A strain of Candida and its application in fermentation of Camellia sinensis
The fermentation of Yunnan camellia by Candida railenensis, a strain of Candida raileensis isolated from wild large edible fungi in Yunnan, solved the problem of the lack of special strains in the fermentation process of Yunnan camellia in the existing technology, and achieved the efficient antioxidant, anti-saccharification and anti-aging effects of Yunnan camellia extract in cosmetics.
Patent Information
- Application Number
- CN202510765057.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-06-10
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2045-06-10
AI Technical Summary
The existing camellia fermentation process lacks functional strains from special ecological environment sources, and fails to effectively improve the anti-saccharification and cellular aging effects of Yunnan camellia. The multi-stage fermentation process leads to high production costs and uncontrollable metabolites of compound bacterial strains.
The Candida railenensis strain Candida scrambled simplified fermentation was used to design a specific biofermentation process, and fermented Yunnan camellia extracted Yunnan camellia fermentation filtrate.
The antioxidant, anti-saccharification and anti-aging effects of the Yunnan Camellia fermentation filtrate are improved. The prepared Yunnan Camellia fermentation extract shows significant anti-oxidant, anti-saccharification and anti-aging effects when used in cosmetics, and the process is simple, environmentally friendly and economical.
Smart Images

Figure CN120330070B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a Candida strain and application thereof in fermentation of Camellia sinensis. Background Art
[0002] Yunnan camellia is a plant of the genus Camellia, belonging to the Theaceae family, native to China. It primarily grows in mountain broadleaf or mixed forests at altitudes between 1,500 and 2,800 meters and is widely distributed throughout Yunnan. Medical texts such as "Yunnan Chinese Herbal Medicine" and "The Great Dictionary of Chinese Materia Medica" indicate that Yunnan camellia has numerous beneficial medicinal properties. Currently, several studies are investigating the efficacy and activity of extracts from different parts of the plant, such as its tea leaves and flowers, using various biochemical extraction techniques.
[0003] The application of microbial technology is increasingly gaining a foothold in the development of ingredients for functional skincare products. Numerous studies have demonstrated that fermentation can enhance the active ingredients in plant-based raw materials and strengthen their efficacy. Furthermore, microbial fermentation extraction offers the advantages of energy conservation, emission reduction, and pollution reduction, and in some cases, can even reduce the presence of undesirable toxic substances in plant-based raw materials. Consequently, some studies have explored the use of microbial fermentation for camellia bioextraction. Currently, two main technical approaches exist in the camellia fermentation field. The first involves complex bacterial fermentation, which often requires the addition of exogenous nutrients (such as glucose and peptone) and employs a multi-stage fermentation process, as exemplified by Chinese Patents CN115569096B and CN119318609A. The former (CN115569096B) discloses a camellia fermentation filtrate and fermentation process. By fermenting camellia with a lactic acid bacteria consortium and exogenously adding a carbon source, vitamins, inorganic salts, and oligofructose, the resulting camellia fermentation filtrate is rich in tea polyphenols, total flavonoids, and small molecule natural nutrients. The latter (Chinese Patent CN119318609A) discloses a camellia ferment, its preparation method, and its application. Camellia is first hydrolyzed with a catalytic enzyme, then fermented with a composite yeast seed solution (Saccharomyces logeri and Candida krusei), and exogenously added with a carbon source, nitrogen source, alkaloids, phosphate, ammonium salt, and acidity regulator. The result is a camellia ferment with repairing, soothing, and oil-control properties. However, similar technologies, due to the multi-stage fermentation process, increase production costs, and the composite bacterial strains pose the risk of uncontrollable metabolites. The second approach to camellia fermentation, such as Chinese Patent CN116785361A, uses a single common yeast for fermentation. This approach ferments camellia with Saccharomyces cerevisiae, resulting in a camellia ferment filtrate with wrinkle-reducing and anti-sebum properties. While the process is simplified, the Saccharomyces cerevisiae strain, a widely used and well-known strain derived from a conventional industrial strain library, lacks uniqueness and innovation. In addition, existing research on fermented camellia mainly focuses on moisturizing, anti-oxidation, anti-wrinkle and skin-lightening effects, but lacks exploration of anti-glycation and anti-aging effects at the cellular level.
[0004] From the above, it can be seen that the current patents for camellia fermentation processes do not involve functional strains from special ecological environments, lack strains that can specifically enhance the efficacy characteristics of Yunnan's unique Camellia japonica, and do not have process technologies to enhance the synergistic anti-glycation and cell aging mechanisms of Camellia japonica. Summary of the Invention
[0005] In view of the shortcomings of the prior art, the present invention provides a special Candida strain isolated and purified from a large wild edible fungus in Yunnan ( Candida railenensis) and designed a simplified fermentation process for Camellia yunnanensis based on the biological characteristics of this strain. The fermentation filtrate obtained by fermenting Camellia yunnanensis with this Candida strain is then extracted. This invention aims to provide a safe, environmentally friendly, economical, and beneficial microbial extraction method for Camellia yunnanensis (anti-glycation and cell aging). This method achieves the extraction of a filtrate rich in active ingredients from Camellia yunnanensis through microbial fermentation, while also enriching the original functional effects of Camellia yunnanensis.
[0006] The innovation of the present invention is to provide for the first time a Candida strain isolated and purified from a large wild edible fungus in Yunnan ( Candida railenensis ), and designed a targeted bio-fermentation process based on the strain specificity; under this fermentation process, this Candida strain can enhance the original antioxidant, anti-glycation and anti-aging activities of Yunnan Camellia, and the final Yunnan Camellia fermentation extract can be used as an effective raw material in the cosmetics field.
[0007] The present invention provides the following technical solutions:
[0008] In the first aspect, the present invention provides a Candida isolated from a wild edible mushroom (Boletus edulis) in Yunnan Province, the Candida strain is numbered BTN-HB-M5 (hereinafter referred to as M5), and is classified as Candida railenensis , the deposit date is September 20, 2024. The deposit unit is Guangdong Provincial Microbiological Culture Collection Center, located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou, and the deposit number is GDMCC No: 65164.
[0009] Preferably, the ITS sequence of Candida is shown in SEQ NO: 1 in the sequence listing.
[0010] Preferably, in the present invention, the specific method for obtaining the Candida M5 strain is as follows:
[0011] (1) Select wild white boletus samples grown in Yunnan, wash them, soak them in sterile water at 4°C for 18-24 hours, absorb the appropriate soaking solution and spread it on YPD solid culture medium, culture it at 25-37°C for 24-30 hours, pick out colonies of different morphologies on the YPD solid culture medium, and purify them by streaking on the surface of the YPD solid culture medium;
[0012] (2) Observe the single colonies on different plates after purification under a microscope, select different strains with yeast morphology for identification, and preserve the selected strains.
[0013] In a second aspect, the present invention provides a fermented Yunnan Camellia syrup, which is obtained by fermenting Yunnan Camellia using Candida with a preservation number of GDMCC No: 65164 as a fermentation bacterium.
[0014] In a third aspect, the present invention provides a Yunnan Camellia Japonica fermentation extract, which uses Candida albicans with a preservation number of GDMCC No: 65164 as a fermentation bacterium to ferment Yunnan Camellia Japonica to obtain fermented Yunnan Camellia Japonica pulp, and the fermented Yunnan Camellia Japonica pulp is filtered to obtain Yunnan Camellia Japonica fermentation extract. The Yunnan Camellia Japonica fermentation extract is also called Yunnan Camellia Japonica fermentation filtrate. The Yunnan Camellia Japonica fermentation extract is a single Candida albicans fermentation product, which can be used in food and daily chemical products to further enhance and enrich the skin care effect of Yunnan Camellia Japonica. It has no other additional ingredients added and no irritating by-products, and can be used in daily chemical products. The Yunnan Camellia Japonica fermentation extract has excellent antioxidant, anti-glycation and anti-aging effects, can significantly alleviate skin aging indicators through antioxidant effects, and has great application prospects in the field of daily chemical products.
[0015] In a fourth aspect, the present invention provides a method for preparing a fermented extract of Camellia yunnanensis, comprising the following steps:
[0016] Step S1, inoculating Candida with a deposit number of GDMCC No: 65164 into a YPD liquid culture medium for activation to obtain a Candida M5 strain seed solution;
[0017] Step S2, inoculating the strain seed liquid into a Yunnan Camellia fermentation medium at an inoculum rate of 1% to 3% for fermentation extraction to obtain a fermented Yunnan Camellia slurry;
[0018] In step S3, the fermented Camellia japonica slurry is centrifuged to remove insoluble matter such as solid residues and bacteria, and the supernatant is collected after centrifugation and filtered to obtain the Camellia japonica fermentation extract prepared by microbial means.
[0019] Preferably, in step S1, the preserved Candida M5 is streaked on a YPD plate and cultured at 25°C to 37°C for 24 hours to complete strain recovery; a single colony is picked from the revived Candida M5 plate and inoculated into YPD liquid culture medium for activation, and the activation is carried out by culturing at 25°C to 30°C for 18 hours to 24 hours, and activating for 1 to 2 generations to obtain a Candida M5 strain seed liquid.
[0020] Preferably, in step S2, the fermentation temperature is 25°C to 37°C, the fermentation time is 24 h to 48 h, and the rotation speed of the shaking culture is set to 150 rpm to 200 rpm.
[0021] Preferably, in step S3, the centrifugation condition is 5000 rpm to 8000 rpm, and the centrifugation time is 15 min to 30 min; then the supernatant obtained by centrifugation is filtered through a 0.22 μm filter membrane to obtain the Camellia yunnanensis fermentation extract.
[0022] Preferably, the preparation method of the Yunnan Camellia Japonica fermentation medium is as follows: Yunnan Camellia Japonica is selected as a raw material and pulverized; then Yunnan Camellia Japonica powder is added in an amount of 5% by mass to ultrapure water, and steam sterilized at 121°C for 20 min to obtain the obtained product.
[0023] In a fifth aspect, the present invention provides the above-mentioned Camellia yunnanensis fermented extract as an antioxidant, anti-glycation and anti-aging ingredient in daily chemical products.
[0024] In a sixth aspect, the present invention provides a daily chemical product comprising the above-mentioned Camellia yunnanensis fermented extract.
[0025] Preferably, the fermented extract of Camellia yunnanensis is added to daily chemical products in an amount of 3% by volume. Experimental verification shows that this amount is safe, non-toxic, and has significant efficacy.
[0026] Preferably, the daily chemical products can be of various types, such as shampoo, hair care products, cosmetics, etc.
[0027] Preferably, the cosmetics may be toner, skin care cream, skin care lotion, skin care essence, eye cream, facial mask, makeup remover oil, facial cleanser, shower gel, shampoo, etc.
[0028] Compared with the prior art, the present invention has at least the following beneficial effects:
[0029] 1. The present invention obtained a yeast strain suitable for fermenting Yunnan Camellia - Candida BTN-HB-M5 (abbreviated as M5) through screening. The Yunnan Camellia was fermented using this strain. The strain can specifically enhance the efficacy of Yunnan Camellia, filling the gap in the current Yunnan Camellia fermentation extraction technology that does not involve strains from special ecological environments.
[0030] 2. The present invention utilizes Candida BTN-HB-M5 through suitable culture and collection processes to obtain the Yunnan Camellia Japonica fermentation extract (fermentation filtrate), and the overall fermentation process is green and efficient; the prepared Yunnan Camellia Japonica fermentation extract can scavenge DPPH free radicals and ABTS free radicals in vitro, inhibit the activity of hyaluronidase, and inhibit the formation of AGEs. It has good in vitro anti-glycation, antioxidant and anti-aging efficacy and activity, is safe, and can be widely used in the cosmetics field.
[0031] 3. The present invention uses Candida M5 to ferment Camellia japonica, thereby improving the antioxidant, anti-glycation and anti-aging effects of Camellia japonica, thereby enhancing its efficacy in daily chemical products and making the products have higher performance:
[0032] 1) The DPPH scavenging rate of the fermented Camellia sinensis extract prepared by Candida M5 was increased by 11.96% compared with the unfermented Camellia sinensis extract;
[0033] 2) The ABTS clearance rate of the fermented Camellia sinensis extract prepared with Candida M5 was increased by 6.46% compared with the unfermented Camellia sinensis extract;
[0034] 3) The hyaluronidase inhibition rate of the fermented Camellia sinensis extract prepared with Candida M5 was increased by 32.06% compared with the unfermented Camellia sinensis extract;
[0035] 4) The AGE inhibition rate of the fermented Camellia sinensis extract prepared with Candida M5 was 13.20% higher than that of the unfermented Camellia sinensis extract.
[0036] 5) The fermented extract of Camellia sinensis prepared with Candida M5 showed a more significant growth-promoting effect on skin fibroblasts compared to the unfermented extract. The viability of skin fibroblasts reached 105.99% after intervention with 3% (v / v) Candida M5 fermented extract of Camellia sinensis.
[0037] 6) At a 3% addition, the fermented extract of Camellia sinensis prepared with Candida M5 significantly reduced the expression of MMP3 mRNA in skin fibroblasts under the H2O2 aging model by 46.53% compared with the unfermented extract of Camellia sinensis.
[0038] The preparation method of the present invention is simple to operate, and the operation process is economical, green and pollution-free. The devices used are easy to clean. At the same time, the fermentation method enhances the efficacy and activity of the Yunnan Camellia extract. It is also non-toxic and performs well in in vitro skin cell experiments. These characteristics indicate that this technology is not only suitable for large-scale industrial production, but also has great potential in the development of skin care product raw materials. BRIEF DESCRIPTION OF THE DRAWINGS
[0039] Figure 1 This is a graph showing the results of the fluorescent AGEs inhibition experiment in Test Example 4 of the present invention;
[0040] Figure 2 This is a graph showing the experimental results of evaluating in vitro HFF cell proliferation in Test Example 5 of the present invention;
[0041] Figure 3 This is a graph showing the expression results of aging-related genes in skin fibroblasts of Test Example 6 of the present invention. DETAILED DESCRIPTION
[0042] The technical solution of the present invention will be further described below with reference to the accompanying drawings and through specific embodiments. However, the following examples are merely simplified examples of the present invention and do not represent or limit the scope of protection of the present invention. The scope of protection of the present invention shall be subject to the claims.
[0043] Unless otherwise specified, the raw materials and materials used in the examples of the present invention were purchased through general commercial channels.
[0044] The sources of the raw materials, materials and instruments involved in the following examples and comparative examples are as follows:
[0045] Yeast M9: self-developed, as described in the examples;
[0046] Yeast M6: self-developed, as described in the examples;
[0047] Bacillus L25: self-developed, described in the examples;
[0048] Lactic acid bacteria M4: self-developed, as described in the examples;
[0049] YPD liquid culture medium: Qingdao Haibo Biotechnology;
[0050] DPPH (1,1-diphenyl-2-trinitrophenylhydrazine (2,2-Diphenyl-1-picrylhydrazyl)), Aladdin;
[0051] ABTS (2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt), Aladdin;
[0052] Hyaluronidase, Yuanye Bio;
[0053] Sodium hyaluronate, Aladdin;
[0054] Human fibroblasts (HFF cells) were purchased from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences.
[0055] DMEM culture medium, Eva cell;
[0056] Fetal bovine serum, Gibco;
[0057] Penicillin-Streptomycin (10,000 U / mL) Penicillin-Streptomycin (10,000 U / mL) (hereinafter referred to as: double antibody);
[0058] Complete medium: DMEM medium supplemented with 10% (v / v) FBS fetal bovine serum and 1% (v / v) double antibody;
[0059] MTT test solution, Aladdin;
[0060] Sample solvent: sterile water.
[0061] <Example 1>
[0062] Screening and identification of strains
[0063] This example provides a Candida species derived from wild edible mushrooms (Boletus edulis) in Yunnan. Candida railenensis ) The specific steps of the M5 screening method are as follows:
[0064] (1) Select wild white boletus samples grown in Yunnan, wash them, and soak them in sterile water at 4°C for 18 h~24 h to obtain soaking liquid; then absorb appropriate soaking liquid and spread it on YPD solid culture medium, culture it at 25°C~37°C for 24 h~30 h, pick out colonies of different morphologies on the YPD solid culture medium, purify them by streaking on the surface of the YPD solid culture medium, and subculture them for at least 2 times to obtain purified colonies;
[0065] (2) Observe the single colonies on different plates after purification under a microscope, select different strains with yeast morphology for screening and identification, and obtain a Candida ( Candida railenensis ), named BTN-HB-M5 (hereinafter referred to as M5). The selected strain was also deposited with the Guangdong Provincial Microbial Culture Collection, located at Building 59, 5th Floor, No. 100 Xianlie Middle Road, Guangzhou, under the GDMCC No. 65164. The screening assay in this step involved sequencing the resulting yeast. The results showed the ITS sequence of the strain as shown in the following sequence listing, SEQ NO: 1:
[0066] CCTGCGGAAGGATCATTACAGTATTCTTTTGCCAGCGCTTAATTGCGCGGCGAAAAACCTTACACACTATGTTTTTTTAATTTGAAACTATTGCTTTGGTCTGGCTTAgAAATAGGTTGGGCCAAAGGTTTTATCAAAACTTCAATATT ATTATTGAATTGTTATTTTTAATTTTATGTCAATTTGTTGATTAATATCAAAAATCTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATTTTCGTGAATC ATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCTCTCAAATCTTCGGATTTGGTTTTGAGTGATACTCTTAGTCAGACTAAGCGTTGCTTGAAATGTATTGGCATGAGTGGT ACTAGATAGTGCTGAACTGTTTTCAATGTATTAGGTTTATCCAACTCATTGACCAGTAAAGTATTTGTTTATTACACAGGCTCGGCCTTACAACAACAACAAAGTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATC
[0067] <Example 2>
[0068] This embodiment provides an unfermented extract of Camellia yunnanensis, and the specific preparation method is as follows:
[0069] Dried flowers of Camellia yunnanensis were selected as raw materials and crushed; Camellia yunnanensis powder was added into ultrapure water at an addition amount of 5% by mass, and sterilized by high-pressure steam at 121℃ for 20 min to be used as Camellia yunnanensis fermentation medium.
[0070] The fermentation culture medium of Camellia yunnanensis is centrifuged at a speed of 5000 rpm to 8000 rpm for 15 min to 30 min; the supernatant is then filtered through a 0.22 μm filter membrane to obtain a high-temperature and high-pressure water extract of unfermented Camellia yunnanensis, referred to as the unfermented Camellia yunnanensis extract.
[0071] <Example 3>
[0072] This embodiment provides a fermentation extract of Camellia japonica (Camellia japonica fermentation filtrate), the preparation method of which is as follows:
[0073] Step S0: preparing a Camellia japonica fermentation medium according to Example 2.
[0074] Step S1: streaking the Candida M5 preserved in Example 1 on a YPD plate and culturing at 25°C to 30°C for 24 hours to complete strain recovery; then, picking a single colony from the revived Candida M5 plate and inoculating it into YPD liquid medium for activation. During the activation, the colony was cultured at 25°C to 30°C for 24 hours, and activated for two generations to obtain a Candida M5 strain seed liquid.
[0075] Step S2: 1% (v / v) of the Candida M5 strain seed solution is inoculated into the Yunnan Camellia fermentation medium for fermentation to obtain fermented Yunnan Camellia slurry. The fermentation temperature is 25° C., the fermentation time is 24 h, and the shaking culture speed is set to 150 rpm.
[0076] In step S3, the fermented Camellia sinensis slurry is first centrifuged to remove solid residues, bacteria and other insoluble matter. The centrifugation conditions are 5000-8000 rpm and the centrifugation time is 15-30 min. The supernatant obtained by centrifugation is then filtered with a 0.22 μm filter membrane to obtain the Camellia sinensis fermentation extract prepared by microbial means.
[0077] <Example 4>
[0078] This embodiment provides a fermented Camellia japonica extract (Camellia japonica fermentation filtrate). The difference between the preparation method and that of Example 3 is that the inoculation amount of the seed solution, the fermentation temperature, the fermentation time, and the shaking speed during the fermentation of Camellia japonica in step S2 are modified. The other components, amounts, and preparation methods are the same as those of Example 3. The modified step S2 is:
[0079] The Candida M5 strain seed liquid was inoculated into the Camellia yunnanensis fermentation medium at 2% (v / v) for fermentation at a temperature of 30°C for 48 h, and the shaking culture speed was set at 200 rpm.
[0080] <Example 5>
[0081] This embodiment provides a fermented Camellia japonica extract (Camellia japonica fermentation filtrate). The difference between the preparation method and that of Example 4 is that the inoculation amount of the seed solution and the fermentation temperature in step S2 during the fermentation of Camellia japonica are modified. The other components, dosages, and preparation methods are the same as those of Example 3. The modified step S2 is:
[0082] The Candida M5 strain seed liquid was inoculated into the Camellia yunnanensis fermentation medium at 3% (v / v) for fermentation at a temperature of 37°C for 48 h, and the shaking culture speed was set at 200 rpm.
[0083] Comparative Example 1
[0084] This comparative example provides a fermented Camellia sinensis extract (Camellia sinensis fermentation filtrate). The preparation method differs from that of Example 4 in that the strain used is changed: Candida M5, derived from a wild edible mushroom (Boletus edulis) in Yunnan, is replaced with a yeast strain M9 isolated independently from a wild edible mushroom (Altissima colletotrichum) in Yunnan by this laboratory. Other components, amounts, and preparation methods are the same as those of Example 4. The isolation method of yeast M9 is the same as that of Example 1.
[0085] Comparative Example 2
[0086] This comparative example provides a fermented Camellia sinensis extract (Camellia sinensis fermented filtrate). The preparation method differs from that of Example 4 in that the strain used is changed: Candida M5, derived from a wild edible mushroom (Boletus edulis) in Yunnan, is replaced with a yeast strain M6, which was independently isolated from a wild edible mushroom (Boletus edulis) in Yunnan by this laboratory. All other components, amounts, and preparation methods are the same as those of Example 4. The isolation method of yeast M6 is the same as that of Example 1.
[0087] Comparative Example 3
[0088] This comparative example provides a fermented extract of Camellia sinensis (Camellia sinensis fermentation filtrate). The preparation method differs from that of Example 5 in that the strain used is modified: Candida M5, derived from a wild edible mushroom (Boletus edulis) in Yunnan, is replaced with a strain of Bacillus L25, isolated independently by our laboratory from Cypripedium serratum in Haba Snow Mountain, Yunnan. All other components, amounts, and preparation methods are the same as those of Example 5. The isolation method of Bacillus L25 is the same as that of Example 1, except that the culture medium is replaced with LB medium and the culture temperature is changed to 37°C.
[0089] Comparative Example 4
[0090] This comparative example provides a fermented extract of Camellia sinensis (Camellia sinensis fermentation filtrate). The preparation method differs from that of Example 5 in that the strain used is modified: Candida albicans M5, derived from a wild edible fungus (Bacillus albicans) in Yunnan, is replaced with a strain of Lactobacillus M4, isolated independently from a wild edible fungus (Bacillus albicans) in Yunnan in our laboratory. All other components, amounts, and preparation methods are the same as those of Example 5. The isolation method of Lactobacillus M4 is the same as that of Example 1, except that the culture medium is replaced with MRS medium and the culture temperature is changed to 37°C.
[0091] <Test Example 1>
[0092] DPPH free radical scavenging experiment
[0093] With reference to the "Cosmetics - Free Radical (DPPH) Scavenging Test Method (T / SHRH006-2018)", the DPPH free radical scavenging rates (%) of the Camellia yunnanensis fermented extracts, Camellia yunnanensis unfermented extracts and sample blank control groups prepared in Examples 2 to 5 and Comparative Examples 1 to 4 were respectively tested.
[0094] (1) Drug preparation: Weigh 10 mg of DPPH, dissolve it in anhydrous ethanol by ultrasonication, and then dilute to 100 mL for later use (0.1 mg / mL). Store in the dark to obtain DPPH solution.
[0095] (2) Experimental steps: Set up a sample group, a sample blank control group, a control group, and a control blank control group, with 3 replicates in each group. In the sample group, 150 μL of the fermentation product filtrate of Examples 2 to 5 and Comparative Examples 1 to 4 were taken in a 96-well plate as the test sample, and then the test sample and DPPH solution were added in equal volumes of 1:1, reacted at room temperature in the dark for 30 min, shaken and evenly mixed, and the absorbance was measured at a wavelength of 517 nm; the sample blank control group used an equal volume of anhydrous ethanol instead of DPPH solution, and other conditions were the same as those of the sample group; the control group used an equal volume of ultrapure water instead of fermentation product filtrate, and other conditions were the same as those of the sample group; the control blank control group used an equal volume of ultrapure water instead of fermentation product filtrate, and anhydrous ethanol instead of DPPH solution, and other conditions were the same as those of the sample group.
[0096] (3) The calculation method of DPPH (1,1-diphenyl-2-trinitrophenylhydrazine) clearance rate is:
[0097] Clearance (%) = [1-(As-As0) / (Ac-Ac0)] × 100%;
[0098] Where: As is the absorbance measured for the sample group; As0 is the absorbance measured for the sample blank group; Ac is the absorbance measured for the control group; Ac0 is the absorbance measured for the control group.
[0099] The results of the DPPH free radical scavenging test are shown in Table 1.
[0100] <Test Example 2>
[0101] ABTS (2,2-azino-bis(3-ethyl-benzothiazole-6-sulfonic acid) diammonium salt) free radical scavenging assay
[0102] (1) Drug preparation: Accurately weigh 0.0284 g of ABTS and dissolve it in 10 mL of distilled water. Accurately weigh 0.0067 g of potassium persulfate and dissolve it in 10 mL of distilled water. Mix the two solutions in a 1:1 ratio by volume and then place them in a dark place at room temperature for 16 h to 24 h to obtain the ABTS stock solution. In the pilot experiment, dilute the ABTS stock solution with 15 times the volume of distilled water to an absorbance (λ = 734 nm) of 0.7 ± 0.1 to obtain the ABTS working solution.
[0103] (2) Experimental steps: First, add 180 μL of ABTS working solution to a 96-well plate, then add 20 μL of the sample to be tested to each well. After reacting for 180 min, shake well and measure the absorbance at 724 nm.
[0104] The samples to be tested were the fermented extracts of Camellia japonica prepared in Examples 2 to 5 and Comparative Examples 1 to 4, the unfermented extract of Camellia japonica and a blank control group (ultrapure water).
[0105] (3) The calculation method of ABTS clearance rate is:
[0106] Clearance (%) = 1-As / Ac × 100%;
[0107] Where: As is the absorbance measured for the sample group; Ac is the absorbance measured for the blank control group.
[0108] The results of the ABTS free radical scavenging test are shown in Table 1.
[0109] <Test Example 3>
[0110] Hyaluronidase inhibition assay
[0111] (1) Drug preparation: Dissolve hyaluronidase in 0.1 mM acetate buffer and prepare it to a concentration of 0.25 mg / mL;
[0112] Sodium hyaluronate was dissolved in 0.1 mM acetate buffer and prepared to a concentration of 1 mg / mL;
[0113] Prepare 12.5 mM calcium chloride solution by adding 0.6 g of calcium chloride to 50 g with ultrapure water.
[0114] Prepare 0.4M sodium hydroxide solution by adding 0.8 g of sodium hydroxide to 50 g with ultrapure water.
[0115] One day in advance, take 6.1 g of potassium borate and add water to 50 g to prepare a 4 M potassium borate solution;
[0116] Take 0.8 g of p-dimethylaminobenzaldehyde, add 20 ml of acetic acid, and then add 5 ml of concentrated hydrochloric acid (store in the dark) to obtain a color developer.
[0117] (2) Set up groups:
[0118] Sample group (Group A): The test samples are the fermented extracts of Camellia yunnanensis and the unfermented extracts of Camellia yunnanensis prepared in Examples 2 to 5 and Comparative Examples 1 to 4. To this group, the test samples, hyaluronidase, and sodium hyaluronate are added simultaneously;
[0119] Sample blank group (Group B): The test samples were the fermented extracts of Camellia japonica and the unfermented extracts of Camellia japonica prepared in Examples 2 to 5 and Comparative Examples 1 to 4. This group only added the test samples without hyaluronidase and sodium hyaluronate.
[0120] Control group (Group C): The sample to be tested is the sample solvent, and this group is added with the sample solvent, hyaluronidase and sodium hyaluronate;
[0121] Control blank group (Group D): The sample to be tested is acetate buffer, and only sample solvent and acetate buffer are added to this group.
[0122] (3) Experimental steps:
[0123] Step (a), according to the grouping requirements, add 0.5 mL of the sample to be tested to Group A, Group B, Group C, and Group D respectively; then add 0.5 mL of acetate buffer to Groups A, B, and C, and add 0.5 mL of sample solvent to Group D, and incubate at 37°C for 20 min.
[0124] Step (b): After step (a), 100 μL of calcium chloride was added to each group and incubated at 37°C for 20 min.
[0125] Step (c): After step (b), 0.5 mL of sodium hyaluronate was added to groups A and B, and 0.5 mL of acetate buffer was added to groups C and D, and the cells were incubated at 37°C for 40 min.
[0126] After step (d) and step (c), 100 μL of sodium hydroxide and 100 μL of potassium borate were added to each group, followed by incubation in an 85°C water bath for 5 min, followed by an ice bath for 2 min, and finally at room temperature for 5 min to obtain a reaction solution.
[0127] In step (e), the reaction solution obtained after step (d) was shaken evenly, and 100 μL of each aliquot was added to a 96-well plate, and 100 μL of the color developer was added to each well.
[0128] In step (f), the 96-well plate was quickly placed in a microplate reader and shaken at 37°C for 1 minute. After adding the color developing reagent for 10 minutes, the absorbance was measured at 585 nm.
[0129] (4) The calculation method of hyaluronidase (HAS) inhibition rate is:
[0130] HAS inhibition rate (%) = [(CD) - (AB)] / (CD) × 100%
[0131] Where: A, B, C, D are the absorbances of group A, group B, group C, and group D measured at 585 nm.
[0132] The results of the HAS inhibition rate test are shown in Table 1.
[0133] Table 1. Test results of test cases 1 to 3
[0134]
[0135] As shown in Table 1, the Camellia japonica fermented extracts obtained by fermentation with Candida BTN-HB-M5 (Camellia japonica fermentation filtrates, Examples 3-5) have better DPPH scavenging ability, ABTS scavenging ability and HAS inhibition ability than the unfermented Camellia japonica extract (Example 2), indicating that the fermentation method using Candida BTN-HB-M5 can enhance the in vitro antioxidant and anti-aging effects of Camellia japonica extract.
[0136] Further comparison of Examples 3-5 with the Yunnan Camellia Japonica fermentation extracts of other self-developed strains (Yunnan Camellia Japonica fermentation filtrate, Comparative Examples 1-4) revealed that although the Yunnan Camellia Japonica fermented with other strains had slightly improved in vitro antioxidant and anti-aging effects compared with the unfermented Yunnan Camellia Japonica, the enhancement effects of the fermentation with other strains were not as good as the Yunnan Camellia Japonica fermentation filtrate of Candida BTN-HB-M5; this indicated that Candida BTN-HB-M5 was a strain more suitable for fermenting to enhance the efficacy of Yunnan Camellia Japonica.
[0137] Analysis of the efficacy of the fermentation products obtained by different processes for preparing Camellia japonica fermented extracts (Camellia japonica fermented filtrates) using Candida BTN-HB-M5 in Examples 3-5 (Table 1) shows that the Camellia japonica fermented extract (Camellia japonica fermented filtrate) obtained using the fermentation process of Example 4 exhibits the best comprehensive antioxidant and anti-aging efficacy, and also surpasses the activity of Camellia japonica fermented extracts obtained by fermentation with other strains (Camellia japonica fermented filtrates, Comparative Examples 1-4). Therefore, selecting Candida BTN-HB-M5 for the production of Camellia japonica fermented extract using the fermentation process conditions of Example 4 is the optimal choice.
[0138] <Test Example 4>
[0139] Fluorescent AGEs inhibition experiment
[0140] (1) Drug preparation: Prepare 0.2 mol / L PBS phosphate buffer (pH = 7.4); weigh bovine serum albumin and dissolve it in PBS buffer to make a 0.8 mg / mL BSA solution; weigh D-glucose and dissolve it in PBS buffer to make a 200 mM Glu solution.
[0141] (2) Test samples: the unfermented extract of Camellia japonica in Example 2 and the fermented extract of Camellia japonica prepared in Example 4. The blank control group was replaced with PBS buffer.
[0142] (3) Experimental steps: Add 1.0 mL each of the above-mentioned test sample, BSA solution, and Glu solution to a sterile centrifuge tube, then add 1.0 mL of PBS buffer and mix thoroughly. Measure the initial fluorescence value of each group of test samples at an excitation wavelength (Ex) of 370 nm and an emission wavelength (Em) of 420 nm. The fluorescence value of the sample group is recorded as Fs0, and the blank control group is recorded as Fc0.
[0143] After incubation in a 60°C metal bath for 24 hours, the fluorescence value (Fs) of the advanced glycation end products at an excitation wavelength (Ex) of 370 nm and an emission wavelength (Em) of 420 nm was measured, representing the total fluorescent AGE content. The fluorescence value of the sample group was recorded as Fs, and the blank control group was recorded as Fc.
[0144] (4) Fluorescent AGEs inhibition rate (%) = [1-(Fs-Fs0) / (Fc-Fc0)] × 100%
[0145] The results of the fluorescence AGEs inhibition rate test are as follows Figure 1 As shown. Figure 1 It can be seen that the fluorescent AGEs inhibition rate of the unfermented extract of Camellia japonica is 45.15%, and the fluorescent AGEs inhibition rate of the fermented extract of Camellia japonica is 51.11%, indicating that the fermentation of Camellia japonica by Candida BTN-HB-M5 improves the anti-glycation property of Camellia japonica.
[0146] <Test Example 5>
[0147] In vitro HFF cell proliferation assessment assay
[0148] (1) Cells and culture medium: HFF cells from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences were cultured in DMEM medium (10% FBS fetal bovine serum).
[0149] (2) Test samples: the unfermented extract of Camellia japonica in Example 2, the fermented extract of Camellia japonica prepared in Example 4, and the blank control group was replaced with PBS buffer.
[0150] (3) Effect of the test substance on HFF cell proliferation: HFF cells with good morphology and in the logarithmic growth phase were selected and inoculated in a 96-well plate and incubated in an incubator for 24 hours. The test substances were all diluted with complete culture medium at a concentration of 3% (v / v). Six replicate wells were set for each concentration gradient and incubated in an incubator for a total of 24 hours. The original supernatant was removed, and MTT test solution was added to each well. The cells were incubated in an incubator for 2 hours. The absorbance at an absorption wavelength of 570 nm was measured using an enzyme-labeled instrument to calculate the cell viability. The results are as follows: Figure 2 shown. Figure 2 In the table, * indicates the difference between other sample groups and blank control group, * indicates p < 0.05, and ** indicates p < 0.01. Figure 2 It can be seen that the 3% fermented extract of Camellia sinensis has more significant proliferation-promoting activity than the 3% unfermented extract of Camellia sinensis.
[0151] <Test Example 6>
[0152] In vitro HFF cell H2O2-induced aging model anti-aging efficacy evaluation experiment
[0153] (1) Cells and culture medium: HFF cells from the Shanghai Institute of Cell Biology, Chinese Academy of Sciences were cultured in DMEM medium (10% FBS fetal bovine serum).
[0154] (2) Test samples: the unfermented extract of Camellia japonica obtained in Example 2 (3% (v / v) concentration for the experiment), the fermented extract of Camellia japonica obtained in Example 4 (3% (v / v) concentration for the experiment), and the blank control group was replaced with PBS buffer.
[0155] (3) HFF cells with good morphology in the logarithmic growth phase were selected and inoculated into 6-well plates at a seeding concentration of 2.5×10 5 cells / well and incubate in a culture incubator for 24 h.
[0156] A sample group, a control group, and a blank group were set up, with 3 replicate wells in each group. The sample group included two groups, the first group was added with a complete culture medium containing 3% of the unfermented extract of Camellia japonica in Example 2, and the second group was added with a DMEM complete culture medium containing 3% of the fermented extract of Camellia japonica prepared in Example 4. After treating the cells for 4 h in both groups, 400 μM H2O2 solution was added and induced for 2 h. DMEM complete culture medium containing 3% of the fermentation product filtrate of Example 3 was added again, and the cells were incubated in a 37°C, 5% CO2 incubator for 24 h. No fermentation product filtrate was added to the control group, and the other conditions were the same as those of the sample group. No fermentation product filtrate was added to the blank group, and no H2O2 solution was used for induction. The other conditions were the same as those of the sample group.
[0157] (3) After the incubation, RNA was extracted and the content was determined, and then reverse transcribed into cDNA. Finally, a fluorescence quantitative PCR experiment was performed. The internal reference gene was β-actin. The experimental results are shown in Figure 2. Figure 3 As shown, ### indicates p < 0.001 compared with blank, ** indicates p < 0.01 compared with H2O2.
[0158] (4) Expression results of senescence-related genes in skin fibroblasts:
[0159] As the core mediator of matrix degradation, MMP3 overexpression is associated with multiple aging mechanisms such as photoaging and glycosylation aging. Figure 3 It can be seen that under H2O2 induction, the mRNA level of MMP3 in HFF cells increased, but after intervention with 3% concentrations of unfermented and fermented extracts of Camellia japonica, the expression of matrix metalloproteinases decreased, and aging was alleviated. In addition, the anti-aging ability of Camellia japonica extract was enhanced after fermentation with Candida M5, and the mRNA level of MMP3 decreased more significantly compared with the group that only underwent H2O2 induction. Considering the close relationship between glycation and oxidative damage, this result fully demonstrates that Candida M5 fermentation not only enhances the anti-aging ability of Camellia japonica and is effective in reducing MMP3 expression, but also further demonstrates powerful anti-glycation and anti-aging effects by alleviating glycation damage under oxidative stress. This echoes the fact that Candida M5 fermentation enhances the anti-glycation function of Camellia japonica in vitro.
[0160] The applicant declares that the above is only a specific embodiment of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and disclosure scope of the present invention.
Claims
1. A strain of Candida, characterized in that The classification of the Candida species is named Candida railenensis , and was deposited in the Guangdong Microbiological Culture Collection Center on September 20, 2024, with the deposit number GDMCC No: 65164.
2. A fermented Yunnan Camellia pulp, characterized in that: The product was obtained by fermenting Camellia yunnanensis using Candida albicans with a deposit number of GDMCC No: 65164 as a fermentation bacterium.
3. A fermented extract of Camellia yunnanensis, characterized in that: Candida with a preservation number of GDMCC No: 65164 is used as a fermentation bacterium to ferment Camellia japonica to obtain fermented Camellia japonica pulp, and the fermented Camellia japonica pulp is filtered to obtain the Camellia japonica fermentation extract.
4. The method for preparing the fermented extract of Camellia yunnanensis according to claim 3, wherein: The steps include: Step S1, inoculating Candida with a deposit number of GDMCC No: 65164 into a YPD liquid culture medium for activation to obtain a Candida M5 strain seed solution; Step S2, inoculating the strain seed liquid into a Yunnan Camellia fermentation medium at an inoculum rate of 1% to 3% for fermentation extraction to obtain a fermented Yunnan Camellia slurry; Step S3, centrifuging the fermented Camellia japonica slurry to obtain a supernatant, and filtering the supernatant to obtain a Camellia japonica fermentation extract; In step S2, the preparation method of the Yunnan Camellia Japonica fermentation medium is as follows: Yunnan Camellia Japonica is selected as a raw material and crushed; then Yunnan Camellia Japonica powder is added in an amount of 5% by mass to ultrapure water, and steam sterilized at 121°C for 20 minutes.
5. The method for preparing the fermented extract of Camellia yunnanensis according to claim 4, wherein: In step S1, during activation, the culture is performed at 25° C. to 30° C. for 18 to 24 hours, and the strain seed liquid of Candida M5 is obtained after activation for 1 to 2 generations; In step S2, the fermentation temperature is 25°C to 37°C, the fermentation time is 24 h to 48 h, and the shaking incubation speed is set to 150 rpm to 200 rpm; In step S3, the centrifugation condition is 5000 rpm~8000 rpm, and the centrifugation time is 15 min~30 min; then the supernatant obtained by centrifugation is filtered with a 0.22 μm filter membrane to obtain the Camellia yunnanensis fermentation extract.
6. A use of the fermented Camellia japonica extract according to claim 3 in daily chemical products, characterized in that: The fermented Camellia yunnanensis extract is used as an antioxidant, anti-glycation and anti-aging ingredient in daily chemical products.
7. A daily chemical product, characterized in that: The invention comprises the fermented Camellia sinensis extract as claimed in claim 3.
8. A daily chemical product according to claim 7, characterized in that: The added amount of the Camellia yunnanensis fermented extract in daily chemical products is 3% by volume.
Citation Information
Patent Citations
A Camellia Fermentation Filtrate and Fermentation Process
CN115569096B
Camellia fermented product, skin external composition containing camellia fermented product and application of camellia fermented product
CN116785361A
Camellia fermented product as well as preparation method and application thereof
CN119318609A
Flos camelliae japonicae extract and traditional Chinese herb cosmetics containing same
CN108403495A
Candida tropicalis and application thereof
CN115710553A