Preparation method and application of tumor microenvironment responsive cascade targeted small activating nucleic acid nanodrug
By modifying M2-type TAM targeting peptides and acid-sensitive liposomes on nucleic acid drug carriers, tumor microenvironment-responsive cascade targeted delivery was achieved, solving the problem of nucleic acid drug carriers being phagocytosed in the blood circulation, successfully reprogramming the TAM phenotype, activating anti-tumor immune responses, and inhibiting tumor growth.
Patent Information
- Application Number
- CN202510490451.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-18
- Publication Date
- 2025-10-17
- Estimated Expiration
- 2045-04-18
AI Technical Summary
Existing nucleic acid drug carriers are easily recognized and engulfed by the endothelial reticular system in the blood circulation, resulting in nonspecific clearance and inefficient delivery, making it difficult to effectively target tumor-associated macrophages, thus affecting the efficacy of gene therapy.
The dendrimer macromolecule PAMAM modified with the M2 TAM targeting peptide CRVLRSGSC was loaded with small activating RNAs of p38 and TFEB and encapsulated with acid-sensitive liposomes to form a tumor microenvironment-responsive cascade-targeted small activating nucleic acid nanodrug, which destroyed the lysosomal structure by the proton sponge effect, entered the cytoplasm and released sa-p38 and sa-TFEB, reprogramming M2 TAM to M1 type.
It achieves tumor microenvironment-responsive targeted delivery, effectively reprograms TAM phenotype and metabolic patterns, activates anti-tumor immune responses, inhibits tumor growth and reshapes the immune microenvironment.
Smart Images

Figure CN120324344B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biological medicine, and particularly relates to a preparation method of a tumor microenvironment responsive cascade targeted small activating RNA nanodrug and application thereof. BACKGROUND
[0002] Malignant tumors seriously threaten human health. Immunotherapy is a new tumor treatment strategy, which mainly reactivates immune cells in the tumor microenvironment, overcomes immune suppression, and thus plays an anti-tumor role, including adoptive cell therapy, monoclonal antibodies, immune checkpoint inhibitors, cytokines, and immune adjuvants. However, the large number of tumor-associated macrophages (TAM) in the tumor microenvironment has resulted in the failure of immunotherapy to achieve the desired effect. TAMs exist in large numbers in the tumor microenvironment, promote tumor growth, invasion, migration, metastasis, angiogenesis, and inhibit anti-tumor immune responses. However, the polarization of TAMs is reversible and adjustable, and reprogramming TAMs from the M2 phenotype to the M1 phenotype with anti-tumor effects can also achieve tumor inhibition. TAM reprogramming not only avoids the side effects that may be caused by the sudden destruction of cell numbers to disrupt the balance of the tumor microenvironment, but also activates the anti-tumor effects of M1 phenotype TAMs, reshapes the tumor microenvironment, and improves the effectiveness of tumor immunotherapy.
[0003] Gene therapy is a new treatment method that achieves the replacement, substitution, knock-in / knock-out, activation / inhibition, and other changes of in vivo genes at the gene level by introducing external genes to treat diseases. Small activating RNA (saRNA) is a new type of gene therapy drug that can stimulate gene expression at the transcriptional level, has a small molecular weight, is gene-specific, and activates gene expression. Studies have shown that upregulating p38 to promote its phosphorylation can reprogram M2-type TAMs to M1-type TAMs. Upregulating transcription factor EB (TFEB) can reprogram the metabolic mode of TAMs from oxidative phosphorylation to aerobic glycolysis.
[0004] Like most nucleic acid drugs, saRNA needs an appropriate nucleic acid delivery carrier to achieve maximum efficacy. Nucleic acid delivery carriers need to cross multiple barriers to reach cells to exert therapeutic effects, such as phagocytosis by the endothelial reticular system in the blood circulation, tissue and cell targeting, cell membrane barrier, lysosomal phagocytosis, etc. Dendritic macromolecule polyamidoamine (PAMAM) is a commonly used nucleic acid drug carrier, which contains a large number of primary amine groups, can buffer the acidic environment in lysosomes, and can escape lysosomes by proton sponge effect; it can also be used for the connection of targeting peptides, so as to realize tissue or cell targeting. However, PAMAM as a foreign substance is easily recognized and phagocytosed by the endothelial reticular system during blood circulation, resulting in inefficient or even ineffective gene therapy. How to reduce the non-specific clearance of nucleic acid drug carriers and improve their tissue / cell targeting is a hot and difficult point of nucleic acid drug delivery. SUMMARY
[0005] The present application uses M2 TAM targeting peptide CRVLRSGSC modified dendritic macromolecule PAMAM to co-load p38 and TFEB small activating RNA (sa-p38, sa-TFEB), and uses acid-sensitive liposomes to encapsulate and protect the above complex (CRV-PAMAM / saRNA) to prepare a tumor microenvironment-responsive cascade targeting small activating nucleic acid nanodrug. The drug is effective for in situ solid tumors except brain tumors. The liposome on the outer layer of the tumor microenvironment-responsive cascade targeting small activating nucleic acid nanodrug swells and disintegrates in the weakly acidic tumor microenvironment, and the small activating nucleic acid nanocomplex CRV-PAMAM / saRNA inside is exposed and enters M2 TAM under the mediation of CRVLRSGSC targeting peptide. CRV-PAMAM has a proton sponge effect to destroy the structure of lysosomes, and then enters the cytoplasm and releases sa-p38 and sa-TFEB, up-regulates the expression of p38 and TFEB, promotes p38 phosphorylation and TFEB nuclear translocation, reprograms the phenotype and metabolic mode of M2 TAM to M1 TAM, thereby killing tumor cells, remodeling the tumor immune microenvironment, and finally inhibiting tumor growth or even ablating tumors.
[0006] The present application provides a preparation method of a tumor microenvironment-responsive cascade targeting small activating nucleic acid nanodrug, which comprises the following steps:
[0007] (1) dilute G4.0 PAMAM solution with PBS to 0.08-0.12 mM, weigh 3.5-4.0 mg sulfo-GMBS to dissolve in 0.8-1.2 mL PBS to make a solution, and add it to the above PAMAM solution, mix well, react at room temperature for 25-35 min, remove unbound GMBS; add CRVLRSGSC to the reaction solution of the previous step according to a grafting degree of 4-6%, stir and react at 3-5°C for 110-130 min; remove unbound CRVLRSGSC, and thus CRV-PAMAM is prepared;
[0008] (2) add 25-35 μg saRNA to 90-110 μL nuclease-free water, add 80-85 μL nuclease-free water and 15-20 μL CRV-PAMAM solution to another tube, the mass ratio of saRNA to CRV-PAMAM is 5-7, mix the two tubes, and incubate at room temperature for 25-35 min to prepare CPS;
[0009] The saRNA is a mixture of sa-p38-5 and sa-TFEB-1, and the mass ratio of sa-p38-5 to sa-TFEB-1 is 1.5-2.5:0.5-1.5, the sequence of the sense and antisense strands of sa-p38-5 is shown in SEQ ID NO. 9-10, and the sequence of the sense and antisense strands of sa-TFEB-1 is shown in SEQ ID NO. 13-14;
[0010] The concentration of the CRV-PAMAM solution is 8-12 μg / μL;
[0011] (3) dipalmitoyl phosphatidylcholine, cholesterol, and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) are dissolved in an organic solvent according to a molar ratio of 1.5-2.5:0.5-1.5:0.3-0.5, the organic solvent is removed by rotary evaporation, CPS is added to the aqueous phase, the mass ratio of the total of dipalmitoyl phosphatidylcholine, cholesterol, and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) to CPS is 8-12:0.8-1.2, and the solution is hydrated in a water bath at 40-45°C until the lipid film disappears completely, and the complex solution is sequentially filtered through filter membranes with pore sizes of 400 nm and 200 nm, and PLCPS is collected by centrifugation.
[0012] Preferably, in step (1), G4.0 PAMAM solution is diluted with PBS to 0.1 mM, and 3.82 mg sulfo-GMBS is weighed to dissolve in 1 mL PBS to make a solution.
[0013] More preferably, in step (1), CRVLRSGSC is added to the reaction solution of the previous step according to a grafting degree of 5%.
[0014] More preferably, in the step (2), 30 ug of saRNA is added to 100 uL of nuclease-free water, and in another tube, 82 uL of nuclease-free water and 18 uL of CRV-PAMAM solution with a concentration of 10 ug / uL are added.
[0015] More preferably, in the step (2), the mass ratio of sa-p38-5 to sa-TFEB-1 is 2:1.
[0016] More preferably, in the step (3), the molar ratio of dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) is 2:1:0.4.
[0017] More preferably, in the step (3), the mass ratio of the sum of dipalmitoyl phosphatidylcholine, cholesterol and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) to CPS is 10:1.
[0018] The application also provides a tumor microenvironment-responsive cascade-targeting small activating RNA nanodrug prepared by the above preparation method.
[0019] The application also provides the use of the above tumor microenvironment-responsive cascade-targeting small activating RNA nanodrug in the preparation of a product for treating solid tumors, including breast cancer, lung cancer, colorectal cancer, hepatocellular carcinoma, pancreatic cancer, gastric cancer, etc.
[0020] Compared with the prior art, the application has the following beneficial effects:
[0021] After the tumor microenvironment-responsive cascade-targeting small activating RNA nanodrug of the application is passively targeted to tumor tissue, it responds to the weak acidic microenvironment, the liposome coat swells and disintegrates, exposing the internal small activating RNA nanocomplex targeting tumor-associated macrophages, which enters the cell through receptor recognition, and then the small activating RNA nanocomplex releases small activating RNA, regulates the expression of genes, reprograms M2-type tumor-associated macrophages into M1-type from two aspects of phenotype and metabolic mode, kills tumor cells, reshapes the tumor immunosuppressive microenvironment, and achieves the purpose of inhibiting tumor progression. Therefore, the application provides a new way for the treatment of tumors. BRIEF DESCRIPTION OF DRAWINGS
[0022] Figure 1 A) q-PCR method for detecting p38 mRNA expression level; B) q-PCR method for detecting TFEB mRNA expression level.
[0023] Figure 2A) Confocal laser scanning microscope observation of cell uptake of CPS with different grafting degrees, scale = 200 pm; B) Flow cytometry detection of the average fluorescence intensity of CPS with different grafting degrees in cells; C) Agarose gel detection of the saRNA blocking ability of different mass ratios of PS and CPS; D) Agarose gel detection of the encapsulation of different mass ratios of CPS; E) Comparison of the encapsulation rates of different mass ratios of CPS; F) Anti-nuclease degradation ability of PS and CPS; G) Particle size distribution and morphology of mass ratio = 6 CPS.
[0024] Figure 3 A) Schematic diagram of the acid response of PLCPS; B) Electron microscope image of PL in a pH 5.4 environment, scale = 200 nm; C) Comparison of particle sizes of CPS, PL, PLCPS, and PLCPS 5.4; D) Comparison of potentials of CPS, PL, PLCPS, and PLCPS 5.4; E) Comparison of morphologies of CPS, PL, PLCPS, and PLCPS 5.4, scale = 200 nm; F) Drug release curve of PLCPS under different pH conditions.
[0025] Figure 4 A) Confocal laser scanning microscope observation of cell uptake of different formulations, scale = 200 pm; B) Flow cytometry detection of the average fluorescence intensity of Cy5-saRNA in cells of different formulations; C) Flow cytometry detection of the average fluorescence intensity of Cy3-saRNA in cells of different formulations; D) Flow cytometry detection of the average fluorescence intensity of PLCPS in different cells; E) Flow cytometry detection of the average fluorescence intensity of PLCPS in different treated cells; F) Confocal laser scanning microscope observation of lysosome escape of PLCPS, scale = 200 pm; G) Confocal laser scanning microscope observation of cell viability of macrophages transfected with different formulations, scale = 200 pm; H) Western blotting detection of protein expression of macrophages transfected with different formulations.
[0026] Figure 5 A) Small animal live imaging observation of the distribution and metabolism of different formulations in tumor-bearing mice; B) Small animal live imaging observation of the distribution of different formulations in the main organs of tumor-bearing mice; C) Comparison of the fluorescence signals of different formulations in tumor-bearing mice; D) Flow cytometry analysis of the co-localization of Cy7-saRNA and tumor-associated macrophages.
[0027] Figure 6 A) Schematic diagram of the animal treatment process; B) Photograph of the tumor of tumor-bearing mice; C) Tumor volume change curve of tumor-bearing mice; D) Body weight change curve of tumor-bearing mice; E) TUNEL immunofluorescence staining, Ki67 immunohistochemical staining, hematoxylin / eosin staining of tumor tissue, scale = 100 pm; F) Comparison of the TUNEL positive area of tumor tissue; G) Comparison result of the Ki67 positive area of tumor tissue.
[0028] Figure 7 This is a technical concept diagram of the present invention. DETAILED DESCRIPTION
[0029] Example 1
[0030] 1. Methods
[0031] 1saRNA sequence screening
[0032] RAW 264.7 cells were induced to become M2 macrophages using IL-4. saRNA and PEI were mixed at a 2:1 mass ratio, vortexed for 15 seconds, and allowed to stand for 15 minutes. The complex was incubated with cells for 8 hours, the culture medium was discarded, and fresh complete culture medium was added for a further 48 hours. Cellular RNA was extracted, reverse-transcribed, and q-PCR was used to analyze p38 and TFEB mRNA expression levels to screen for effective saRNA sequences.
[0033] sa-p38-1
[0034] Sense(SEQ ID NO.1):5'-TGCGACCACAGAGAGGCGC-3';
[0035] anti sense (SEQ ID NO.2):5'-GCGCCUCUCUGUGGUCGCA-3';
[0036] sa-p38-2
[0037] sense(SEQ ID NO.3):5'-CTTCCCCGACGCTGTCACA-3';
[0038] anti sense (SEQ ID NO.4):5'-UGUGACAGCGUCGGGGAAG-3';
[0039] sa-p38-3
[0040] sense(SEQ ID NO.5):5'-TCGCCCGTGCGACCACAGA-3';
[0041] anti sense (SEQ ID NO.6):5'-UCUGUGGUCGCACGGGCGA-3';
[0042] sa-p38-4
[0043] sense(SEQ ID NO.7):5'-AAAATACCGACTTTATCTC-3';
[0044] sense (SEQ ID NO. 7): 5'-GAGAUAAAGUCGGUAUUUU-3';
[0045] sa-p38-5
[0046] sense (SEQ ID NO. 9): 5'-TCACAGCGGCTTTCCGCCA-3';
[0047] anti sense (SEQ ID NO. 10): 5'-UGGCGGAAAGCCGCUGUGA-3';
[0048] sa-p38-6
[0049] sense (SEQ ID NO. 11): 5'-GGGACCACGGTGCCAGCTT-3';
[0050] anti sense (SEQ ID NO. 12): 5'-AAGCUGGCACCGUGGUCCC-3';
[0051] sa-TFEB-1
[0052] sense (SEQ ID NO. 13): 5'-GATGTGGATGTGACAGCGA-3';
[0053] anti sense (SEQ ID NO. 14): 5'-UCGCUGUCACAUCCUCAUC-3';
[0054] sa-TFEB-2
[0055] sense (SEQ ID NO. 15): 5'-GCTACTGTGAGCAGATGGT-3';
[0056] anti sense (SEQ ID NO. 16): 5'-ACCAUCUGCUCACAGUAGC-3';
[0057] sa-TFEB-3
[0058] sense (SEQ ID NO. 17): 5'-GAGGGAGTCCGAGGCCCGA-3';
[0059] anti sense (SEQ ID NO. 18): 5'-UCGGGCCUCGGACUCCCUC-3';
[0060] sa-TFEB-4
[0061] sense (SEQ ID NO. 19): 5'-TGCAGGCACCAAGGCCGGC-3';
[0062] anti sense (SEQ ID NO. 20): 5'-UCGCUGUCACAUCCUCAUC-3';
[0063] sa-TFEB-5
[0064] sense (SEQ ID NO. 21): 5'-GGCACAGCGGTAGGCCTAT-3';
[0065] anti sense (SEQ ID NO. 22): 5'-AUAGGCCUACCGCUGUGCC-3';
[0066] sa-TFEB-6
[0067] sense (SEQ ID NO. 23): 5'-AATTGACTCCTAGGGAACA-3';
[0068] anti sense (SEQ ID NO. 24): 5'-UGUUCCCUAGGAGUCAAUU-3';
[0069] p38 primer
[0070] Forward (SEQ ID NO. 25): TGACCCTTATGACCAGTCCTTT;
[0071] Reverse (SEQ ID NO. 26): GTCAGGCTCTTCCACTCATCTAT;
[0072] TFEB primer
[0073] Forward (SEQ ID NO. 27): CCACCCCAGCCATCAACAC;
[0074] Reverse (SEQ ID NO. 28): CAGACAGATACTCCCGAACCTT;
[0075] 2CPS preparation and characterization
[0076] 2.1 CRV-PAMAM synthesis
[0077] Take the appropriate amount of G4.0 PAMAM solution, add the appropriate amount of PBS dilution to 0.1 mM. Weigh 3.82 mg sulfo-GMBS into 1 mL PBS to make a 10 mM solution and quickly add to the PAMAM solution and mix well, stir at room temperature for 30 min; 3kDa ultrafiltration tube to remove unbound GMBS. CRVLRSGSC (referred to as CRV) is added to the reaction solution of the above step according to the grafting degree of 5%, 15%, 25%, 35%, respectively, and stirred at 4°C for 120 min; 3kDa ultrafiltration tube to remove unbound CRV, freeze-dry the reaction product and reconstitute with water. Scan the ultraviolet absorption spectrum of PAMAM, CRV, CRV-PAMAM (referred to as CP) to analyze whether CRV-PAMAM is successfully prepared.
[0078] The above G4.0 PAMAM contains 64 amino groups, and the CRV polypeptide contains 1 thiol group. The amino and thiol groups react in a 1:1 ratio. 5% of the amino groups are used for thiol reaction, which is a 5% grafting degree.
[0079] 2.2 Grafting degree screening
[0080] RAW 264.7 cells are induced into M2 type macrophages using IL4. Cy5-sa-p38 and Cy3-sa-TFEB are used to synthesize PS (i.e. PAMAM / saRNA), 5% CPS, 15% CPS, 25% CPS, and 35% CPS according to a mass ratio of 6. After co-incubation of CPS with M2 type macrophages for 8 hours, the intracellular fluorescence intensity is detected using a flow cytometer, or the fluorescence distribution in the cells is observed using a confocal laser microscope. The above mass ratio of 6 refers to the ratio of the sum of sa-p38 and sa-TFEB to CP. The mass ratio of sa-p38 and sa-TFEB is 2:1.
[0081] 2.3 CPS mass ratio screening
[0082] Take sa-p38 1 μg and sa-TFEB 0.5 μg and dilute in 10 μL nuclease-free water. In another tube, add CP with a grafting degree of 5% according to the mass ratio of saRNA (sa-p38 and sa-TFEB) to CP of 0.75, 1.5, 3, 6, 9, 12, and 15, and add an appropriate amount of nuclease-free water to 10 μL. Mix the two tubes by vortexing for 15 seconds, and incubate at room temperature for 30 minutes to prepare CRV-PAMAM / saRNA (referred to as CPS). Take 20 μL of the complex solution, add 10*Loading buffer and mix well, then load onto a 1% agarose gel and run at 100V for 30 min. Take a photo with a gel imager and save it. Analyze the loading and blocking ability of CPS with different mass ratios to saRNA.
[0083] Take sa-p386 μg and sa-TFEB 3 μg diluted in 50 μL of nuclease-free water, another tube according to the mass ratio of saRNA total to CP 0.75, 1.5, 3, 6, 9, 12, 15, respectively, add CP with a grafting degree of 5%, and add an appropriate amount of nuclease-free water to 50 μL, mix the two tubes after vortexing for 15 s, and incubate at room temperature for 30 min to prepare CRV-PAMAM / saRNA (referred to as CPS). The CPS solution was centrifuged at 12,000 rpm for 30 min at 4°C, 20 μL of supernatant was taken, mixed with 10*Loading buffer, and then loaded onto a 1% agarose gel and electrophoresed at 100 V for 30 min. The gel was imaged and saved, and the encapsulation efficiency and drug loading rate were calculated.
[0084] 3. Preparation and characterization of PLCPS
[0085] 3.1 Synthesis of PLCPS
[0086] Dipalmitoyl phosphatidylcholine, cholesterol, and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) were dissolved in ethanol at a molar ratio of 2:1:0.4, and the organic solvent was removed by rotary evaporation. CPS complex (three lipids:CPS complex = 10:1, w / w) was added to the aqueous phase, and the lipid film was completely disappeared after hydration at 42°C water bath for 30 min. The complex solution was sequentially passed through polycarbonate filters with pore sizes of 400 nm and 200 nm, centrifuged at 12,000 rpm for 15 min at 4°C, and PLCPS was collected.
[0087] 3.2 pH responsiveness
[0088] Dipalmitoyl phosphatidylcholine (DPPC), cholesterol, and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) (DSPE-PEOz) were dissolved in ethanol at a molar ratio of 2:1:0.4, and the organic solvent was removed by rotary evaporation. Double distilled water was added, and the lipid film was completely disappeared after hydration at 42°C water bath for 30 min. The complex solution was sequentially passed through polycarbonate filters with pore sizes of 400 nm and 200 nm, centrifuged at 12,000 rpm for 15 min at 4°C, and acid-sensitive liposome PEOz-Liposome (referred to as PL) was collected. PL was resuspended with pH 5.4 PBS buffer solution, and 10 μL was taken at 0, 3, 6, 12 h and dropped on a carbon-coated copper grid. After complete drying, phosphotungstic acid was used for negative staining, and the morphology of PL was observed by transmission electron microscopy.
[0089] PLCPS was diluted in pH 7.4 and pH 5.4 PBS buffer solutions, respectively, and incubated for 6 h. The particle size and potential of the appropriate amount of solution were determined and compared with CPS and PL.
[0090] PLCPS was diluted in pH 7.4 and pH 5.4 PBS buffer solution for 6h, 10μL was dropped on the carbon-coated copper grid, and then negatively stained with phosphotungstic acid. The morphology was observed by transmission electron microscopy and compared with that of CPS and PL.
[0091] 3.3 Drug release
[0092] PLCPS was prepared with fluorescently labeled saRNA and loaded into dialysis bags with a molecular weight cutoff of 3500. The dialysis bags were placed in pH 5.4 and pH 7.4 PBS buffer solutions, respectively. Dialysate was taken at 1, 2, 3, 4, 5, 6, 8, 12, 24, 48, and 72h. The fluorescence intensity was measured by fluorescence spectrophotometry, and the cumulative drug release rate was calculated.
[0093] 4. Macrophage reprogramming mediated by PLCPS
[0094] 4.1 Cell uptake
[0095] PLCPS was prepared with fluorescently labeled saRNA. M2 macrophages were cultured in 6-well plates overnight, and then PBS, saRNA (Cy5-sa-p381.6μg, Cy3-sa-TFEB 0.8μg), PS, CPS, PLCPS, and PLCPS+1mL pH 6.5 (i.e., PLCPS was incubated with cells in pH 6.5 DMEM medium) were added to each well, each containing Cy5-sa-p381.6μg and Cy3-sa-TFEB 0.8μg. The first five groups were supplemented with pH 7.4 DMEM medium to a final volume of 1mL. After 8h of incubation, cell uptake of different preparations was detected by flow cytometry and laser confocal fluorescence microscopy.
[0096] 4.2 Cell-specific uptake
[0097] Mouse alveolar epithelial cells (MLE12), mouse embryonic fibroblasts (NIH 3T3), and mouse Lewis lung cancer cells (LLC) were cultured overnight, and then the culture medium was replaced with pH 6.5 high-glucose DMEM. The cells were incubated with PLCPS containing equal amounts of fluorescently labeled saRNA for 8h. Cell uptake was detected by flow cytometry and confocal fluorescence microscopy.
[0098] 4.3 Cell uptake mechanism
[0099] M2 macrophages were cultured overnight and then pretreated with low temperature (4℃), amiloride (200μg / mL), genistein (50μg / mL), and chlorpromazine (5μg / mL) for 4h. The cells were then incubated with fluorescently labeled CPS for 8h. Cell uptake under different treatment conditions was detected by flow cytometry to analyze the mechanism of CPS entering cells.
[0100] 4.4 lysosomal escape
[0101] M2 macrophages were cultured overnight, and then equal amount of fluorescently labeled PLCPS was added and incubated for 3h and 12h, respectively. Cells were washed twice with PBS, and then incubated with green lysosome probe (Yisheng LysoTracker Green DND-26 lysosome green fluorescent probe, item number 40738ES50). Laser confocal microscope was used to observe the lysosomal escape of nanoparticles in cells.
[0102] 4.5 cytotoxicity
[0103] M2 macrophages were cultured overnight in confocal dishes, and then treated with PBS, saRNA, PS, CPS, PLCPS, and PLCPS6.5 (i.e., PLCPS was incubated with cells in pH 6.5 DMEM medium) for 8h. Then the medium was replaced, and each well contained Cy5-sa-p38 1.6μg and Cy3-sa-TFEB 0.8μg. The first five groups were cultured in pH 7.4 DMEM medium, and the culture was continued for 48h. Cell viability was determined by using cell live / dead staining kit, and laser confocal microscope was used to observe the live / dead status of cells, and analyze the cytotoxicity of different preparations.
[0104] 4.6 reprogramming efficiency of macrophages
[0105] M2 macrophages were cultured overnight, and then treated with PBS, saRNA, PS, CPS, PLCPS, and PLCPS+pH6.5 (i.e., PLCPS was incubated with cells in pH 6.5 DMEM medium) for 8h. Then the medium was replaced, and each well contained Cy5-sa-p38 1.6μg and Cy3-sa-TFEB 0.8μg. The first five groups were cultured in pH 7.4 DMEM medium, and the culture was continued for 48h. Cells were lysed by RIPA lysis buffer, and total protein was extracted. Western blot was used to analyze the expression levels of iNOS, Arg1, TFEB, p38, and p-p38, and evaluate the reprogramming efficiency of PLCPS.
[0106] 5 in vivo anti-tumor effect of PLCPS
[0107] 5.1 in vivo distribution
[0108] PLCPS was prepared using Cy7-saRNA, and the specific process was as follows:
[0109] (1) G4.0 PAMAM solution was diluted to 0.1 mM with PBS, 3.82 mg sulfo-GMBS was dissolved in 1 mL PBS to make a 10 mM solution, and then quickly added to the PAMAM solution, mixed well, and stirred at room temperature for 30 min. The unbound GMBS was removed. CRVLRSGSC was added to the reaction solution in the previous step according to a grafting degree of 5%, and stirred at 4°C for 120 min. The unbound CRVLRSGSC was removed, and CRV-PAMAM was prepared.
[0110] (2) 30 μg Cy7-saRNA (sa-p38-5 and sa-TFEB-1 in a mass ratio of 2:1) was added to 100 μL nuclease-free water, and another tube was added with 82 μL nuclease-free water and 18 μL CRV-PAMAM (10 μg / μL), with a mass ratio of saRNA to CRV-PAMAM of 6. After vortexing for 15 s, the two tubes were mixed and incubated at room temperature for 30 min to prepare CPS.
[0111] (3) Dipalmitoyl phosphatidylcholine, cholesterol, and distearoyl phosphatidyl ethanolamine-poly(2-ethyl-2-oxazoline) were dissolved in ethanol according to a molar ratio of 2:1:0.4, and the organic solvent was removed by rotary evaporation. CPS was added to the water phase (lipid:CPS complex = 10:1, w / w), and the solution was hydrated at 42°C for 30 min until the lipid film completely disappeared. The complex solution was sequentially passed through polycarbonate filters with pore sizes of 400 nm and 200 nm, and centrifuged at 4°C at 12000 rpm for 15 min. PLCPS was collected.
[0112] C57BL / 6J mice were subcutaneously injected with 3×10 6 LLC cells in the right axillary, and a subcutaneous tumor model was established. When the tumor volume reached 100 mm 3 PBS, saRNA, PS, CPS, and PLCPS, respectively, were injected into the tail vein of each mouse at a dose of 200 μL, and Cy7-saRNA was injected at a dose of 30 μg per mouse, with a mass ratio of sa-p38 to sa-TFEB of 2:1. At 2, 4, 8, 12, 24, and 48 h after injection, the mice were imaged using a small animal imaging system to observe the distribution and metabolism of PLCPS in vivo. At 48 h after injection, the mice were dissected to collect the heart, liver, spleen, lung, kidney, and tumor, and the distribution of PLCPS in each organ was observed by imaging. The tumor tissue was digested to prepare a single cell suspension, which was incubated with AF647-CD206 antibody on ice, and the co-localization of Cy7-saRNA and AF-647-CD206 + tumor-associated macrophages was analyzed by flow cytometry.
[0113] 5.3 Tumor inhibition
[0114] When the tumor volume reaches 100 mm 3 Mice were randomly divided into five groups: PBS, saRNA, PS, CPS, and PLCPS. Each group received 200 μL of the above drugs, each containing 30 μg of saRNA (sa-p38: saTFEB = 20 μg: 10 μg) via the tail vein. Tumor volume and body weight were measured every two days, and mice were dissected five days after the last dose. Tumor tissues were photographed and weighed, and then fixed with 4% paraformaldehyde and sectioned. Tumor cell death was detected by TUNEL staining, and cell proliferation was detected by Ki67 staining.
[0115] 2. Results
[0116] q-PCR screening of sa-p38 and sa-TFEB sequences revealed that sa-p38-5 upregulated p38 mRNA levels, which was significantly different from the other sequences ( Figure 1 A), sa-TFEB-1 significantly upregulated TFEB mRNA levels ( Figure 1 B), therefore, sa-p38-5 and sa-TFEB-1 were screened as saRNA sequences for p38 and TFEB, and sa-p38-5 and sa-TFEB-1 were used in subsequent experiments.
[0117] Laser confocal microscopy was used to observe the uptake of CPS with different grafting degrees by M2 macrophages. Obvious green fluorescence and red fluorescence were observed in the PS-treated cells. As the grafting degree of CRVLRSGSC increased, the fluorescence in the cells weakened ( Figure 2 A). Flow cytometry was used to quantitatively analyze the intracellular fluorescence signal. The average intracellular fluorescence intensity of 15% CPS, 25% CPS, and 35% CPS was significantly lower than that of PS, while 5% CPS showed no significant decrease ( Figure 2 B), so 5% CRVLRSGSC grafting degree was selected to synthesize CPS. When the CPS mass ratio was 6, saRNA was completely blocked in the sample well ( Figure 2 C), indicating that saRNA can be fully loaded at this time, and the encapsulation efficiency is close to 100% ( Figure 2 D and 2E). saRNA was completely degraded after 15 minutes of co-incubation with nuclease, while PS and CPS still effectively protected saRNA after 60 minutes of co-incubation ( Figure 2 F). Based on the above results, the mass ratio was 6 to prepare CPS. The CPS particle size was 140.0±4.30nm, the potential was 19.1±1.3mV, and it was quasi-round ( Figure 2 G).
[0118] The acid-sensitive liposome (PEOz-Liposome, PL) gradually increased in size in a pH 5.4 environment, and the structure of the liposome disappeared after 12 h, indicating that it had completely disintegrated Figure 3 B), indicating that the PL was acid-sensitive. The size of the PL was 106 ± 4.9 nm, the size of the PLCPS was 175.5 ± 12.2 nm, and the size of the PLCPS 5.4 was 131.6 ± 14.6 nm after being placed in a pH 5.4 PBS buffer for 6 h Figure 3 C). The PL was negatively charged, the PLCPS was similarly negatively charged as the PL, and the PLCPS 5.4 was positively charged, similar to the CPS Figure 3 D). The changes in the size and potential indicated that the PL successfully encapsulated the CPS and degraded in an acidic environment to free the CPS. The CPS was a circular nanoparticle, the PL had a clear liposome morphology, and the electron microscope image of the PLCPS showed that there were circular particles in the liposome cavity, further indicating that the PLCPS was successfully prepared. The PLCPS 5.4 did not show a liposome structure, and the circular nanoparticles were visible Figure 3 E). The cumulative release of the PLCPS in a pH 5.4 environment was more than 90% after 72 h, and the cumulative release in a pH 7.4 environment was less than 50% Figure 3 F).
[0119] The CPS showed a strong fluorescence signal in M2 macrophages, the PLCPS was negatively charged, so the fluorescence signal in the cells was weak, and the PLCPS (PLCPS 6.5) that was co-incubated with the cells in a pH 6.5 environment had a strong fluorescence signal Figure 4 A). Comparison of the average fluorescence intensity in the cells showed that there was no significant difference between the PLCPS 6.5 and the CPS group, but there was a significant difference between the PLCPS 6.5 and the PLCPS Figure 4 B, 4C). The PLCPS was co-incubated with mouse alveolar epithelial cells (MLE12), mouse embryonic fibroblasts (NIH 3T3), and mouse lewis lung cancer cells (LLC), and the average fluorescence intensity in the above cells was weaker than that in the M2 macrophages, and there was a significant difference Figure 4 D). The mechanism of the entry of the CPS into the cells was studied, and it was found that the average fluorescence intensity in the cells that were pretreated with low temperature, amiloride, and genistein was significantly different from that in the untreated cells, but there was no significant difference in the chlorpromazine treatment group Figure 4 E), indicating that the CPS entered the cells through energy-dependent endocytosis, macropinocytosis, and caveolin-mediated endocytosis. The fluorescence signal of the PLCPS co-incubated with the cells for 3 h overlapped with the blue fluorescence signal of the lysosomes, indicating that the PLCPS was captured by the lysosomes at this time, and the fluorescence signal of the PLCPS was separated from the lysosome fluorescence signal after 12 h, and the lysosome fluorescence signal was weakened, indicating that the PLCPS escaped the lysosomes at this time Figure 4F) M2 macrophages transfected with PLCPS for 48 h still showed positive signals of calcein Figure 4 G), indicating that PLCPS had low cytotoxicity. After M2 macrophages were transfected with PLCPS, p38 phosphorylation increased, TFEB expression was up-regulated, M2 macrophage marker protein Arg1 decreased, and M1 macrophage marker iNOS increased Figure 4 H), indicating that PLCPS effectively reprogrammed M2 macrophages by up-regulating the p38 and TFEB pathways.
[0120] After PLCPS was injected into tumor-bearing mice via the tail vein, it gradually accumulated in the tumor site, and the signal was strongest at 4 h, and still had a strong fluorescent signal after 48 h Figure 5 A) After 48 h, the mice were sacrificed, and the main internal organs and tumor tissues were removed and imaged again. The fluorescence was distributed in the liver, spleen, lung and tumor tissue Figure 5 B) The fluorescence of the PLCPS group at the tumor site was the strongest among the groups Figure 5 C) The above results showed that PLCPS effectively targeted the tumor site and prolonged the circulation time in vivo. After the tumor tissue was prepared into a single cell suspension, the tumor-associated macrophages were stained and labeled with AF647-CD206 antibody. The double positive cell rate of Cy7-saRNA and AF647-CD206 in the PS group was only 8.22%, while the double positive rate of cells in the CPS group was 16.1%, and the double positive rate of cells in the PLCPS group was as high as 23.4% Figure 5 D), indicating that acid-sensitive liposomes and CRVLRSGSC could enhance the tumor targeting of small active nucleic acid nanomedicines through weakly acidic tumor microenvironment response and cascade polypeptide active targeting.
[0121] Tumor-bearing mice were administered every 3 days via the tail vein, and the mice were dissected 5 days after the last administration Figure 6 A) The saRNA group had almost no therapeutic effect Figure 6 B), the PLCPS group had the smallest tumor volume and showed the strongest tumor inhibition effect Figure 6 B and 6C). During the entire treatment process, the body weight of mice in each group did not change significantly Figure 6 D), indicating that PLCPS had biological safety. The tumor tissue of PLCPS-treated mice had pyknosis Figure 6 E), TUNEL staining showed that the tumor tissue cells of PLCPS-treated mice underwent apoptosis Figure 6 E), which was significantly higher than that of other formulation treatment groups Figure 6 F). At the same time, the expression of Ki67 in the tumor tissue of PLCPS-treated mice decreased Figure 6 E), which was significantly different from the control group Figure 6G), indicating that the cell proliferation was inhibited by PLCPS treatment. In summary, the above results showed that PLCPS can effectively inhibit the growth of non-small cell lung cancer.
[0122] The above embodiments are only to illustrate the preferred modes of the present application, and are not intended to limit the scope of the present application. Any modification and improvement of the technical solutions of the present application made by those skilled in the art without departing from the design spirit of the present application shall fall within the protection scope of the present application.
Claims
1. A method for preparing a tumor microenvironment-responsive cascade-targeted small activated nucleic acid nanodrug, characterized in that: The preparation method comprises the following steps: (1) Dilute the G4.0 PAMAM solution to 0.08-0.12 mM with PBS, weigh 3.5-4.0 mg of sulfo-GMBS and dissolve it in 0.8-1.2 mL of PBS to prepare a solution, which is then added to the above PAMAM solution and mixed evenly. The mixture is reacted at room temperature for 25-35 minutes to remove unbound GMBS. CRVLRSGSC is added to the reaction solution of the previous step at a grafting degree of 4-6%, and the mixture is stirred at 3-5°C for 110-130 minutes. Unbound CRVLRSGSC is removed to obtain CRV-PAMAM. (2) Add 25-35 μg of saRNA to 90-110 μL of nuclease-free water. Add 80-85 μL of nuclease-free water and 15-20 μL of CRV-PAMAM solution to another tube. The mass ratio of saRNA to CRV-PAMAM is 5-7. After mixing the two tubes, incubate at room temperature for 25-35 minutes to prepare CPS. The saRNA is a mixture of sa-p38-5 and sa-TFEB-1, with a mass ratio of sa-p38-5 to sa-TFEB-1 of 1.5-2.5:0.5-1.
5. The positive and negative strand sequences of sa-p38-5 are shown in SEQ ID NOs. 9-10, and the positive and negative strand sequences of sa-TFEB-1 are shown in SEQ ID NOs. 13-14. The concentration of the CRV-PAMAM solution is 8-12 μg / μL; (3) Dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) were dissolved in an organic solvent at a molar ratio of 1.5-2.5:0.5-1.5:0.3-0.
5. The organic solvent was removed by rotary evaporation, and CPS was added to the aqueous phase. The mass ratio of the sum of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) to CPS was 8-12:0.8-1.
2. The mixture was hydrated in a water bath at 40-45°C until the lipid film completely disappeared. The complex solution was passed through filter membranes with pore sizes of 400 nm and 200 nm in turn, and PLCPS was collected by centrifugation.
2. The preparation method according to claim 1, characterized in that In step (1), the G4.0 PAMAM solution was diluted to 0.1 mM with PBS, and 3.82 mg of sulfo-GMBS was weighed and dissolved in 1 mL of PBS to prepare a solution.
3. The preparation method according to claim 2, characterized in that In the step (1), CRVLRSGSC is added to the reaction solution of the previous step according to a grafting degree of 5%.
4. The preparation method according to claim 3, characterized in that In step (2), 30 μg of saRNA was added to 100 μL of nuclease-free water, and 82 μL of nuclease-free water and 18 μL of CRV-PAMAM solution were added to another tube. The concentration of the CRV-PAMAM solution was 10 μg / μL.
5. The preparation method according to claim 4, characterized in that In step (2), the mass ratio of sa-p38-5 to sa-TFEB-1 is 2:
1.
6. The preparation method according to claim 5, characterized in that In the step (3), the molar ratio of dipalmitoylphosphatidylcholine, cholesterol, and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) is 2:1:0.
4.
7. The preparation method according to claim 6, characterized in that The mass ratio of the sum of the dipalmitoylphosphatidylcholine, cholesterol and distearoylphosphatidylethanolamine-poly(2-ethyl-2-oxazoline) to CPS in step (3) is 10:
1.
8. A tumor microenvironment-responsive cascade-targeted small activated nucleic acid nanomedicine prepared by the preparation method according to any one of claims 1 to 7.
9. Use of the tumor microenvironment-responsive cascade-targeted small activated nucleic acid nanodrug according to claim 8 in the preparation of a product for treating solid tumors.
10. The use according to claim 9, characterized in that The solid tumor is lung cancer.
Citation Information
Patent Citations
Functional dendritic polymer gene vector system of targeted malignant cerebroma
CN101337076A
Drug delivery vector and pharmaceutical formulation using same
WO2020224475A1