably, the insulator is obtained from or derived from a mammalian insulator, preferably a non-human mammalian insulator, such as a murine insulator.

[0069] Advantageously, the insulator comprises one or more CCCTC-binding factor (CTCF) motifs. In certain embodiments, the insulator comprises a single CTCF motif.

[0070] According to the present invention, the insulator is preferably derived from the 3' hypersensitive site 1 (3'HS1) insulator of the β-globin locus. More specifically, the insulator may be derived from the 3'HS1 insulator element described in Farrell (Farrell et al., Molecular and cellular biology, 2002, Vol. 22(11), pp. 3820-3831).

[0071] Preferably, the insulator comprises or consists of a functional fragment of the murine 3' hypersensitive site 1 (m3’HS1) insulator. In the context of the present invention, a "functional fragment of an insulator" refers to a fragment that retains the activity of the insulator. A person skilled in the art knows how to demonstrate the insulator activity of an insulator fragment. For example, two rHVTs expressing the VP2 protein are constructed, which have an insulator fragment sequence at the 5' end (e.g., ligated to the Bac promoter driving the expression of the VP2 protein) or no insulator fragment sequence (i.e., negative control). The VP2 protein expression levels of these two rHVTs are compared. If the VP2 expression of the rHVT comprising the insulator fragment is higher than the VP2 expression of the rHVT lacking the insulator fragment, the insulator activity of the insulator fragment is demonstrated. The functional fragment of m3’HS1 advantageously comprises, consists essentially of, or consists of: the nucleotide sequence of SEQ ID NO:4, or a nucleotide sequence having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4 and retaining the insulator activity. Advantageously, the functional fragment of m3’HS1 comprises at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to SEQ ID NO:4 comprising the CTCF motif and retains the insulator activity. In a particular embodiment, the insulator comprises or consists of the nucleotide sequence as shown in SEQ ID NO:4.

[0072] SEQ ID NO:4:

[0073] GGAGAGGAGGGCGGAAATCAGTGGAACACTTCTGCCCCCTACTGGTATGCAACAGGATCATTAGAGAAATGA

[0074] The insulator as shown in SEQ ID NO:4 comprises 72 nucleotides (hereinafter referred to as "3’HS1-72 insulator"), wherein the CTCF motif is located between positions 30 and 45 of SEQ ID NO:4.

[0075] The inventors have shown that the 3’HS1-72 insulator derived from the murine β-globin locus can be successfully used to improve the expression of recombinant nucleotide sequences in cells. In addition to acting as a physical boundary that can prevent the spread of gene silencing, the 3’HS1-72 insulator also shows the effect of blocking enhancer elements.

[0076] The 3’HS1-72 insulator is particularly suitable for rHVT. Thus, the object of the present invention is to provide an rHVT which comprises a recombinant nucleotide sequence encoding an antigen inserted into an insertion site, the recombinant nucleotide sequence being operably linked to a promoter and an insulator, wherein the insulator is located upstream of the promoter and comprises or consists of a nucleotide sequence having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity.

[0077] Regulatory sequence

[0078] According to the present invention, an rMDV vector such as an rHVT vector comprises one or more insulators as described herein. The insulator is located upstream of a promoter which drives the expression of at least one recombinant nucleotide sequence placed under the control of said promoter. The insulator element can be directly linked to the promoter sequence.

[0079] The promoter can be synthetic or natural, an endogenous or a heterologous promoter. In principle, any promoter can be used as long as it can function effectively in the target cell or host. In this regard, the promoter can be a eukaryotic, prokaryotic, viral or synthetic promoter which is capable of directing gene transcription in avian cells in the case of a recombinant vector.

[0080] If the rMDV comprises two or more recombinant nucleotide sequences, each recombinant nucleotide sequence can be operably linked to a promoter which can be the same or different from each other. In a particular embodiment, each recombinant nucleotide sequence is operably linked to a different promoter.

[0081] Preferably, the promoter is selected from the Pec promoter, the cytomegalovirus (CMV) immediate early 1 (ie1) promoter (in particular the murine cytomegalovirus (Mcmv) ie1 promoter or the human cytomegalovirus (Hcmv) promoter), the chicken β-actin (Bac) promoter, the simian virus 40 (SV40) promoter and the Rous sarcoma virus (RSV) promoter, or any fragment thereof retaining promoter activity.

[0082] The recombinant nucleotide sequence can further be operably linked to regulatory sequences such as a polyadenylation signal. Then, the insulator can be directly linked to the polyadenylation signal. In this particular embodiment, the insulator is located downstream of the polyadenylation signal.

[0083] The polyadenylation signal can be synthetic or natural, an endogenous polyadenylation signal or a heterologous polyadenylation signal. In principle, any polyadenylation signal can be used as long as it can function effectively in the target cell or host. In this regard, the polyadenylation signal can be a eukaryotic, prokaryotic, viral or synthetic polyadenylation signal capable of stabilizing the mRNA and enhancing transcriptional termination in avian cells.

[0084] If the rMDV comprises two or more recombinant nucleotide sequences, each recombinant nucleotide sequence can be operably linked to a polyadenylation signal, which can be the same or different from each other.

[0085] The polyadenylation signal sequence is a base sequence comprising AATAAA, ATTAAA or a modified sequence thereof. Preferably, the polyadenylation signal is derived from bovine growth hormone, simian virus 40 late and early regions, rabbit β-globin, murine or human immunoglobulin, polyomavirus late region.

[0086] Recombinant nucleotide sequence encoding an antigen

[0087] The recombinant nucleotide sequence can encode any polypeptide of interest, such as, for example, an antigen, cytokine, hormone or adjuvant.

[0088] In particular, the recombinant nucleotide sequence can encode an antigen from an avian pathogen or an antigenic fragment thereof.

[0089] The recombinant nucleotide sequence can be derived from or obtained from any pathogenic organism capable of causing infection in avian species. Examples of pathogens causing avian infections include viruses, bacteria, fungi and protozoa.

[0090] The antigen can be any immunogenic peptide or protein of the pathogen, such as a peptide or protein selected from or derived from a surface protein, secreted protein or structural protein of the pathogen or an antigenic fragment thereof.

[0091] Preferred recombinant nucleotide sequences for use in the present invention encode antigens from: avian influenza virus, avian paramyxovirus type 1 (also known as Newcastle disease virus (NDV)), avian metapneumovirus, Marek's disease virus, Gumboro disease virus (also known as infectious bursal disease virus (IBDV)), infectious laryngotracheitis virus (ILVT), infectious bronchitis virus (IBV), Escherichia coli, Salmonella, Pasteurella multocida, Riemerella anatipestifer, Ornithobacterium rhinotracheale, Mycoplasma gallisepticum, Mycoplasma synoviae, mycoplasma microorganisms infecting avian species and / or coccidia.

[0092] Preferably, the antigen is selected from the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma gallisepticum, and the surface protein hemagglutinin (HA) of avian influenza virus or immunogenic fragments thereof.

[0093] When two or more recombinant nucleotide sequences are inserted into rMDV, various combinations of antigens can be considered. Preferably, the two or more recombinant nucleotide sequences encode different antigens, more preferably antigens from different pathogens.

[0094] In an embodiment, the recombinant MDV of the present invention comprises a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an immunogenic fragment thereof.

[0095] In another embodiment, the recombinant MDV of the present invention comprises a nucleotide sequence encoding the VP2 protein of IBDV or an immunogenic fragment thereof and a nucleotide sequence encoding the gB protein of ILTV or an immunogenic fragment thereof.

[0096] In an embodiment, the recombinant MDV of the present invention comprises a recombinant nucleotide sequence encoding the F protein of NDV or an immunogenic fragment thereof.

[0097] In another embodiment, the recombinant MDV expresses two or more antigens from the same pathogen. The antigens can be the same or different.

[0098] In a further embodiment, the recombinant nucleotide sequence encodes an active molecule, such as a cytokine or immunomodulator, adjuvant, hormone, antiparasitic agent, antibacterial agent, etc., and other recombinant nucleotide sequences encode antigens as defined above.

[0099] According to a further embodiment, three or more recombinant nucleotide sequences can be inserted into the viral genome.

[0100] Insertion site

[0101] According to the present invention, a recombinant nucleotide sequence, a promoter, and optionally an insulator are inserted into an insertion site of MDV.

[0102] Preferably, the insertion site is located in the non-coding region of the viral genome.

[0103] The term "non-coding region" is well known in the art and refers to any region of the viral genome that does not encode a protein.

[0104] Preferably, the insertion site can be selected from the non-coding regions between UL43 and UL47, between UL55 and SORF4, and between US1 and US3. In particular, the insertion site can be selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, between UL55 and SORF4, between US10 and SORF3, and between SORF3 and US2. In particular, the insertion site is selected from the non-coding regions located between UL44 and UL45, between UL45 and UL46, and between SORF3 and US2.

[0105] The recombinant MDV of the present invention can be prepared from any MDV, preferably non-pathogenic HVT. In particular, rMDV is recombinant HVT. An example of a suitable HVT is the FC126 strain. The genomic sequence of the FC126 strain is available in the art (Afonso et al., ibid., Kingham et al., ibid.), and the nucleotide sequence of the FC 126 reference strain, as well as the positions of most of the ORFs within said genome, have been reported in the art.

[0106] By reference to the complete FC126 genome (GenBank: AF291866.1), the non-coding region between UL44 (HVT052) and UL45 (HVT053) preferably corresponds to nucleotides 94243 to 94683 of the HVT genome, the non-coding region between UL45 (HVT053) and UL46 (HVT054) preferably corresponds to nucleotides 95323 to 95443 of the HVT genome, the non-coding region between UL55 (HVT065) and LORF4 (HVT066) corresponds to nucleotides 112010 to 112207 of the HVT genome, the non-coding region between US10 (HVT086) and SORF3 (HVT087) corresponds to nucleotides 138688 to 138825 of the HVT genome, and the non-coding region between SORF3 (HVT087) and US2 (HVT088) corresponds to nucleotides 139867 to 140064 of the HVT genome.

[0107] Monovalent construct

[0108] The object of the present invention relates to rMDV, which comprises a single foreign antigen operably linked to a promoter and an insulator located upstream of the promoter. That is, the present invention relates to rMDV, which comprises a single recombinant nucleotide sequence encoding a single foreign antigen.

[0109] Advantageously, a single insulator is located upstream of the promoter. However, two, three or more insulators associated with the same antigen can be used. Preferably, the plurality of insulators are grouped and positioned one after another, all upstream of the promoter.

[0110] Advantageously, the recombinant nucleic acid sequences (i.e., recombinant antigen, promoter and insulator) are inserted into an insertion site in the non-coding region located between UL45 and UL46, or between UL44 and UL45, or between SORF3 and US2.

[0111] In a particular embodiment, the recombinant nucleic acid sequence is inserted into an insertion site in the non-coding region located between UL45 and UL46.

[0112] Advantageously, the exogenous antigen encodes an antigenic peptide or an antigenic fragment thereof selected from the group consisting of: the F protein of NDV, the VP2 protein of IBDV, the gB protein of ILTV, the 40K protein of Mycoplasma gallisepticum, and the surface protein HA of avian influenza virus.

[0113] Among the multiple possible embodiments based on the preferred insertion sites and preferred recombinant nucleotide sequences, the inventors surprisingly found that constructs comprising a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof exhibit a high level of stability and allow for high-level expression of said antigen. The inventors further showed that such constructs can allow for early immunity against the corresponding pathogen.

[0114] Accordingly, an object of the present invention is to provide a monovalent rMDV, preferably rHVT, which comprises a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter and an m3’HS1 insulator or a functional fragment thereof located upstream of the promoter, in an insertion site selected from the non-coding regions between UL45 and UL46 and between UL44 and UL45.

[0115] In a particular embodiment, the rHVT comprises a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a Bac promoter and a functional fragment of an m3’HS1 insulator located upstream of the Bac promoter, in an insertion site in the non-coding region located between UL45 and UL46, wherein the functional fragment of the m3’HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity, or consists thereof.

[0116] In another embodiment, the rHVT includes a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof in an insertion site located between UL44 and UL45, the recombinant nucleotide sequence being operably linked to a murine cytomegalovirus (Mcmv) immediate early (ie) 1 promoter and a functional fragment of an m3'HS1 insulator located upstream of the Mcmv (ie) 1 promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists thereof.

[0117] Another object of the present invention is to provide an rMDV, in particular an rHVT, which rHVT includes a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof in an insertion site located between SORF3 and US2, the recombinant nucleotide sequence being operably linked to a promoter, in particular the Mcmvie1 promoter and a functional fragment of an m3'HS1 insulator located upstream of the promoter, wherein the functional fragment of the m3'HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists thereof.

[0118] A specific object of the present invention is to provide an rHVT which rHVT includes a nucleotide sequence encoding the VP2 protein of IBDV, the nucleotide sequence preferably belonging to SEQ ID NO:1 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:1, under the control of a Bac promoter, preferably belonging to SEQ ID NO:2 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:2, flanked by an insulator sequence of SEQ ID NO:4 or having at least 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:4, at the 5' end and an SV40 polyadenylation signal, preferably belonging to SEQ ID NO:3 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:3, at the 3' end, inserted into the intergenic region (FW285) between HVT053 (UL45) and HVT054 (UL46).

[0119] Another object of the present invention is to provide a monovalent rMDV, preferably rHVT, which rMDV comprises a recombinant nucleotide sequence encoding the F protein of NDV or an antigenic fragment thereof, operably linked to a promoter and an m3’HS1 insulator or a functional fragment thereof located upstream of the promoter, in an insertion site selected from the non-coding regions between UL45 and UL46 and between UL44 and UL45.

[0120] In a particular embodiment, the rHVT comprises a recombinant nucleotide sequence encoding the F protein of NDV or an antigenic fragment thereof, operably linked to a Bac promoter and a functional fragment of an m3’HS1 insulator located upstream of the Bac promoter, in an insertion site in the non-coding region between UL45 and UL46, wherein the functional fragment of the m3’HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:4 and retaining insulator activity, or consists thereof.

[0121] A specific object of the present invention is to provide an rHVT which comprises a nucleotide sequence encoding the F protein of NDV, which nucleotide sequence preferably belongs to SEQ ID NO:17 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:17, is under the control of a Bac promoter, preferably belongs to SEQ ID NO:2 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:2, is flanked by an insulator sequence of SEQ ID NO:4 or having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:4, at the 5’ end and an SV40 polyadenylation signal, preferably belongs to SEQ ID NO:3 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:3, at the 3’ end, and is inserted into the intergenic region (FW348) between HVT053 (UL45) and HVT054 (UL46).

[0122] Multivalent construct

[0123] Another object of the present invention relates to a multivalent rMDV, which multivalent rMDV comprises two or more recombinant nucleotide sequences encoding antigens, wherein at least one recombinant nucleotide sequence is associated with an insulator as described above. Preferably, the insulator comprises or consists of a functional fragment of the m3’HS1 insulator, which functional fragment has at least 90%, 95%, 98%, 99% identity to the nucleotide sequence shown in SEQ ID NO:4, including its CTCF motif, and retains insulator activity, or exactly has the nucleotide sequence shown in SEQ ID NO:4.

[0124] Two or more recombinant nucleotide sequences can be associated with the insulator. In particular, each recombinant nucleotide sequence can be associated with the insulator. Preferably, only one of the plurality of recombinant nucleotide sequences is associated with the insulator.

[0125] Preferably, two or more recombinant nucleotide sequences encode different antigens. More preferably, two or more recombinant nucleotide sequences encode different antigens from different pathogens.

[0126] Two or more recombinant nucleotide sequences can be inserted into the same insertion site or different insertion sites. Preferably, two or more recombinant nucleotide sequences are inserted into at least two different insertion sites. More preferably, each recombinant nucleotide sequence is inserted into a different insertion site.

[0127] In particular, the combination of insertion sites is selected from non-coding regions located between UL44 and UL45, between UL45 and UL46, between UL55 and SORF4, between US10 and SORF3, and between SORF3 and US2, which non-coding regions are preferably selected from non-coding regions located between UL44 and UL45, between UL45 and UL46, and between SORF3 and US2.

[0128] In a particular embodiment, a multivalent rMDV comprising one or more recombinant nucleotide sequences encoding antigens comprises only one cassette expression comprising an insulator as described above. That is, only one recombinant nucleotide sequence encoding an antigen is associated with the insulator.

[0129] Accordingly, an object of the present invention is to provide rMDV, in particular rHVT, which rHVT comprises a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from the first insertion site, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator located upstream of the promoter, and wherein the second recombinant nucleotide sequence is operably linked to a promoter. The second expression cassette comprising the second recombinant nucleotide sequence does not contain (i.e., lacks) an insulator. Advantageously, the first recombinant nucleotide sequence encodes a first antigen and the second recombinant nucleotide sequence encodes a second antigen different from the first antigen.

[0130] The multivalent rMDV may comprise a first recombinant nucleotide sequence inserted into the non-coding region between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region between UL45 and UL46, or vice versa.

[0131] Alternatively, the multivalent rMDV may comprise a first recombinant nucleotide sequence inserted into the non-coding region between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region between SORF3 and US2, or vice versa.

[0132] Alternatively, the multivalent rMDV may comprise a first recombinant nucleotide sequence inserted into the non-coding region between UL45 and UL46 and a second recombinant nucleotide sequence inserted into the non-coding region between SORF3 and US2, or vice versa.

[0133] Preferably, two or more recombinant nucleotide sequences encoding antigens are under the control of different promoters.

[0134] Advantageously, one recombinant nucleotide sequence encodes the VP2 protein of IBDV or an antigenic fragment thereof, and the other recombinant nucleotide sequence encodes the gB protein of ILTV or an antigenic fragment thereof.

[0135] In a particular embodiment, the recombinant nucleotide sequence associated with the insulator according to the invention encodes the VP2 protein of IBDV or an antigenic fragment thereof.

[0136] Among the multiple possible embodiments based on the combination of the insertion site and the recombinant nucleotide sequence associated with the insulator and optionally a preferred promoter, the inventors surprisingly found that a specific combination produces rMDV, particularly rHVT, with a high level of stability and a high expression level of two antigens. Such rMDV, and particularly such rHVT, are particularly suitable for preparing improved multivalent vaccines. In particular, the inventors have shown that in a multivalent rMDV, the insulator as described above in combination with a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof allows for stable and efficient expression of the VP2 antigen without compromising the expression of the second antigen.

[0137] Accordingly, an object of the present invention is to provide a multivalent rMDV, preferably a multivalent rHVT, which comprises in a first insertion site a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter and an m3’HS1 insulator or a functional fragment thereof located upstream of the promoter, and in a second insertion site a second recombinant nucleotide sequence encoding a second antigen different from the VP2 antigen, operably linked to a promoter, wherein the first insertion and the second insertion are different and are selected from non-coding regions located between UL45 and UL46, between UL44 and UL45, and between SORF3 and US2.

[0138] In a particular embodiment, the multivalent rHVT comprises in a first insertion site in the non-coding region located between UL45 and UL46 a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, preferably the Bac promoter and an m3’HS1 insulator or a functional fragment thereof located upstream of the Bac promoter, and in a second insertion site in the non-coding region located between UL44 and UL45 a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmv ie1 promoter, wherein the functional fragment of the m3’HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists of such a nucleotide sequence.

[0139] In another embodiment, the multivalent rHVT comprises a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, preferably the Bac promoter and an m3’HS1 insulator or a functional fragment thereof located upstream of the Bac promoter, in a first insertion site in the non-coding region between UL45 and UL46, and a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmv ie1 promoter, in a second insertion site in the non-coding region between SORF3 and US2, wherein the functional fragment of the m3’HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists thereof.

[0140] In another embodiment, the multivalent rHVT comprises a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmv ie1 promoter and an m3’HS1 insulator or a functional fragment thereof located upstream of the Mcmv ie1 promoter, in a first insertion site in the non-coding region between UL44 and UL45, and inserts a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof, operably linked to a promoter, preferably the Pec promoter, in a second insertion site in the non-coding region between UL45 and UL46, wherein the functional fragment of the m3’HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists thereof.

[0141] In yet another embodiment, the multivalent rHVT comprises a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmv ie1 promoter and an m3’HS1 insulator or a functional fragment thereof upstream of the Mcmv ie1 promoter, in a first insertion site in a non-coding region between SORF3 and US2, and a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof, operably linked to a promoter, preferably the Pec promoter, in a second insertion site in the non-coding region between UL45 and UL46, wherein the functional fragment of the m3’HS1 insulator preferably comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:4 and retaining insulator activity or consisting of the same.

[0142] The object of the present invention is to provide rHVT, which rHVT comprises a first nucleotide sequence encoding the VP2 protein of IBDV and a second nucleotide sequence encoding the gB protein of ILTV, the first nucleotide sequence preferably belonging to SEQ ID NO:1 or having at least 80%, 85%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:1, being under the control of the Bac promoter, preferably belonging to SEQ ID NO:2 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO, being flanked by SEQ ID NO:4 or an insulator sequence having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQID NO:4, at the 5'-end and the SV40 polyadenylation signal, preferably belonging to SEQ ID NO:3 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:3, at the 3'-end, being inserted into the intergenic region between HVT053 (UL45) and HVT054 (UL46), the second nucleotide sequence preferably belonging to SEQID NO:5 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:5, being under the control of the Mcmv ie1 promoter, preferably belonging to SEQ ID NO:6 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ IDNO:6, being linked to the polyadenylation signal 1, preferably belonging to SEQ ID NO:7 or having at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence as shown in SEQ ID NO:7, at the 3'-end, being inserted into the intergenic region (FW311) between HVT052 (UL44) and HVT053 (UL45).

[0143] Another object of the present invention is to provide rHVT, which rHVT comprises a first nucleotide sequence encoding the VP2 protein of IBDV and a second nucleotide sequence encoding the gB protein of ILTV. The first nucleotide sequence preferably belongs to SEQ ID NO:1, is under the control of the Mcmv ie1 promoter, preferably belongs to SEQ ID NO:6 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:6, and is flanked by an insulator sequence preferably belonging to SEQ ID NO:4 or having at least 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:4. At the 5'-end and the SV40 polyadenylation signal, it preferably belongs to SEQ ID NO:3 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:3. At the 3'-end, it is inserted into the intergenic region between HVT052 (UL44) and HVT053 (UL45). The second nucleotide sequence preferably belongs to SEQ ID NO:5 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:5, is under the control of the Pec promoter, preferably belongs to SEQ ID NO:18 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:18, is linked to the polyadenylation signal 1, preferably belongs to SEQ ID NO:7 or has at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity with the full-length sequence shown in SEQ ID NO:7. At the 3'-end, it is inserted into the intergenic region (FW313) between HVT053 (UL45) and HVT054 (UL46).

[0144] Viral construct

[0145] The recombinant MDV of the present invention, preferably recombinant HVT, can be prepared by the techniques known per se in the art, such as recombinant techniques, homologous recombination, site-specific insertion, mutagenesis and the like.

[0146] Gene cloning and plasmid construction are well known to those of ordinary skill in the art and can be carried out essentially by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 4th Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012).

[0147] Generally, recombinant viruses can be prepared by homologous recombination between a viral genome and a construct (e.g., a plasmid) that includes the nucleic acid to be inserted, flanked by nucleotides from the insertion site that permits recombination. The insertion can be carried out with or without deletion of the endogenous sequence.

[0148] Known selection techniques can be used, For example , to select the resulting recombinant virus genotypically or phenotypically by hybridization, detection of the enzyme activity encoded by the gene integrated together with the recombinant nucleic acid sequence, or immunological detection of the antigenic peptide expressed by the recombinant virus. The selected recombinant virus can be cultured on a large scale in cell culture, and then the recombinant virus containing the peptide can be collected.

[0149] Cell culture

[0150] The recombinant virus of the present invention can be propagated in any competent cell culture. After achieving the desired growth of the virus, the cells can be detached from the wells using a scraper or trypsin, and the infected cells can be separated from the supernatant by centrifugation.

[0151] Examples of competent cells include CEF, embryonated eggs, chicken kidney cells, etc. The cells or virus can be cultured at about 37 °C for 3 to 6 days in a medium such as Eagle's MEM, Leibowitz-L-15 / McCoy 5A (1:1 mixture) medium. Generally, the infected cells are suspended in a medium containing 10% dimethyl sulfoxide (DMSO) or 1 (ZENOAQ), and cryopreserved at -85 °C, for example, under liquid nitrogen or in a freezer.

[0152] The present invention also relates to a method for producing or replicating rMDV as described above, preferably rHVT, the method comprising infecting a competent host cell with rMDV or a nucleic acid molecule, and collecting rMDV, preferably rHVT, the nucleic acid molecule comprising the genome of rMDV, preferably the genome of rHVT, consisting essentially of or consisting of the same.

[0153] The invention also relates to host cells comprising the rMDV as described above, preferably rHVT, or nucleic acid molecules comprising the genome of rMDV, preferably the genome of rHVT, consisting essentially of or consisting of the same.

[0154] Advantageously, the rMDV of the invention exhibits a high level of stability upon passage, which corresponds to the expression of the recombinant nucleotide sequence in cells of avian species even after 10, 15, 20 or more passages. In the context of the present invention, "passage" or "cell passage" means cell culture under suitable conditions allowing them to grow and remain viable until they reach 90% to 100% confluence. The passage step consists of transferring a small amount of cells from a previously confluent culture into fresh medium. An aliquot of the previously confluent culture containing a small amount of cells can be diluted in a large volume of fresh medium. In the case of adherent cultures, the cells can first be detached, for example, by using a mixture of trypsin and EDTA or any suitable enzyme before inoculating the fresh medium with a small amount of detached cells.

[0155] According to a preferred embodiment of the invention, CEF cells transfected with the rMDV of the invention still express the corresponding antigen after at least 10 passages. In other words, CEF cells generated by 10 or more passages of CEF cells transfected with the rMDV of the invention, and more specifically CEF cells generated by 15 passages, still contain the foreign nucleotide sequence of the rMDV used for the initial cell transfection and express the corresponding antigen. In the context of the present invention, if the production level is greater than 80%, and preferably greater than 85%, of the production level of the first passage, the cells of said passage are considered to still express the antigen.

[0156] Compositions, vaccines and their uses

[0157] The invention also relates to a composition comprising a vaccine, the vaccine comprising a monovalent or multivalent recombinant MDV, preferably recombinant HVT, an effective immunizing amount of the nucleic acid of the invention or the cells of the invention. "Effective immunizing amount" means an amount of the rMDV of the invention, preferably rHVT, sufficient to generate an immune response. The effective amount may vary with the antigen. The quantity constituting the effective amount may vary depending on whether the vaccine is used as a first treatment or as a booster treatment.

[0158] The vaccine of the invention generally comprises an immunologically effective amount of the recombinant MDV as described above, preferably recombinant HVT, in a pharmaceutically acceptable vehicle.

[0159] The compositions and vaccines according to the present invention generally comprise suitable solvents or diluents or excipients, such as aqueous buffers or phosphate buffers. These compositions may also contain additives administered with the vaccine in an amount sufficient to enhance the immune response, such as proteins or peptides derived from animals (e.g., hormones, cytokines, co-stimulatory factors), nucleic acids derived from viruses and other sources (e.g., double-stranded RNA, CpG), etc. Additionally, combinations of any number of the foregoing substances may provide an immune-enhancing effect, and thus immune enhancers of the present invention can be formed.

[0160] The vaccines of the present invention can be further formulated with one or more other additives to maintain isotonicity, physiological pH, and stability, such as buffers such as physiological saline (0.85%), phosphate-buffered saline (PBS), citrate buffer, tris(hydroxymethyl)aminomethane (TRIS), Tris-buffered saline, etc., or antibiotics such as neomycin or streptomycin, etc.

[0161] The rMDV according to the present invention can preferably be used as a live vaccine, but other alternatives such as inactivated vaccines or attenuated vaccines are also within the skills of those skilled in the art.

[0162] The route of administration can be any route, including oral (e.g., drinking water, gel), ocular (e.g., by eye drops), eye-nose administration using an aerosol (e.g., by spraying), intranasal, cloacal, in ovo, topical, or vaccination by injection (e.g., intravenous, subcutaneous, intramuscular, intraorbital, intraocular, intradermal, and / or intraperitoneal). For each type of route of administration, those skilled in the art will easily adjust the formulation of the vaccine composition.

[0163] Each vaccine dose can contain a suitable dose sufficient to elicit a protective immune response in avian species. Optimization of such doses is well known in the art. The amount of antigen per dose can be determined by known methods using antigen / antibody reactions, such as by ELISA method.

[0164] The vaccines of the present invention can be administered in a single dose or repeated doses, depending on the vaccination schedule.

[0165] The vaccines of the present invention are further advantageous because they confer protection to avian species against targeted avian pathogens up to 70%, preferably up to 80%, 90% or more, 4 weeks after vaccination.

[0166] The present invention further relates to the use of the compositions, vaccines or vaccine compositions as described above for immunizing or vaccinating avian species such as poultry against at least one pathogen.

[0167] The present invention further relates to the rMDV as described above, preferably rHVT, which is used for immunizing or vaccinating avian species such as poultry, preferably chickens, against at least one avian pathogen.

[0168] The present invention further relates to a method for immunizing or vaccinating avian species by administering an immunologically effective amount of a vaccine according to the present invention. The vaccine can be advantageously administered by intradermal, subcutaneous, intramuscular, oral, in ovo, mucosal administration, or via eye-nose administration.

[0169] The present invention also relates to the rMDV as described above, which is used to increase the immune response of avian species such as poultry, preferably chickens, to at least one avian pathogen. "Increasing" the immune response means that after vaccination with rMDV as described herein, preferably rHVT, compared to using a vaccine that does not include an insulator element, a stronger immune protection against the pathogen is provided to the avian species.

[0170] In a particular embodiment, the rMDV or vaccine composition is used to vaccinate avian species such as poultry, preferably chickens, against Newcastle disease virus (NDV).

[0171] In another embodiment, the rMDV or vaccine composition is used to vaccinate avian species such as poultry, preferably chickens, against both infectious bursal disease virus (IBDV) and infectious laryngotracheitis virus (ILVT).

[0172] In another embodiment, the rMDV or vaccine composition is used to vaccinate avian species such as poultry, preferably chickens, against infectious bursal disease virus (IBDV).

[0173] The present invention also relates to a vaccination kit for immunizing avian species, which vaccination kit comprises an effective amount of the above-mentioned monovalent vaccine or multivalent vaccine and a device for administering said components to said species. For example, such a kit comprises an injection device filled with the monovalent vaccine or multivalent vaccine according to the present invention and instructions for use for intradermal, subcutaneous, intramuscular, or in ovo injection. Alternatively, the kit comprises a spray / aerosol, gel, drop, or eye drop device filled with the multivalent vaccine according to the present invention and instructions for use for eye-nose administration, oral administration, or mucosal administration.

[0174] Other aspects and advantages of the present application will now be disclosed in the following examples, which are intended to illustrate the present invention.

[0175] Examples

[0176] The inventors constructed a series of recombinant HVTs, in which different expression cassettes were inserted into the non-coding region located between HVT053 (UL45) and HVT054 (UL46), or between HVT052 (UL44) and HVT053 (UL45), or between HVT087 (SORF3) and HVT088 (US2). Their schematic diagrams are shown in Figure 2(a) andFigure 5 Shown in (a).

[0177] In the experiment, several monovalent recombinant HVTs and multivalent recombinant HVTs were used in each efficacy test. These viruses are represented as follows (virus / expression cassette inserted at the insertion site): FW169: rHVT / HVT053 - 054_Bac - VP2 (vaccine control)

[0178] FW181: rHVT / HVT053 - 054_Pec - gBdel

[0179] FW285: rHVT / HVT053 - 054_m3’HS1 - 72 - Bac - VP2

[0180] FW348: rHVT / HVT053 - 054_m3’HS1 - 72 - Bac - F

[0181] FW260: rHVT / HVT053 - 054_Bac - VP2 / HVT052 - 053_Mcmvie1 - gBdel

[0182] FW311: rHVT / HVT053 - 054_m3’HS1 - 72 - Bac - VP2 / HVT052 - 053_Mcmvie1 - gBdel

[0183] FW313: rHVT / HVT052 - 053_m3’HS1 - 72 - Mcmvie1 - VP2 / HVT053 - 054_Pec - gBdel

[0184] Example 1: Construction of homologous vectors

[0185] Plasmid construction was carried out essentially by standard molecular biology techniques (Molecular Cloning: A Laboratory Manual. 4th edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, USA, 2012).

[0186] Construction of p45 / 46_m3’HS1-72 Bac-VP2

[0187] The fragment in which the insulator sequence m3’HS1-72 (SEQ ID NO:4) is directly linked to the 5’ end of the Bac promoter was prepared by overlap PCR with p45 / 46BacVP2 (wo03064595) and specific primers (SEQ ID NO:9, 10, 11 and 12). The amplicon was cloned into p45 / 46BacVP2 digested with XbaI and EcoRI, generating p45 / 46_m3’HS1-72-Bac-VP2.

[0188] Construction of p44 / 45d46_Mcmvie1-gBdel

[0189] The nucleotide sequence of the ILTV-gBdel gene (SEQ ID:5) was initially obtained by cloning from the ILTV strain 632 (EP1731612A1). The ILTV gBdel gene was cloned into the pUC18 plasmid such that the ILTV gBdel gene had additional XbaI sites and Sall sites at the 5’ end and 3’ end respectively. Then, a part of the ILTVgBdel was divided into two by digestion with XbaI and SalL. These two portions of the ILTV gBdel gene were cloned into p44 / 45d46_Mcmvie1-VP2 (WO13144355) digested with XbaI and Sall, generating p44 / 45d46_Mcmvie1-gBdel.

[0190] Construction of p45 / 46_Bac-F

[0191] The NDV-F gene was synthesized and replaced with the IBDV-VP2 gene of p45 / 46BacVP2 (US7153511) by digestion with XbaI and SalI, generating p45 / 46_Bac-F.

[0192] Construction of p45 / 46_m3’HS1-72 Bac-F

[0193] The fragment containing the insulator sequence m3’HS1-72 (SEQ IDNO:4) was digested from p45 / 46_m3’HS1-72_Bac-VP2 with XhoI. The fragment was cloned into p45 / 46_Bac-F digested with XhoI, generating p45 / 46_m3’HS1-72_Bac-F.

[0194] Construction of p44 / 45 d46_m3’HS1-72 Mcmvie1-VP2

[0195] The fragment of the Mcmvie1 promoter ligated to the insulator sequence (SEQ ID: 4) at the 5'-end was amplified by overlapping PCR with p44 / 45d46_Mcmvie1-VP2 (wo13144355) and specific primers (SEQ ID: 19, 20, 21, 22, 23 and 24). This fragment was inserted into p44 / 45d46_Mcmvie1-VP2 digested with SacII and Nael by seamless cloning, generating p44 / 45d46_m3’HS1-72-Mcmvie1-VP2.

[0196] Example 2: Construction of recombinant HVT

[0197] The construction of recombinant HVT (rHVT) was performed by homologous recombination in cultured cells. For homologous recombination in cultured cells, viral DNA of wild-type HVT FC-126 strain (PASS+14) and FW285 (PASS+25) and FW181 (PASS+22) was prepared as described in the following reference: Morgan et al. (avian Diseases, 34: 345-351, 1990). Approximately 2 pg of parental viral DNA and 1 pg of one of the homology vectors were transfected into approximately 10 7Into the CEF cells. The transfected cells were added to Leibovitz’s L-15 (Life Technologies Corp., catalog number 41300-39), McCoy5A medium (Life Technologies Corp., catalog number 21500-061) (1:1), and 4% calf serum [LM(+) medium], seeded into 96-well tissue culture plates, and then incubated at 37 °C in 4% to 5% CO2 for 5 to 7 days until recombinant HVT plaques became visible. The cells were then detached from the plates by trypsin digestion, evenly transferred to two 96-well plates with CEF, and incubated for 4 to 6 days until plaques were observed. Screening was performed by plaque assay, and only plaques expressing the IBDV VP2 protein or the IL TV gB protein were stained. In other words, one of the two plates was fixed with a methanol:acetone mixture (1:2) and incubated with anti-IBDV VP2 mouse monoclonal antibody R63 (ATCC#: HB-9490) or anti-IL TV gB mouse monoclonal antibody #1_B4_7 (not publicly available). Next, it was incubated with a biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog number BA-9200), then incubated with the VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000), and plaques expressing the VP2 protein or the gB protein were stained by adding the NBT / BCIP solution (Roche Applied Science, catalog number 1681451). The wells containing the stained recombinant plaques were identified, and the cells in the corresponding wells on the other 96-well plate were trypsinized. The cells were then diluted in fresh secondary CEF cells and transferred to 96-well plates to complete the first round of purification. The purification procedure was repeated until all plaques were positively stained in the plaque assay.

[0198] A list of the constructed recombinant HVTs, their parental viruses, and the homologous vectors used is provided in Table I below. A diagram showing the genomic structures of the recombinant HVT / IBD and recombinant HVT / IBD-LT is provided in FIG. 1(a).

[0199] Table I: Recombinant HVTs constructed, parental viruses and homologous vectors

[0200]

[0201] The construction of FW169 and FW181 was carried out as disclosed in WO03064595.

[0202] Example 3: Verification of the genomic structure of recombinant HVT / IBD

[0203] Using FW285 as a model case, the characterization method of recombinant HVT / IBD is described below. Briefly, the genomic structure of recombinant HVT / IBD was verified by amplifying the flanking regions of the inserted gene by PCR reaction. The position of the amplified region in FW285 is shown in Fig. 1(b). The primer pairs used in the PCR reaction were SEQ ID NO:13 and SEQ ID NO:14. Fig. 1(c) demonstrated that all clones of FW285 had the correct genomic structure and that those clones did not contain the parental virus.

[0204] Example 4: Comparison of VP2 protein expression from recombinant HVT / IBD

[0205] The expression of VP2 antigen by the recombinant HVT / IBD (FW285) of the present invention was confirmed by Western blot assay. Western blot was performed using CEF cells infected with the recombinant virus and the anti-IBDV VP2 mouse monoclonal antibody R63. Briefly, CEF cells in a 12-well plate were infected with one of the recombinant virus strains or other recombinant virus strains at a multiplicity of infection of approximately 0.1. Three days after inoculation, the cells were harvested with trypsin and centrifuged at 913×g for 5 minutes. The pellet was washed with PBS and resuspended in 100 μl of PBS. After adding the same volume of 2× SDS sample buffer (130 mM Tris-Cl (pH 6.8), 6% SDS, 20% glycerol, 10% 2-mercaptoethanol and 0.01% bromophenol blue), the cell suspension was boiled for 5 minutes. The samples were separated by SDS-PAGE using a 10% polyacrylamide gel and transferred onto a PVDF membrane (Immobilon-P, Millipore). The membrane was completely dried and then incubated with the anti-IBDV VP2 mouse monoclonal antibody R63. After washing away the anti-IBDV VP2 mouse monoclonal antibody R63, a biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog number BA-9200) was added, and then the VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000) was added. The proteins bound to the anti-IBDV VP2 mouse monoclonal antibody R63 were visualized by adding the NBT / BCIP solution (Roche Applied Science, catalog number 1681451).

[0206] As shown in Fig. 2(a), protein bands with an expected size of 40 kilodaltons (kDa) for the VP2 protein were observed in the lanes with rHVT / IBD-infected cells (FW285 and FW169). The in vitro results clearly demonstrated that including a single upstream insulator did not alter promoter transcriptional activity.

[0207] To compare the amount of VP2 protein expressed in recombinant HVT / IBD, the results of quantitative western blotting assays by ImageJ were determined and shown as bar graphs in Figure 2(b). The relative density of the bands was measured relative to the vaccine control FW169. It was demonstrated that the insulator sequence enhanced VP2 protein expression in vitro compared to rHVT without the insulator.

[0208] Example 5: Efficacy of recombinant HVT / IBD in SPF chickens

[0209] The efficacy of FW285 was further investigated in SPF chickens. One-day-old chickens were divided into four groups, and the chickens in groups 3 and 4 were vaccinated subcutaneously with one of the recombinant HVT / IBD at approximately 3000 plaque-forming units (pfu) / 0.2 ml (FW169: group 3, FW285: group 4). The chickens in group 2 (unimmunized, challenged positive control - NIC) remained unvaccinated. The chickens in group 1 (unimmunized, unchallenged control - NINC) remained unvaccinated and unchallenged. The chickens were bled weekly between 1 week and 4 weeks of age, and the presence of anti-IBDV antibodies was tested using a commercial IBDV ELISA kit (ID IBD VP2: Idvet). The challenge was performed at 4 weeks of age. For the challenge, 1x10 3 EID 50 of the virulent IBDV STC strain was administered via the oral route. The chickens were observed daily for clinical signs associated with IBD, such as depression and death. Seven days after the challenge, the chickens were necropsied, and grossly observable bursa lesions, such as edema, discoloration, atrophy, bleeding, and yellow or gelatinous exudates, were observed. The body weight and the weight of the bursa were also measured at necropsy for calculating the B / B index, which is the ratio of the bursa weight to the body weight of the challenged bird divided by the same ratio of the unchallenged bird.

[0210] The results of the IBDV ELISA are shown in Figure 3 and the results of the efficacy are summarized in Table II below.

[0211] Construct FW285 appeared to induce the production of anti-VP2 antibodies earlier in vaccinated chickens than in chickens vaccinated with the control FW169 vaccine (OOI occurred at 2 weeks for FW285 and at 3 weeks for FW169), confirming the early immune response with the construct of the present invention. In addition, higher anti-IBDV VP2 titers were obtained with the FW169 construct as early as 3 weeks and up to 4 weeks after vaccination compared to the anti-IBDV VP2 titers obtained with the FW285 vaccine, confirming the stronger immunity obtained with the construct of the present invention.

[0212] Table II. Protection of recombinant HVT / IBD against virulent IBDV challenge in SPF chickens at 4 weeks of age

[0213]

[0214] (*) The B / B index represents the bursa index

[0215] (**) Protection % = 100 - 100 x (# deaths + # lesions) / n The B / B index is calculated as follows:

[0216] The BB index = the BB ratio of the infected (or inoculated) birds / the BB ratio of the control group

[0217] Where the BB ratio = [bursal weight (g) / body weight (g)] × 1000

[0218] As indicated in the publication "Bursal body index as a visual indicator for the assessment of bursa of Fabricius" (Journal of Veterinary Medicine and Animal Health, Volume 9(2), pages 32 - 38, February 2017; DOI: 10.5897 / JVMAH2016.0456), an index below 0.7 is generally considered to indicate bursa atrophy. Conversely, a B / B index higher than the value of 0.7 indicates no bursa atrophy.

[0219] Table II confirms that FW285 is stable in vivo. Table II further shows that FW285 can effectively protect chickens from IBDV challenge as well as FW169. In addition, FW285 induces a better anti - IBDV VP2 antibody titer than FW169 ( Figure 3 ).

[0220] These data indicate that the insulator sequence can enhance transgene expression and the antibody titer of rHVT in vivo. When poultry are inoculated with the rHVT of the present invention, earlier animal immunity can be further obtained.

[0221] Example 6: Verification of the genomic structure of recombinant HVT / ND

[0222] Taking FW348 as a model case, the characterization method of recombinant HVT / ND is described below. Briefly, the genomic structure of recombinant HVT / ND is verified by amplifying the flanking regions of the inserted gene through a PCR reaction. The primer pairs used in the PCR reaction are SEQ ID NO:25 and SEQ ID NO:26.

[0223] Example 7: Comparison of F protein expression from recombinant HVT / ND

[0224] The expression of F antigen by the recombinant HVT / ND (FW348) of the present invention was confirmed by black plaque assay and Western blot assay. CEF cells infected with the recombinant virus and anti-NDV F mouse monoclonal antibody #77-2 were used for black plaque and Western blot.

[0225] Briefly, CEF cells in 12-well plates were infected with one of the recombinant viruses at a multiplicity of infection of approximately 0.1. Three days after inoculation, the cells were fixed with a methanol:acetone mixture (1:2). After washing 3 times with PBS, the samples were incubated with anti-NDV F mouse monoclonal antibody #77-2. After washing away anti-NDV F mouse monoclonal antibody #77-2, the samples were incubated with biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog number BA-9200), and then the VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000) was added. Finally, the expression of NDV-F protein was visualized by NBT / BCIP solution (Roche Applied Science, catalog number 1681451). The results were observed using a microscope.

[0226] For Western blot, CEF cells in 12-well plates were infected with one of the recombinant virus strains or other recombinant virus strains at a multiplicity of infection of approximately 0.1. Three days after inoculation, the cells were harvested with trypsin and centrifuged at 913×g for 5 minutes. The pellet was washed with PBS and resuspended in 100 μl of PBS. After adding the same volume of 2×SDS sample buffer (130 mM Tris-Cl (pH 6.8), 6% SDS, 20% glycerol, 10% 2-mercaptoethanol and 0.01% bromophenol blue), the cell suspension was boiled for 5 minutes. The samples were separated by SDS-PAGE using a 10% polyacrylamide gel and transferred to a PVDF membrane (Immobilon-P, Millipore). The membrane was completely dried and then incubated with anti-NDV F mouse monoclonal antibody #77-2. After washing away anti-NDV F mouse monoclonal antibody #77-2, biotinylated anti-mouse IgG antibody (Vector Laboratories, catalog number BA-9200) was added, and then the VECTASTAIN ABC-AP kit (Vector Laboratories, catalog number AK-5000) was added. The proteins bound to anti-NDV F mouse monoclonal antibody #77-2 were visualized by adding NBT / BCIP solution (Roche Applied Science, catalog number 1681451).

[0227] As Figure 10As shown, NDV F protein expression was observed in CEF cells infected with rHVT / ND.

[0228] As Figure 11 shown, protein bands with an expected size of 60 kilodaltons (kDa) for the F protein were observed in the lanes with rHVT / ND-infected cells (FW348 and FW026). The in vitro results clearly demonstrated that including a single upstream insulator did not alter promoter transcriptional activity.

[0229] Example 8: Verification of the genomic structure of recombinant HVT / IBD-LT

[0230] Taking FW311 as a model case, the characterization method of recombinant HVT / IBD-LT is described below. Briefly, the genomic structure of recombinant HVT / IBD-LT was verified by amplifying the flanking regions of the inserted gene through PCR reactions. Figure 4(a) shows the amplified regions in FW311. The primer pairs used in the PCR reactions were SEQ ID NO:13 and SEQ ID NO:14 for PCR primer set 1, and SEQ ID NO:15 and SEQ ID NO:16 for PCR primer set 2. Figure 4(b) demonstrated that FW311 had the correct genomic structure and was free of parental viruses.

[0231] Example 9: Comparison of VP2 protein expression from recombinant HVT / IBD-LT

[0232] The expression of VP2 antigen by the recombinant HVT / IBD-LT (FW311, 313) of the present invention was confirmed by Western blot assay. Western blot was performed using CEF cells infected with the recombinant virus as exposed in Example 4 and anti-IBDV VP2 mouse monoclonal antibody R63.

[0233] Protein bands with an expected size of 40 kilodaltons (kDa) for the VP2 protein were observed in the lanes with rHVT / IBD-LT-infected cells. FW260 is a multivalent rHVT lacking an insulator and was used as the counterpart of FW311 (Figure 4(c)). Similarly, FW261 is a multivalent rHVT lacking an insulator and was used as the counterpart of FW313 (Figure 8(a)).

[0234] To compare the amount of VP2 protein expressed in recombinant HVT / IBD-LT, the results of Western blot assay were quantified by ImageJ and presented as bar graphs in Figure 5 (FW311) and Figure 8b (FW313). The relative density of the bands ( Figure 5 ) was measured relative to the vaccine control FW169. It was demonstrated that the insulator sequence could enhance VP2 protein expression in vitro compared to rHVT without an insulator.

[0235] Example 10: Efficacy of recombinant HVT / IBD-LT against virulent IBDV in SPF chickens (FW311)

[0236] The efficacy of recombinant HVT / IBD-LT FW 311 was studied in SPF chickens. One-day-old chickens were divided into four groups, and the chickens in Group 4 were vaccinated subcutaneously with approximately 3000 plaque-forming units (pfu) / 0.2 ml of recombinant HVT / IBD-LT (FW311: Group 4). Similarly, the chickens in Group 3 were vaccinated subcutaneously with a vaccine control (FW169). The chickens in Group 2 (non-immunized, challenged positive control) remained unvaccinated. The chickens in Group 1 (non-immunized, non-challenged control) remained unvaccinated and unchallenged. Chickens between 1 week and 4 weeks of age were bled weekly. The challenge was performed at 4 weeks of age. For the challenge, 1x10 3 EID 50 of the virulent IBDV STC strain was administered via the oral route. Chickens were observed daily for clinical signs associated with IBD, such as depression and death. Seven days after the challenge, the chickens were necropsied, and grossly observable bursa lesions, such as swelling, discoloration, atrophy, bleeding, and yellow or gelatinous exudates, were observed. Body weight and bursa weight were also measured at necropsy for calculation of the B / B index, which is the ratio of bursa weight to body weight of the challenged bird divided by the same ratio of the non-challenged bird.

[0237] The results of the IBDV ELISA are shown in Figure 6 and the results of the efficacy trial are summarized in Table III below.

[0238] Construct FW311 induced the synthesis of anti-VP2 antibodies.

[0239] Table III. Effect of protection of recombinant HVT / IBD-LT against virulent IBDV challenge in SPF chickens at 4 weeks of age (efficacy Trial 2)

[0240]

[0241] *The B / B index represents the bursa index

[0242] (**) % Protection = 100 - 100x(# deaths + # lesions) / n.

[0243] The results confirmed that FW311 was stable in vivo. The results further showed that FW311 elicited protective immunity against IBDV challenge infection in vivo.

[0244] Example 11: Efficacy of recombinant HVT / IBD-LT against virulent ILTV in SPF chickens (FW311)

[0245] The efficacy of recombinant HVT / IBD-LT FW311 was studied in SPF chickens. One-day-old chickens were divided into three groups, and the chickens in Group 3 were vaccinated subcutaneously with approximately 3000 plaque-forming units (pfu) / 0.2 ml of recombinant HVT / IBD-LT FW311. Similarly, the chickens in Group 2 were vaccinated subcutaneously with a vaccine control (FW181). The chickens in Group 1 (unimmunized, challenged positive control) remained unvaccinated. Chickens between 1 week and 4 weeks of age were bled weekly. The challenge was performed at 4 weeks of age. For the challenge, 1x10 3 EID 50 of the virulent ILTV US strain was administered via the intratracheal route. The chickens were observed daily for clinical signs associated with ILTV, such as rales, gasping, neck dorsum, bloody expectorants, nasal exudates, eyelid swelling, lacrimation, mucoid conjunctivitis, nasal bleeding, head / eye / face swelling, head tremors, ruffled feathers, depression, and death. Ten days after the challenge, the chickens were necropsied.

[0246] The efficacy results are summarized in Tables IV and V below.

[0247] Table IV. Protection of recombinant HVT / IBD-LT against virulent ILTV challenge in SPF chickens at 4 weeks of age

[0248]

[0249] The results showed that FW311 elicited excellent protective immunity against in vivo ILTV challenge infection.

[0250] Table V. Daily clinical sign scores of recombinant HVT / IBD-LT from virulent IL TV challenge (efficacy trial)

[0251]

[0252] Clinical sign score = total points / live birds

[0253] From the 3rd day after vaccination, very good clinical scores were obtained in the group of chickens vaccinated with FW311, with an average clinical sign score of 0.02.

[0254] In summary, all these results showed that the presence of insulators in the multivalent rHVT increased the expression of the antigen placed under the influence of the insulator without altering the synthesis and expression of the second antigen. In addition, the introduction of insulators into the genome of rHVT had no effect on the stability and efficacy of the virus.

[0255] Example 12: Efficacy of recombinant HVT / LBD-LT against virulent IBDV in SPF chickens (FW313)

[0256] For FW311 (Example 8), the efficacy of recombinant HVT / IBD-LT FW313 was studied in SPF chickens. One-day-old chickens were divided into three groups, and the chickens in Group 3 were vaccinated subcutaneously with approximately 3000 plaque-forming units (pfu) / 0.2 ml of the recombinant HVT / IBD-LT of the present invention (FW313: Group 3). The chickens in Group 2 (non-immunized, challenged positive control) remained unvaccinated. The chickens in Group 1 (non-immunized, non-challenged control) remained unvaccinated and unchallenged. Chickens between 1 and 4 weeks of age were bled weekly. At 4 weeks of age, the challenge was carried out. For the challenge, 1x10 3 EID 50 of the virulent IBDV STC strain was administered via the oral route. The chickens were observed daily for clinical signs associated with IBD, such as depression and death. Seven days after the challenge, the chickens were necropsied, and gross bursa lesions such as swelling, discoloration, atrophy, bleeding, and yellow or gelatinous exudates were observed. The body weight and the weight of the bursa of Fabricius were also measured at necropsy for calculating the B / B index, which is the ratio of the bursa weight to the body weight of the challenged bird divided by the same ratio of the non-challenged bird.

[0257] The results of the efficacy test are summarized in Table IV below.

[0258] Construct FW313 induced the synthesis of anti-VP2 antibodies.

[0259] Table IV. Effect of protection of recombinant HVT / IBD-LT against virulent IBDV challenge in SPF chickens at 4 weeks of age (efficacy Trial 2)

[0260]

[0261] (*) The B / B index represents the bursa index

[0262] (**) % Protection = 100 - 100x(# deaths + # lesions) / n.

[0263] The results confirmed that FW313 was stable in vivo. The results further showed that FW313 elicited protective immunity against in vivo IBDV challenge infection.

Claims

1. A recombinant Marek's disease virus (rMDV), said recombinant Marek's disease virus comprising a recombinant nucleotide sequence encoding an antigen inserted into an insertion site, said recombinant nucleotide sequence being operably linked to a promoter and an insulator, wherein said insulator is located upstream of said promoter.

2. The rMDV according to claim 1, wherein said insulator comprises one or more CCCTC-binding factor (CTCF) motifs.

3. The rMDV according to claim 1 or 2, wherein said insulator comprises or consists of a functional fragment of the murine 3' hypersensitive site 1 (m3'HS1) insulator.

4. The rMDV according to claim 3, wherein the functional fragment of m3’HS1 comprises, consists essentially of, or consists of the following: The nucleotide sequence as shown in SEQ ID NO:4, or a nucleotide sequence having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence as shown in SEQ ID NO:4 and retaining insulator activity.

5. The rMDV according to any one of claims 1 to 4, said rMDV comprising a first recombinant nucleotide sequence encoding a first antigen inserted into a first insertion site and a second recombinant nucleotide sequence encoding a second antigen inserted into a second insertion site different from said first insertion site, wherein said first recombinant nucleotide sequence encoding an antigen is operably linked to a promoter and an insulator located upstream of said promoter, and wherein said second recombinant nucleotide sequence is operably linked to a promoter.

6. The rMDV according to claim 5, wherein said nucleotide sequences encode different antigens.

7. The rMDV according to any one of claims 1 to 6, wherein said insertion site is located in a non-coding region of the viral genome, said non-coding region preferably being selected from the non-coding regions between L43 and UL47, between UL55 and SORF4, and between US1 and US3, more preferably being selected from the non-coding regions between UL44 and UL45, between UL45 and UL46, between UL55 and SORF4, between US10 and SORF3, and between SORF3 and US2, even more preferably being located between UL44 and UL45, between UL45 and UL46, and between SORF3 and US2.

8. The rMDV according to any one of claims 1 to 7, wherein said recombinant nucleotide sequence encodes an antigen from an avian pathogen, said antigen preferably being selected from surface proteins, secreted proteins and structural proteins of said avian pathogen or antigenic fragments thereof.

9. The rMDV according to claim 8, wherein the antigen is selected from antigens of avian paramyxovirus type 1, preferably the F protein or an antigenic fragment thereof of Newcastle disease virus (NDV), antigens of infectious bursal disease virus, preferably the VP2 protein or an antigenic fragment thereof of infectious bursal disease virus (IBDV), antigens of infectious laryngotracheitis virus, preferably the gB protein or an antigenic fragment thereof, antigens of Mycoplasma gallisepticum, preferably the 40K protein or an antigenic fragment thereof, and antigens of avian influenza virus, preferably the surface protein hemagglutinin (HA) or an antigenic fragment thereof.

10. The rMDV according to any one of claims 1 to 9, wherein the promoter controlling the expression of the recombinant nucleotide sequence is selected from the chicken β-actin (Bac) promoter, the Pec promoter, the murine cytomegalovirus (Mcmv) immediate early (ie) 1 promoter, the human cytomegalovirus promoter (Hcmv), the simian virus (SV40) 40 promoter, and the Rous sarcoma virus (RSV) promoter or any fragment thereof that retains promoter activity.

11. The rMDV according to any one of claims 1 to 10, wherein the rMDV is a recombinant turkey herpesvirus (rHVT).

12. The rMDV according to any one of claims 1 to 11, wherein the rMDV comprises a first recombinant nucleotide sequence inserted into the non-coding region between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region between UL45 and UL46, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter and an insulator upstream of the promoter, and wherein the second recombinant nucleotide sequence is operably linked to a promoter.

13. The rMDV according to any one of claims 1 to 11, wherein the rMDV comprises a first recombinant nucleotide sequence inserted into the non-coding region between UL44 and UL45 and a second recombinant nucleotide sequence inserted into the non-coding region between UL45 and UL46, wherein the first recombinant nucleotide sequence encoding the antigen is operably linked to a promoter, and wherein the second recombinant nucleotide sequence is operably linked to a promoter and an insulator upstream of the promoter.

14. The rMDV according to claim 12 or 13, wherein the recombinant nucleotide sequence encodes the VP2 protein or an antigenic fragment thereof of IBDV, and the second recombinant nucleotide sequence encodes the gB protein or an antigenic fragment thereof of ILTV in reverse.

15. The rMDV according to any one of claims 11 to 14, wherein a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, preferably the Bac promoter and the m3’HS1 insulator or a functional fragment thereof upstream of the Bac promoter, is inserted into the first insertion site in the non-coding region between UL45 and UL46, and a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmvie1 promoter, is inserted into the second insertion site in the non-coding region between UL44 and UL45, wherein the functional fragment of the m3’HS1 insulator comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence as shown in SEQ ID NO:4 and retaining insulator activity, or consists thereof.

16. The rMDV according to any one of claims 11 to 14, wherein a first recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a promoter, preferably the Mcmv ie1 promoter and the m3’HS1 insulator or a functional fragment thereof upstream of the Mcmv ie1 promoter, is inserted into the first insertion site in the non-coding region between UL44 and UL45, and a second recombinant nucleotide sequence encoding the gB protein of ILTV or an antigenic fragment thereof, operably linked to a promoter, preferably the Pec promoter, is inserted into the second insertion site in the non-coding region between UL45 and UL46, wherein the functional fragment of the m3’HS1 insulator comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence as shown in SEQ ID NO:4 and retaining insulator activity, or consists thereof.

17. The rMDV according to any one of claims 1 to 4 or according to any one of claims 7 to 11 when dependent on any one of claims 1 to 4, the rMDV comprising a single recombinant nucleotide sequence encoding an antigen, the single recombinant nucleotide sequence being operably linked to a promoter and an insulator upstream of the promoter.

18. The rMDV according to claim 17, wherein the single recombinant nucleotide sequence is inserted into an insertion site in the non-coding region between UL45 and UL46.

19. The rMDV according to claim 17 or 18, wherein a recombinant nucleotide sequence encoding the VP2 protein of IBDV or an antigenic fragment thereof, operably linked to a Bac promoter and a functional fragment of the m3’HS1 insulator located upstream of the Bac promoter, is inserted at the insertion site in the non-coding region located between UL45 and UL46, and wherein the functional fragment of the m3’HS1 insulator comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95%, 96%, 97%, 98% or 99% identity to the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists thereof.

20. The rMDV according to claim 17 or 18, wherein a recombinant nucleotide sequence encoding the F protein of NDV or an antigenic fragment thereof, operably linked to a Bac promoter and a functional fragment of the m3’HS1 insulator located upstream of the Bac promoter, is inserted at the insertion site in the non-coding region located between UL45 and UL46, and wherein the functional fragment of the m3’HS1 insulator comprises a nucleotide sequence having a CTCF motif and having at least 90%, preferably at least 95% or 99% identity to the full-length sequence shown in SEQ ID NO:4 and retaining insulator activity or consists thereof.

21. A host cell, the host cell comprising a nucleic acid molecule or the rMDV according to any one of claims 1 to 20, the nucleic acid molecule comprising, consisting essentially of or consisting of the genome of the rMDV according to any one of claims 1 to 20.

22. A vaccine composition, the vaccine composition comprising the rMDV according to any one of claims 1 to 20 and a pharmaceutically acceptable vehicle.

23. A vaccination kit for immunizing avian species, the vaccination kit comprising the vaccine composition according to claim 22 and a device for administering the vaccine composition to the species, and optionally instructions for use for administering the vaccine composition.

24. The rMDV according to any one of claims 1 to 20 or the vaccine composition according to claim 22, the rMDV or the vaccine composition for vaccinating avian species such as poultry, preferably chickens, against at least one avian pathogen.

25. The rMDV according to any one of claims 1 to 20 or the vaccine composition according to claim 22, the rMDV or the vaccine composition for inducing an early immune response in avian species such as poultry, preferably chickens, against at least one avian pathogen.

26. The rMDV according to claim 15 or 16 or the vaccine composition comprising the rMDV, the rMDV or the vaccine composition for vaccinating avian species such as poultry, preferably chickens, against infectious bursal disease virus (IBDV) and infectious laryngotracheitis virus (ILVT).

27. The rMDV or vaccine composition comprising the rMDV according to claim 19, wherein the rMDV or the vaccine composition is used for vaccinating avians such as poultry, preferably chickens, against infectious bursal disease virus (IBDV).

28. The rMDV or vaccine composition comprising the rMDV according to claim 20, wherein the rMDV or the vaccine composition is used for vaccinating avians such as poultry, preferably chickens, against Newcastle disease virus (NDV).

29. A method for immunizing or vaccinating an avian against an avian pathogen by administering to the avian such as poultry, preferably chickens, an immunologically effective amount of the rMDV according to any one of claims 1 to 20 or the vaccine according to claim 22.

30. A method for increasing the immune response of an avian against an avian pathogen by administering to the avian such as poultry, preferably chickens, an immunologically effective amount of the rMDV according to any one of claims 1 to 20 or the vaccine according to claim 22.

31. The method according to claim 29 or 30, wherein the rMDV is administered orally, by eye, by eye-nose administration using an aerosol, intranasally, by cloacal administration, by mucosal administration, in ovo or by injection.

Citation Information

Patent Citations

  • Recombinant herpesvirus and utilization of the same

    EP1731612A1

  • Avian herpesvirus-based recombinant Infectious Bursal Disease vaccine

    US7153511B2

  • Recombinant herpesvirus of turkeys and use thereof

    WO2003064595A2

  • Multivalent recombinant avian herpes viruses and vaccines for immunizing avian species

    WO2013144355A1