Engineering bacterium of high-yield glutamine transaminase as well as construction method and application of engineering bacterium

Abstract

The invention relates to the technical field of gene engineering, in particular to an engineering bacterium for high-yield glutamine transaminase as well as a construction method and application of the engineering bacterium. According to the invention, the DnaK gene is over-expressed in streptomyces mobaraensis GL, the yield of TGase produced by the streptomyces mobaraensis is promoted, the relative enzyme activity of the TGase of the GL-dnaK mutant strain is 1.53 times that of a wild strain at the shake flask level of a laboratory, and the GL-dnaK mutant strain has a good application prospect in the field of production of glutamine transaminase.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to an engineered bacterium with high yield of glutamine transaminase, a construction method thereof, and an application thereof. Background Art

[0002] Glutamine transaminase (TGase, EC 2.3.2.13) can catalyze the transamination reaction of the γ-amino group on the glutamine residue in a protein or polypeptide chain with the ε-amino group on the lysine residue or the amino group on other amino group-containing substrates, or the deamination reaction with water. In recent years, TGase has shown great application prospects in many industrial productions, especially in the food processing field. Because the covalent cross-linking produced by TGase can be used to modify the physical and chemical properties of proteins, such as water retention, thermal stability, emulsification, viscosity, elasticity, etc., it is widely used in the processing of meat products, dairy products, soy products, and cereals. Myosin, milk casein, whey protein, soybean globulin, and gluten in these products are good substrates for TGase. However, the current yield of this enzyme is still low and needs to be further improved.

[0003] The DnaK protein is an important molecular chaperone of heat shock proteins and plays an important role in the correct folding, translation, synthesis, and decomposition of many proteins in bacteria. DnaK can prevent proteins from aggregating under stress conditions and help denatured proteins refold into the correct conformation. In addition, the DnaK protein plays a key role in the bacteria's response to heat stress. Under high-temperature conditions, the expression level of the DnaK protein increases significantly, helping the cell maintain the stability and function of proteins, thereby enhancing the heat resistance of the bacteria. As a molecular chaperone, the DnaK protein not only helps proteins fold correctly and maintain stability but also enhances the survival ability of bacteria under various environmental stresses. Thus, it can be seen that the regulatory role of the DnaK gene in protein synthesis is pleiotropic. However, there is no relevant research on whether the DnaK gene affects the production of glutamine transaminase.

[0004] Therefore, exploring the expression of the DnaK gene is of great significance for improving the yield of glutamine transaminase. Summary of the Invention

[0005] In view of this, the present invention provides an engineered bacterium with high yield of glutamine transaminase, a construction method thereof, and an application thereof.

[0006] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions: In the first aspect of the present invention, there is provided an engineered bacterium with high yield of glutamine transaminase. The engineered bacterium is a strain overexpressing the DnaK gene, and the starting strain of the engineered bacterium is Streptomyces mobaraensis ( Streptomyces mobaraensis )

[0007] Furthermore, the parental strain of the engineered bacterium is Streptomyces mobaraensis ( Streptomyces mobaraensis ) GL, and its preservation number is GDMCC No. 63755; the nucleotide sequence of the DnaK gene is as shown in SEQ ID NO.1.

[0008] In the second aspect of the present invention, a method for constructing the above-mentioned engineered bacterium is provided, which includes introducing an expression vector containing the DnaK gene into a host cell.

[0009] In the third aspect of the present invention, an application of the above-mentioned engineered bacterium in the production of transglutaminase is provided.

[0010] In the fourth aspect of the present invention, a method for producing transglutaminase is provided, which includes taking the above-mentioned engineered bacterium for fermentation to obtain a fermentation broth, centrifuging to collect the supernatant of the fermentation broth, and obtaining transglutaminase.

[0011] The present invention has the following effects: In the present invention, the DnaK gene is overexpressed in Streptomyces mobaraensis ( Streptomyces mobaraensis ) GL, which promotes the yield of TGase produced by Streptomyces mobaraensis. At the laboratory shake-flask level, the relative enzyme activity of TGase of the GL-dnaK mutant strain is 1.53 times that of the wild strain. The reason for obtaining the above effect may be that inclusion bodies are produced during the large-scale production of TGase by Streptomyces mobaraensis, which affects the activity of TGase. As a molecular chaperone, DnaK can bind to about 700 different proteins and help them fold correctly; at the same time, when Streptomyces mobaraensis produces TGase, the pH rises in the later stage of fermentation, and secondary metabolites will also affect the growth of the bacteria. Overexpression of DnaK can enhance the resistance of the bacteria to heat, acid and oxidative stress, enabling it to better adapt to environmental changes and improve production performance. Description of the Drawings

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0013] Figure 1 It is a schematic diagram of constructing the expression vector pIB139-dnaK in Example 1 of the present invention; Figure 2 It is the standard curve of the enzyme activity determination of transglutaminase in Example 4 of the present invention; Figure 3 It is the relative enzyme activity of transglutaminase (TGase) in the fermentation process of the GL-dnaK mutant strain, the GL strain and the GL strain with the empty plasmid in Example 4 of the present invention. Detailed Embodiments

[0014] The present invention discloses a genetically engineered bacterium with high glutamine transaminase productivity, its construction method and application. Those skilled in the art can draw on the content of this article and appropriately modify process parameters to achieve it. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as being included within the scope of the present invention. The methods and applications of the present invention have been described through preferred embodiments. Those skilled in the art can obviously make changes, or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention, so as to implement and apply the technology of the present invention.

[0015] In a specific embodiment of the present invention, a genetically engineered bacterium with high glutamine transaminase productivity is provided. The genetically engineered bacterium is a strain overexpressing the DnaK gene, and the starting strain of the genetically engineered bacterium is Streptomyces mobaraensis ( Streptomyces mobaraensis ).

[0016] As a preferred embodiment, the starting strain of the genetically engineered bacterium is Streptomyces mobaraensis ( Streptomyces mobaraensis ) GL, and its preservation number is GDMCC No. 63755.

[0017] As a preferred embodiment, the nucleotide sequence of the DnaK gene is as shown in SEQ ID NO.1.

[0018] In another embodiment of the present invention, a method for constructing the above-mentioned genetically engineered bacterium is provided, which includes introducing an expression vector containing the DnaK gene into a host cell.

[0019] As a preferred embodiment, for the expression vector, its preparation method includes ligating the DnaK gene or its gene expression cassette into a plasmid, and the nucleotide sequence of the DnaK gene is as shown in SEQ ID NO.1.

[0020]

[0021] As a preferred embodiment, the amplification primers in the construction of the gene expression cassette include the sequences shown in SEQ ID NO.2-3, and the restriction enzyme digestion and ligation sites are Nde I and Xba I.

[0022] As a preferred embodiment, the recombinant expression vector is pIB139.

[0023] In some embodiments of the present invention, the construction process of the expression vector specifically includes: Using the genomic DNA of Streptomyces mobaraensis GL strain as a template, and using primers introducing Nde I and Xba I restriction enzyme sites at both ends (dnaK F:GGGTTTCATATGGCCGTGTACGGCATCGA (SEQ ID NO.2); dnaK R:GCTCTAGATCAGCCGATCCGCTGGCGG (SEQ ID NO.3)), the target gene fragment is obtained by PCR amplification, and the digested target gene fragment ( Nde I, Xba I) is inserted into the Nde I, Xba I sites of the integrative vector pIB139 to obtain the expression vector pIB139-dnaK.

[0024] As a preferred embodiment, the host cell is Streptomyces mobaraensis ( Streptomyces mobaraensis ) GL, and its preservation number is GDMCC No.63755.

[0025] In some embodiments of the present invention, the introduction of the host cell includes conjugation transfer, and the conjugation transfer includes the following steps: (1) Transforming the expression vector into Escherichia coli as the donor bacterium; (2) Scraping the spores of Streptomyces mobaraensis, pre-germinating them in a medium after heat shock, and rinsing them with the medium to use as the recipient bacterium; (3) Mixing the donor bacterium and the recipient bacterium evenly according to a ratio and coating them on the MS solid medium; (4) Verifying the recombinant strain by mycelial PCR.

[0026] In some embodiments of the present invention, in step (1), specifically, the expression vector pIB139-dnaK is transformed into the host Escherichia coli ET12567, and inoculated into LB medium containing three antibiotics, Apr (final concentration 50 μg / mL), Kan (final concentration 25 μg / mL), and Chl (final concentration 25 μg / mL), and cultured at 37 °C for 20 h. Then, the cells are rinsed with fresh LB medium to remove the antibiotics in the culture, and the donor bacteria are obtained.

[0027] In some embodiments of the present invention, in step (2), the spores of Streptomyces mobaraensis are the 7-day culture of Streptomyces mobaraensis GL.

[0028] In some embodiments of the present invention, in step (2), the heat shock temperature is 50 °C; the heat shock time is 10 min; the medium is 2×YT medium; the pre-germination is specifically pre-germination at 37 °C for 2 h.

[0029] In some embodiments of the present invention, in step (3), the donor bacteria and the recipient bacteria are mixed evenly at a volume ratio of 10:1 and then spread on MS solid medium for culture to obtain zygotes.

[0030] In some embodiments of the present invention, in step (4), the zygotes are transferred to ISP4 solid medium containing two antibiotics, 1% apramycin and nalidixic acid, for subculture to obtain single colonies, and the GL-dnaK mutant strain overexpressing the DnaK gene is screened by mycelial PCR verification.

[0031] In some embodiments of the present invention, in step (4), the primers for mycelial PCR verification are as follows: dnaK-CX-F: TGCCGGTTGGTAGGATCCACAT (SEQ ID NO.6); dnaK-CX-R: GCGGCCGCGGATCCTCTAGA (SEQ ID NO.7).

[0032] Another embodiment of the present invention provides a method for producing transglutaminase, including fermenting the above-mentioned engineered bacteria to obtain a fermentation broth, centrifuging to collect the supernatant of the fermentation broth, and obtaining transglutaminase.

[0033] In some embodiments of the present invention, it includes activating the engineered bacteria on Gao's No. 1 medium, culturing at 30 °C for 5-7 d, scraping a plate of spores and inoculating them into the seed medium, culturing at 30 °C and 200 rpm for 18-30 h, inoculating into the fermentation medium, and performing fermentation culture at 30 °C and 200 rpm for 48 h to obtain a fermentation broth, centrifuging to collect the supernatant of the fermentation broth, and obtaining transglutaminase.

[0034] In some embodiments of the present invention, the inoculation concentration is 10% (V / V).

[0035] In some embodiments of the present invention, the formula of Czapek's No. 1 medium is: soluble starch 20 g / L, KNO3 1 g / L, NaCl 0.5 g / L, K2HPO4•3H2O 0.5 g / L, MgSO4•7H2O 0.5 g / L, FeSO4•7H2O 0.01 g / L, agar 20 g / L.

[0036] In some embodiments of the present invention, the formula of the seed medium is: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, MgSO4·H2O 2 g / L, K2HPO4 2 g / L, KH2PO4 2 g / L; the pH of the seed medium is 7.0.

[0037] In some embodiments of the present invention, the formula of the fermentation medium is: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, dried corn steep liquor 20 g / L, KH2PO4 4 g / L, K2HPO4 2 g / L, MgSO4·H2O 2 g / L, NH4Cl 3.2 g / L; the pH of the fermentation medium is 7.0.

[0038] In some embodiments of the present invention, the formula of the MS medium is: mannitol 20 g / L, soybean powder 20 g / L, agar powder 20 g / L, and the initial pH of the MS medium is adjusted to 7.0 with 1 M NaOH solution.

[0039] In some embodiments of the present invention, the formula of the 2×YT medium is: tryptone 16 g / L, yeast extract 10 g / L, sodium chloride 5 g / L.

[0040] In some embodiments of the present invention, the formula of the ISP4 solid medium is: starch 10.0 g / L, K2HPO4 1.0 g / L, MgSO4·7H2O 1.0 g / L, NaCl 1.0 g / L, CaCO3 2.0 g / L, FeSO4·7H2O 0.001 g / L, trace element solution 1 mL, agar 20.0 g / L; wherein the formula of the trace element solution (per liter) is ZnSO4·7H2O 1.0 g, MnCl2·4H2O 1.0 g.

[0041] The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0042] Streptomyces mobaraensis involved in the present inventionStreptomyces mobaraensis ), GL is disclosed in Chinese Patent CN118185837A and is Streptomyces mobaraensis as described in Chinese Patent CN118185837A Streptomyces mobaraensis ), GL, which has been deposited in the Guangdong Provincial Culture Collection Center of Microorganisms under the deposit number GDMCC No.63755 and can be purchased directly from the deposit center

[0043] The plasmid pIB139 involved in the present invention was purchased from Wuhan Miaoling Biotechnology Co., Ltd., and the product number is P0385

[0044] Example 1 Construction of expression vector pIB139-dnaK Refer to Figure 1 the construction process shown below to construct the expression vector pIB139-dnaK. Using the genomic DNA of Streptomyces mobaraensis Streptomyces mobaraensis ), GL strain as a template, and using primers dnaK F / R that introduce Nde I / Xba I restriction sites at both ends, the target gene fragment was obtained by PCR amplification. Among them, the sequence of the DnaK gene fragment is shown in SEQ ID NO.1. Insert the digested amplification fragment ( Nde I / Xba ) into the Nde I / Xba I site of the integrative vector pIB139 (ΦC31 integration site, derived from pSET152, with the ermE* promoter) to obtain the expression vector pIB139-dnaK. The expression vector pIB139-dnaK was sequenced and compared using the universal primers M13 F / M13 R, and the results were correct

[0045] Sequences of primers dnaK F / R: dnaK F:GGGTTTCATATGATGGCCGTGTACGGCATCGA (SEQ ID NO.2); dnaK R:GCTCTAGATCAGCCGATCCGCTGGCGG (SEQ ID NO.3); Sequences of primers M13 F / M13 R: M13 F: GTAAAACGACGGCCAGT (SEQ ID NO.4); M13 R: CAGGAAACAGCTATGAC (SEQ ID NO.5).

[0046] The PCR reaction system of the primers used in the above steps is shown in Table 1, and the PCR reaction conditions are shown in Table 2 Table 1 PCR reaction system

[0047] Table 2 PCR reaction conditions

[0048] Example 2 Construction of an overexpressing DnaK gene mutant of Streptomyces mobaraensis GL (abbreviated as GL-dnaK mutant) The constructed expression vector pIB139-dnaK overexpressing DnaK was introduced into Streptomyces mobaraensis GL by conjugal transfer for site-specific recombination, and the correct conjugants were screened by resistance and PCR verification, thereby obtaining the GL-dnaK mutant with overexpressed DnaK gene. The specific steps are as follows: Transform pIB139-dnaK into the host Escherichia coli ET12567 (purchased from Youbao Biotech). Inoculate the corresponding Escherichia coli ET12567 into LB containing three antibiotics, Apr (final concentration 50 μg / mL), Kan (final concentration 25 μg / mL), and Chl (final concentration 25 μg / mL), and culture at 37°C for 20 h. Then rinse the cells with fresh LB solution to remove the antibiotics in the culture, and collect the bacterial solution as the donor bacteria. At the same time, scrape the fresh spores of Streptomyces mobaraensis GL (7-day culture), heat shock at 50°C for 10 min, then add them to 2×YT medium and pre-germinate at 37°C for 2 h. After rinsing 2-3 times with 2×YT medium, collect the spores as the recipient bacteria, mix them with the previously prepared donor bacteria ET12567 (pIB139-dnaK) (the cell number ratio of the recipient bacteria to the donor bacteria is about 1:10), spread them evenly on MS solid medium containing 10 mM magnesium ions, and culture them inverted in a 30°C incubator. After 16 h, take out the plate, add two antibiotics, apramycin (final concentration 50 μg / mL) and nalidixic acid (final concentration 50 μg / mL), to 1 mL of sterile water, mix well, and cover the MS solid medium. After air-drying the MS solid medium, culture it inverted in a 30°C incubator. Generally, after 3-5 days, conjugants can be seen growing on the plate. Transfer them to ISP4 solid medium containing 1% apramycin and nalidixic acid for expanded culture to obtain single colonies. The GL-dnaK mutant with overexpressed DnaK gene was screened by mycelial PCR verification.

[0049] Among them, using the conjugant mycelium as the DNA template, introducing Nde I / XbaPrimers dnaK-CX F / R for the I restriction enzyme site (dnaK-CX-F: TGCCGGTTGGTAGGATCCACAT (SEQ ID NO.6); dnaK-CX-R: GCGGCCGCGGATCCTCTAGA (SEQ ID NO.7)) were used to screen GL-dnaK mutant strains by PCR verification. The PCR system used is shown in Table 3, and the PCR conditions are shown in Table 4.

[0050] Table 3 PCR reaction system

[0051] Table 4 PCR reaction conditions

[0052] Example 3 Production of transglutaminase This example is about the process of producing transglutaminase using the wild strain of Streptomyces mobaraensis GL (abbreviated as GL strain) and the GL-dnaK mutant strain respectively.

[0053] Fermentation method: The strains were respectively spread on Gause's No.1 medium for activation. After culturing at 30 °C for 5 - 7 days, the spores on one plate were scraped and inoculated into the seed medium, cultured at 30 °C and 200 rpm for 24 h, then transferred to the fermentation medium at an inoculation amount of 10% (volume ratio), and fermented at 30 °C and 200 rpm for 48 h - 72 h to obtain the fermentation broth. The supernatant of the fermentation broth was collected by centrifugation to obtain transglutaminase, and the enzyme activity was detected.

[0054] Example 4 Determination of transglutaminase activity The transglutaminase produced by the GL strain and the GL-dnaK mutant strain in Example 3 was subjected to enzyme activity detection.

[0055] The enzyme activity was determined by the Grossowicz colorimetric method: Reaction solution A: It consists of 0.2 mol / L Tris-HCl (pH 6.0), 0.1 mol / L hydroxylamine hydrochloride, 0.1 mol / L reduced glutathione, and 0.03 mol / L N-α-CBZ-GIn-Gly.

[0056] Termination solution B: It is composed of 3 mol / L hydrochloric acid, 12% (mass fraction) trichloroacetic acid, and 5% (mass fraction) ferric chloride hexahydrate (dissolved in 0.1 mol / L hydrochloric acid) by mixing equal volumes of the three reagents.

[0057] Prepare L-glutamic acid-γ-monohydroxamic acid standard solutions with different concentrations, which are 0, 0.5, 1.0, 2.0, and 4.0 μmol / mL respectively. Then take 1 mL of Reagent A and mix it with 200 μL of each concentration standard solution, incubate in a 37°C water bath for 10 min, then add Reagent B to terminate the reaction, centrifuge at 4°C and 7000 r / min for 10 min, and then measure the absorbance at 525 nm. Plot the standard curve, and the results are as Figure 2 shown. The equation of the standard curve is y = 7.34x + 0.0779, and R 2 = 0.9996.

[0058] Among them, 1 unit of glutamine transaminase activity is defined as: the amount of enzyme required to generate 1 μmol of monohydroxamic acid per 1 min under the condition of reaction at 37°C, and the unit is U / mL.

[0059] When measuring the sample, pipette 200 μL of the supernatant diluted 10 times (prepared in Example 3) and add 1 mL of Reagent A, react at 37°C for 10 min, then add 1 mL of Reagent B to terminate the reaction, centrifuge at 4°C and 7000 r / min for 10 min, and then measure the absorbance at 525 nm. The blank control group is that 200 μL of the sample is first added with Reagent B to terminate the reaction, then reacted at 37°C for 10 min, and then added with Reagent A, and the other operations are the same.

[0060] Based on the above method, the relative enzyme activity of the GL strain containing the empty plasmid pIB139 under the same conditions was measured, and the results are as Figure 3 shown. By comparison, it can be seen that the relative enzyme activity of TGase of the GL-dnaK mutant strain is 1.53 times that of the wild strain at the laboratory shake flask level, indicating that the GL-dnaK mutant strain provided by the present invention can significantly improve the fermentation level of TGase in Streptomyces mobaraensis.

[0061] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. An engineered bacterium with high yield of glutamine transaminase, characterized in that, The engineered bacterium is a strain overexpressing the DnaK gene, and the starting strain of the engineered bacterium is Streptomyces mobaraensis ( Streptomyces mobaraensis ).

2. The engineered bacterium according to claim 1, characterized in that, The nucleotide sequence of the DnaK gene is shown in SEQ ID NO.

1.

3. The method for constructing the engineered bacteria according to any one of claims 1-2, characterized in that, It includes introducing an expression vector containing the DnaK gene into a host cell.

4. The construction method according to claim 3, characterized in that For the said expression vector, its preparation method includes ligating the DnaK gene or its gene expression cassette into a plasmid; The nucleotide sequence of the DnaK gene is shown in SEQ ID NO.

1.

5. The construction method according to claim 4, characterized in that In the construction of the gene expression cassette, the amplification primers include the sequences shown in SEQ ID NO.2-3, and the restriction enzyme digestion and ligation sites are Nde I and Xba I.

6. The construction method according to claim 3, characterized in that The introduction into the host cell includes conjugation transfer, and the conjugation transfer includes the following steps: (1) Transforming the expression vector into Escherichia coli as the donor bacterium; (2) Scraping the spores of Streptomyces mobaraensis, adding them to the medium after heat shock for pre-germination, and rinsing with the medium to use as the recipient bacterium; (3) Mixing the donor bacterium and the recipient bacterium evenly in proportion and spreading them on the MS solid medium; (4) Verifying the recombinant strain by mycelial PCR.

7. Use of the engineered bacterium according to any one of claims 1-2 in the production of transglutaminase.

8. A method for producing transglutaminase, characterized in that, It includes: Taking the engineered bacterium according to any one of claims 1-2 for fermentation, obtaining a fermentation broth, centrifuging to collect the supernatant of the fermentation broth, and obtaining transglutaminase.

9. The method according to claim 8, wherein It includes: Inoculating the recombinant strain on the Gao's No.1 medium for activation, culturing at 30 °C for 5-7 d, scraping the spores of one plate and inoculating them into the seed medium, culturing at 30 °C and 200 rpm for 18-30 h, and then inoculating into the fermentation medium for fermentation culture at 30 °C and 200 rpm.

10. The method according to claim 9, characterized in that, The formula of the Gao's No.1 medium is: soluble starch 20 g / L, KNO3 1 g / L, NaCl 0.5 g / L, K2HPO4•3H2O 0.5 g / L, MgSO4•7H2O 0.5 g / L, FeSO4•7H2O 0.01 g / L, agar 20 g / L; The formula of the seed medium is: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, MgSO4·H2O 2 g / L, K2HPO4 2 g / L, KH2PO4 2 g / L, pH 7.0; The formula of the fermentation medium is: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, dry corn steep liquor 20 g / L, KH2PO4 4 g / L, K2HPO4 2 g / L, MgSO4·H2O 2 g / L, NH4Cl 3.2 g / L; the pH of the fermentation medium is 7.0.

Images