Construction method and application of primary cardiomyopathy animal model

Abstract

The invention belongs to the technical field of disease model construction, and particularly relates to a construction method and application of a primary cardiomyopathy animal model. The invention provides a construction method of a primary cardiomyopathy animal model. The animal model shows typical characteristics of primary cardiomyopathy, such as reduction of the ratio of heart weight to body weight, reduction of the ratio of heart weight to tibia length, reduction of cardiac ejection fraction, left ventricular minor axis shortening rate, reduction of left ventricular diastolic end inner diameter and left ventricular systolic end inner diameter, significant increase of cardiac fibrosis area and the like. The animal model can be used for researching the primary cardiomyopathy and screening medicines for treating the primary cardiomyopathy, and has a wide application prospect.

Description

Technical Field

[0001] The present invention belongs to the technical field of disease model construction, and specifically relates to a method for constructing an animal model of primary cardiomyopathy and its application. Background Art

[0002] Primary cardiomyopathies (such as hypertrophic cardiomyopathy, dilated cardiomyopathy) are a group of genetic diseases characterized by abnormal myocardial structure or function, and their onset is highly correlated with specific gene mutations (such as MYH7, MYBPC3, TNNT2, etc.). With the popularization of gene sequencing technology, a large number of pathogenic mutation sites (such as missense mutations, splice site variations) that are clearly associated with disease phenotypes have been accumulated clinically. However, existing animal models are difficult to simulate the corresponding relationship of human cardiomyopathy phenotypes, resulting in low efficiency in disease mechanism research and drug development.

[0003] Traditional chemical induction or surgical modeling (such as isoproterenol injection) only simulates the end-stage pathological phenotype and cannot reflect the disease occurrence and development process driven by genetic factors, leading to the disconnection between mechanism research and clinical practice. Existing models mostly focus on a few high-frequency mutations, while a large number of rare mutations in clinical practice lack corresponding models, hindering the development of individualized treatment strategies.

[0004] Therefore, constructing an animal model of primary cardiomyopathy is of extremely important significance for the development of clinically relevant therapeutic drugs and the treatment of cardiomyopathy patients. Summary of the Invention

[0005] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a method for constructing an animal model of primary cardiomyopathy and its application. The animal model of primary cardiomyopathy obtained by using this construction method can be used for researchers to deeply and systematically study primary cardiomyopathy and for drug screening of primary cardiomyopathy.

[0006] The present invention uses the CRISPR technology to shear the DNA of the target gene, and at the same time provides a homologous template Donor with point mutations. Through homologous recombination repair of DNA, base substitution is achieved in a specific exon to achieve the purpose of point mutation.

[0007] Among them, the site of the point mutation is located on Exon 16 of the PIEZO1 gene, that is, at the 123224720th position on the antisense strand of chromosome 8. gRNA target sites are designed in the Intron on both sides of Exon16, and the following base mutations are carried out: GGC G ACCTG->GGC T ACCTG, to achieve point mutation of amino acids.

[0008] To achieve the above purpose, the present invention adopts the following technical solutions:

[0009] In the first aspect of the present invention, a method for constructing an animal model of primary cardiomyopathy is provided, comprising the following steps:

[0010] S1. Modify the genome of a mouse single-cell embryo so that a point mutation occurs in the PIEZO1 gene in the genome of the mouse single-cell embryo;

[0011] S2. Select a gene-modified mouse single-cell embryo in which a point mutation occurs in the PIEZO1 gene in the genome of the mouse single-cell embryo;

[0012] S3. Implant the gene-modified mouse single-cell embryo into a surrogate mother to obtain a founder mouse with a point mutation;

[0013] The gene number of PIEZO1 is 234839; the point mutation site is located at position 123224720 on the antisense strand of chromosome 8 of the mouse reference genome, and the nucleotide base at this site is G or T. Among them, the nucleotide sequence of exon 16 of the non-point-mutated PIEZO1 gene is as follows:

[0014] GTTGGGCGACCTGGGCCTGGAGCAGTTCAGTGTGTCGGAGCTCTTTTCCAGTATCCTCATCC CTGGCTTCTTCCTGCTGGCCTGCATCCTGCAGCTGCACTACTTCCACAGACCGTTCATGCAGCTC ACTGACCTGGAGCACGTGCCGCCACCAGGCACCCGCCACCCTCGATGGGCTCACAG (SEQ ID NO.1).

[0015] Further, the construction method further includes step S4: obtaining the F1 generation of gene point mutation heterozygous mice by crossing the founder mouse in step S3 with a wild-type mouse.

[0016] Further, after obtaining the F1 generation of heterozygous mice with gene mutations, DNA sequencing is performed to confirm that the target gene has mutated.

[0017] Further, the nucleotide sequences of the sequencing primers are as follows:

[0018] F: GCTGTCACTTCACCTTCTGTCC (SEQ ID NO.8); R: GCTCCTGTCTGCCTTCCTCAA (SEQ ID NO.9).

[0019] Further, the modification method is CRISPR / Cas9 technology, zinc finger nuclease technology or transcription activator-like effector nuclease technology.

[0020] Further, step S1 includes introducing into mouse single-cell stage embryos:

[0021] (i) A nuclease reagent targeting the 16th exon of the PIEZO1 gene or a polynucleotide encoding the nuclease reagent;

[0022] and (ii) A targeting vector containing a donor DNA with a point mutation, where the donor DNA contains a 5' homologous arm corresponding to the 5' targeting sequence of the 16th exon of the PIEZO1 gene and a 3' homologous arm corresponding to the 3' targeting sequence of the 16th exon of the PIEZO1 gene;

[0023] Wherein, the nucleotide sequence of the donor DNA is as follows:

[0024] CTGCTGTGCCTCACCTTGTTCCAGGTGACCTAGGGAATGGGCAGGTAGGGCTCGTGGGTGG

[0025] GGCTCTGTCCCTCACCTGCCCTGCTCACCAGCCACCCCACCCCCATCCTTCTGCAGGTCTACTAC

[0026] ACCCTGTGGAGGAAGCTGCTGCGTGTCTTCTGGTGGCTCGTGGTGGCCTATACAATGCTCGTGCT

[0027] CATCGCTGTGTACACCTTCCAGTTCCAGGACTTCCCCACCTATTGGCGCAACCTCACGGGCTTCA

[0028] CGGACGAGCAGTGAGTAGGGTAAATTAGGGGCAGTACCGCTGAGCGCTCTTCAGGGGGCGGTA

[0029] GAGGCACCTTCCTCGTAACGTCCCATGCTCAGACTCTAAGATCTGGTTCAGGAGGGCTACTGGTT

[0030] CAGGGCAGAGTAAAGGGCTGATGGTGCTCGCTCTCTTCTGCCAGGTTGGGCTACCTGGGCCTGG

[0031] AGCAGTTCAGTGTGTCGGAGCTCTTTTCCAGTATCCTCATCCCTGGCTTCTTCCTGCTGGCCTGC

[0032] ATCCTGCAGCTGCACTACTTCCACAGACCGTTCATGCAGCTCACTGACCTGGAGCACGTGCCGC

[0033] CACCAGGCACCCGCCACCCTCGATGGGCTCACAGGTGTTCTGCCTTCGAGAACCACGGGTGTTT

[0034] TTTGGTCTGTGGGAACTGGGGTTGACGCTAAGGGCTGTGTCATAGAGTTAGCCGACCGTCCTGC

[0035] GCTTGGGCGGGAGCCGTGAGGCAGCCTTAAGTTATGTAGACTTGGCCTAGAGTTTACAGGTGGA

[0036] CTGGTGGAGATGGGGTGGGGGGGCTGTCTCAGGGAAGGGAGAGCCAGGGACAAGGGCAGGAA

[0037] GTGACACTTGGGCTTTCCCAGGCAGGATGCAGTGAGCGAGGCCCCTCTGCTTGAGCATCAGGA

[0038] GGAAGAGGAAGTC(SEQ ID NO.2);

[0039] The nucleotide sequence of the 5' homologous arm is as follows:

[0040] TGCTGTGCCTCACCTTGTTCCAGGTGACCTAGGGAATGGGCAGGTAGGGCTCGTGGGTGGG

[0041] GCTCTGTCCCTCACCTGCCCTGCTCACCAGCCACCCCACCCCCATCCTTCTGCAGGTCTACTACA

[0042] CCCTGTGGAGGAAGCTGCTGCGTGTCTTCTGGTGGCTCGTGGTGGCCTATACAATGCTCGTGCTC

[0043] ATCGCTGTGTACACCTTCCAGTTCCAGGACTTCCCCACCTATTGGCGCAACCTCACGGGCTTCAC

[0044] GGACGAGCAGTGAGTAGGGTA(SEQ ID NO.3);

[0045] The nucleotide sequence of the 3' homologous arm is as follows:

[0046] ATGTAGACTTGGCCTAGAGTTTACAGGTGGACTGGTGGAGATGGGGTGGGGGGGCTGTCTC AGGGAAGGGAGAGCCAGGGACAAGGGCAGGAAGTGACACTTGGGCTTTCCCAGGCAGGATGC AGTGAGCGAGGCCCCTCTGCTTGAGCATCAGGAGGAAGAGGAAG(SEQ ID NO.4)

[0047] Furthermore, the nucleotide sequence of the targeting vector is as shown in SEQ ID NO.7.

[0048] Furthermore, the nuclease reagent comprises Cas9 nuclease and guide gRNA.

[0049] Furthermore, the Cas nuclease is Cas9nickase mRNA.

[0050] Furthermore, the sequence of the guide RNA is as shown in SEQ ID NO.5-6;

[0051] PIEZO1-L: GGTTCAGGAGGGCTACTG(SEQ ID NO.5); PIEZO1-R: CTCTAGGCCAAGTCTACA(SEQ ID NO.6).

[0052] In the second aspect of the present invention, there is provided the use of the model mice obtained by the method for constructing the above-mentioned animal model of primary cardiomyopathy in screening drugs for treating primary cardiomyopathy.

[0053] The above one or more technical solutions have the following beneficial effects:

[0054] The method for constructing the animal model of primary cardiomyopathy provided by the present invention can obtain those showing typical characteristics of primary cardiomyopathy such as a reduced ratio of heart weight to body weight, a reduced ratio of heart weight to tibia length, a reduced heart ejection fraction, a reduced left ventricular short-axis shortening rate, a reduced left ventricular end-diastolic diameter and a reduced left ventricular end-systolic diameter, and a significantly increased area of cardiac fibrosis. This animal model can be used in the research of primary cardiomyopathy and in screening drugs for treating primary cardiomyopathy, and has broad application prospects. Brief Description of the Drawings

[0055] The accompanying drawings forming a part of this invention are used to provide a further understanding of the invention. The schematic embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0056] Figure 1 Technical principle for constructing point mutation mice;

[0057] Figure 2 Sequencing analysis of point mutation mice;

[0058] Figure 3 Schematic diagram of cardiomyopathy caused by GOF PIEZO1 mutation; wherein, (A) is the experimental result of the ratio of heart weight to body weight; (B) is the experimental result of the ratio of heart weight to tibia length; (C) and (D) are the experimental results of cardiac ultrasound; (E) is the experimental result of cardiac Masson staining; (F) is the statistical chart of cardiac collagen fibers;

[0059] Figure 4 Results of single-cell analysis and verification of pathway enrichment; wherein, (A) is the UMAP map of cell types in cardiac tissue; (B) is the enrichment map of inhibitory pathways; (C) and (D) are gene set enrichment analysis of fatty acid pathways; (E) and (F) are the oil red staining and statistical analysis maps of the heart; (G) and (H) are the transmission electron microscopy and statistical analysis maps of the heart; (I) and (J) are the immunoblotting and statistical analysis maps of proteins related to fatty acid pathways;

[0060] Figure 5 Schematic diagram showing that inhibiting the activity of GOF PIEZO1 mutation can improve cardiomyopathy; wherein, (A) and (B) are the experimental results of cardiac ultrasound of mice with inhibited GOF PIEZO1 mutation activity; (B) and (D) are the experimental results of cardiac Masson staining of mice with inhibited GOF PIEZO1 mutation activity; (E) is the experimental result of oil red staining and transmission electron microscopy of the heart of mice with inhibited GOF PIEZO1 mutation activity. Detailed implementation manners

[0061] It should be noted that the following detailed description is exemplary and is intended to provide further illustration of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs.

[0062] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit the exemplary embodiments according to the present application. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should also be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. If the experimental methods in the following specific embodiments are not specified with specific conditions, they are generally carried out according to the conventional methods and conditions in the field of molecular biology, and such techniques and conditions are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., "Molecular Cloning: A Laboratory Manual", or according to the conditions recommended by the manufacturer.

[0063] The present invention will be further described in conjunction with specific examples. The following examples are only for explaining the present invention and do not limit its content. If the specific experimental conditions are not indicated in the examples, they are generally carried out according to the conventional conditions or according to the conditions recommended by the sales company; the materials, reagents, etc. used in the examples, unless otherwise specified, can be obtained through commercial channels.

[0064] The features and performance of the present invention will be further described in detail in the following examples.

[0065] Example 1 Construction of GOF PIEZO1 mutant mice

[0066] As Figure 1 shown, the present invention uses CRISPR technology to shear the DNA of the target gene, and at the same time provides a homologous template Donor with point mutations. Through homologous recombination repair of DNA, base substitution is achieved in a specific exon to achieve the purpose of point mutation.

[0067] 1. Design of gRNA sequences targeting point mutant genes

[0068] gRNA target site sequences for recognizing the L-terminal (5'-end) target site and the R-terminal (3'-end) target site were designed and synthesized for the 16th exon region of the mouse PIEZO1 gene. The two ends of the sgRNA recognition sites are respectively located in the Intron at both ends of the 16th exon of the mouse PIEZO1 gene, and their nucleotide sequences are shown in SEQ ID NO.1-2: PIEZO1-L: GGTTCAGGAGGGCTACTG (SEQ ID NO.5); PIEZO1-R: CTCTAGGCCAAGTCTACA (SEQ ID NO.6).

[0069] 2. Construction of homologous recombination template (Donor plasmid)

[0070] According to the positions of gRNA targets with high endogenous activity, donor DNA fragments were designed, and a donor DNA targeting vector containing mutation sites was constructed. The nucleotide sequence of the donor DNA fragment is shown in SEQ ID NO.2.

[0071] The specific design idea is as follows: Determine the homologous arm sequences; at the same time, introduce point mutations at the designated positions on the gene; subsequently, design the gRNA targets on the introns on both sides of exon 16, and introduce point mutations to the targets (without affecting the splicing of exons), so that the gRNA can no longer recognize and cleave the donor DNA, avoiding re - mutation and improving the efficiency of point mutation.

[0072] The plasmid vector containing the Donor DNA was constructed by gene synthesis, and its nucleotide sequence is shown in SEQID NO.7.

[0073] 3. Establishment of a stably inherited point - mutant mouse strain

[0074] Cas9nickase mRNA (Viewsolid, 50 ng / μl), Cas9 target gRNA (Viewsolid, 10 ng / μl) and donor DNA vector (Viewsolid, 20 ng / μl) were co - microinjected into mouse fertilized eggs. Gene knockout was achieved by directly injecting fertilized eggs. Since gene knock - in occurs at an early stage of fertilized egg development, even at the single - cell stage, the chimerism rate of mice is high, and the probability of mouse transmission is higher than that of injecting ES cells into blastocysts. The genotypes of the mice were identified two weeks after birth, and PCR was used to detect whether the founder mice with gene point mutations were obtained. The identification primers were: F: GCTGTCACTTCACCTTCTGTCC (SEQID NO.8); R: GCTCCTGTCTGCCTTCCTCAA (SEQ ID NO.9).

[0075] After obtaining the founder mice with point mutations, the founder mice with point mutations were mated with wild - type mice to obtain stably inherited heterozygous mice with gene point mutations (+ / -) in the F1 generation. PCR amplification was performed using the sequences such as SEQ ID NO.8 - 9, and the amplified products were subjected to DNA sequencing. The sequencing results are as Figure 2 shown, confirming that point mutations occurred in the target gene.

[0076] Example 2 Detection of cardiac function in GOF PIEZO1 mutant mice

[0077] When the gain-of-function (GOF) PIEZO1 mutant mice were bred to 3 months of age, the cardiac function and structure were detected using a small animal ultrasound system and pathological staining. As Figure 3 shown in (A) of Figure 3 and (B) of Figure 3 , the ratio of heart weight to body weight and the ratio of heart weight to tibia length in GOF PIEZO1 mutant mice decreased; as Figure 3 shown in (C) of Figure 3 and (D) of Figure 3 , the ejection fraction, left ventricular fractional shortening, left ventricular end-diastolic diameter, and left ventricular end-systolic diameter in GOF PIEZO1 mutant mice decreased; as

[0078] shown in (E) of

[0079] and (F) of

[0080] , the area of cardiac fibrosis in GOF PIEZO1 mutant mice increased significantly. Based on the above results, GOF PIEZO1 can lead to the phenotype of primary cardiomyopathy in mice. Figure 4 Single-cell analysis between samples found that the GOF PIEZO1 mutation was closely related to the cardiac lipid metabolism pathway. After cardiac ultrasound examination, the mice were sacrificed and the fresh heart tissues were taken for preparation of electron microscopy sections. At the same time, frozen sections were prepared from the fixed heart tissues to detect the changes in cardiac lipid droplets. The heart tissues were collected and added with protein lysate (Beyotime, P0013B) and protease phosphatase inhibitor mixture (Beyotime, P1045). After shaking and mixing evenly, low-temperature homogenization was performed, and the supernatant was collected. An equal volume of 1× Loading Buffer was added, and the mixture was boiled at 100 °C for 5 min. The prepared protein samples were added to the micropores of the SDS-PAGE gel for electrophoresis and transferred to the PVDF membrane. The expression of proteins related to the fatty acid pathway in the single-cell results was verified by the principle of Western blot experiment. Figure 4 Figure 4 Figure 4 Figure 4 Figure 4 Figure 4 Figure 4 Figure 4 Figure 4 ​​​​​​​​As shown in (J) therein, the expression levels of fatty acid pathway-related proteins CPT1, CPT2, CD36, and PGC-1α decreased.

[0081] Example 4 Inhibit the activity of PIEZO1 in GOF PIEZO1 mutant mice and detect the cardiac function of the animals

[0082] The inhibitor GsMTX4 (MCE, HY-P1410) of PIEZO1 was intraperitoneally injected to inhibit the activity of PIEZO1. Four weeks after the intraperitoneal injection, the cardiac function of the mice was detected. As Figure 5 shown in (A) therein and Figure 5 shown in (B) therein, inhibiting the activity of PIEZO1 in GOF PIEZO1 mutant mice improved the cardiac function injury of the animals. Paraffin sections were prepared from mouse heart tissues fixed with 4% paraformaldehyde for pathological staining to record cardiac fibrosis indexes and observe the changes in cardiac structure after inhibiting the activity of GOF PIEZO1. As Figure 5 shown in (C) therein and Figure 5 shown in (D) therein, the degree of cardiac fibrosis decreased after inhibiting the activity of GOF PIEZO1. Fresh mouse heart tissues were collected and frozen sections of the heart were prepared simultaneously. Oil red staining and electron microscopy experiments were performed to detect the lipid metabolism of the mouse heart. As Figure 5 shown in (E) therein, after inhibiting the activity of GOF PIEZO1, the lipid deposition in the hearts of transgenic mice was improved. The above shows that targeting the GOF PIEZO1 protein and regulating its activity level confirm that inhibiting the activity of the GOF PIEZO1 protein can regulate cardiac lipid deposition and then play a beneficial effect in the treatment of primary cardiomyopathy.

[0083] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and are not restrictive. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. A method for constructing an animal model of primary cardiomyopathy, characterized in that, Comprising the following steps: S1. Modify the genome of a mouse single-cell embryo so that a point mutation occurs in the PIEZO1 gene in the genome of the mouse single-cell embryo; S2. Select the gene-modified mouse single-cell embryo in which a point mutation occurs in the PIEZO1 gene in the genome of the mouse single-cell embryo; S3. Implant the gene-modified mouse single-cell embryo into a surrogate mother to obtain a founder mouse with the point mutation; Wherein, the gene number of PIEZO1 is 234839; the point mutation site is located at position 123224720 on the antisense strand of chromosome 8 of the mouse reference genome, and the nucleotide base at this site is G or T.

2. The method for constructing an animal model of primary cardiomyopathy according to claim 1, wherein The construction method further includes step S4: obtaining the F1 generation of gene point mutation heterozygous mice by crossing the founder mouse in step S3 with a wild-type mouse.

3. The method for constructing an animal model of primary cardiomyopathy according to claim 2, characterized in that, After obtaining the F1 generation of heterozygous mice with gene mutations, perform DNA sequencing to confirm that a point mutation occurs in the target gene; the nucleotide sequences of the sequencing primers are as shown in SEQ ID NO.8-9.

4. The method for constructing an animal model of primary cardiomyopathy according to claim 1, characterized in that, The modification method is the CRISPR / Cas9 technology, zinc finger nuclease technology or transcription activator-like effector nuclease technology.

5. The method for constructing an animal model of primary cardiomyopathy according to claim 1, characterized in that, Step S1 includes introducing into the mouse single-cell embryo: (i) A nuclease reagent targeting the 16th exon of the PIEZO1 gene or a nucleotide molecule encoding the nuclease reagent; And (ii) a targeting vector containing donor DNA with a point mutation, the donor DNA containing a 5' homologous arm corresponding to the 5' targeting sequence of the 16th exon of the PIEZO1 gene and a 3' homologous arm corresponding to the 3' targeting sequence of the 16th exon of the PIEZO1 gene; Wherein, the nucleotide sequence of the donor DNA is as shown in SEQ ID NO.

2.

6. The method for constructing an animal model of primary cardiomyopathy according to claim 5, characterized in that, The nuclease reagent includes Cas9 nuclease and guide RNA.

7. The method for constructing an animal model of primary cardiomyopathy according to claim 6, wherein, The Cas9 nuclease is Cas9nickase mRNA.

8. The method for constructing an animal model of primary cardiomyopathy according to claim 6, characterized in that, The nucleotide sequence of the guide RNA is as shown in SEQ ID NO.5-6.

9. The method for constructing an animal model of primary cardiomyopathy according to claim 5, wherein The nucleotide sequence of the targeting vector is as shown in SEQ ID NO.

7.

10. Use of the model mouse obtained by the construction method of the animal model of primary cardiomyopathy according to any one of claims 1-9 in screening drugs for treating primary cardiomyopathy.

Images