Engineered bacteria with high yield of glutamine transaminase and construction method and application thereof

Abstract

The present application relates to the technical field of genetic engineering, in particular to an engineered bacterium with high yield of glutamine transaminase and a construction method and application thereof. The present application overexpresses DnaK gene in Streptomyces mobaraensis (S. mobaraensis) Streptomyces mobaraensis ) GL to promote the yield of TGase produced by S. mobaraensis, and the relative enzyme activity of TGase of the GL-dnaK mutant strain is 1.53 times that of the wild strain at the laboratory level of a shake flask, which has a good application prospect in the field of producing glutamine transaminase.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to an engineered bacterium that produces high levels of glutamine transaminase, its construction method, and its applications. Background Technology

[0002] Transglutaminase (TGase, EC 2.3.2.13) catalyzes the transamination reaction between the γ-amino group on the glutamine residue of a protein or polypeptide chain and the ε-amino group on the lysine residue or other amino groups on amino-containing substrates, or the deamination reaction with water. In recent years, TGase has shown great promise in many industrial production processes, especially in food processing. Because the covalent cross-links generated by TGase can modify the physicochemical properties of proteins, such as water retention, thermal stability, emulsification, viscosity, and elasticity, it is widely used in meat, dairy, soy, and grain processing. Myosin, casein, whey protein, soy globulin, and gluten in these products are good substrates for TGase. However, the current yield of this enzyme remains low and needs further improvement.

[0003] DnaK protein is an important molecular chaperone for heat shock proteins, playing a crucial role in the proper folding, translation, synthesis, and degradation of many proteins in bacteria. DnaK prevents protein aggregation under stress conditions and helps denatured proteins refold into their correct conformations. Furthermore, DnaK protein plays a key role in bacterial responses to heat stress. Under high temperatures, DnaK protein expression increases significantly, helping cells maintain protein stability and function, thereby enhancing bacterial heat resistance. As a molecular chaperone, DnaK protein not only helps proteins fold and stabilize correctly but also enhances bacterial survival under various environmental stresses. Therefore, the regulatory role of DnaK protein in protein synthesis is pleiotropic. However, whether the DnaK gene affects the production of transglutaminase has not been studied.

[0004] Therefore, investigating the expression of the DnaK gene is of great significance for increasing the production of glutamine transaminase. Summary of the Invention

[0005] In view of this, the present invention provides an engineered bacterium that produces high levels of glutamine transaminase, its construction method, and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] In a first aspect, the present invention provides an engineered bacterium that produces high levels of glutamine transaminase, wherein the engineered bacterium is a strain overexpressing the DnaK gene, and the originating strain of the engineered bacterium is *Streptomyces mobara* (…). Streptomycesmobaraensis ).

[0008] Furthermore, the starting strain of the engineered bacteria is *Streptomyces mobara* (…). Streptomyces mobaraensis The DnaK gene is described in SEQ ID NO.1, with accession number GDMCC No. 63755.

[0009] In a second aspect, the present invention provides a method for constructing the above-mentioned engineered bacteria, comprising introducing an expression vector containing the DnaK gene into a host cell.

[0010] A third aspect of the present invention provides the application of the above-mentioned engineered bacteria in the production of transglutaminase.

[0011] A fourth aspect of the present invention provides a method for producing transglutaminase, comprising fermenting the above-mentioned engineered bacteria to obtain a fermentation broth, centrifuging to collect the supernatant of the fermentation broth, and obtaining transglutaminase.

[0012] The present invention has the following effects:

[0013] This invention relates to *Streptomyces mobara* (… Streptomyces mobaraensis Overexpression of the DnaK gene in GL promoted the production of TGase in *Streptomyces mobara*. At the laboratory shake-flask level, the relative TGase activity of the GL-dnaK mutant strain was 1.53 times that of the wild-type strain. This effect may be attributed to the formation of inclusion bodies during the large-scale TGase production in *Streptomyces mobara*, which affects TGase activity. DnaK, as a molecular chaperone, can bind to approximately 700 different proteins, helping them fold correctly. Simultaneously, during TGase production in *Streptomyces mobara*, the pH rises in the later stages of fermentation, and secondary metabolites also affect cell growth. DnaK overexpression can enhance the cell's resistance to heat, acid, and oxidative stress, enabling it to better adapt to environmental changes and improve production performance. Attached Figure Description

[0014] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0015] Figure 1 This is a schematic diagram of the construction of the expression vector pIB139-dnaK in Embodiment 1 of the present invention;

[0016] Figure 2 This is the standard curve for the determination of glutamine transaminase activity in Example 4 of the present invention;

[0017] Figure 3The relative enzyme activities of glutamine transaminase (TGase) during fermentation of the GL-dnaK mutant strain, GL strain, and empty vector plasmid GL strain in Example 4 of this invention are shown. Detailed Implementation

[0018] This invention discloses an engineered bacterium that produces high levels of glutamine transaminase, its construction method, and its applications. Those skilled in the art can refer to this document and appropriately modify the process parameters to achieve the desired result. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included within the scope of this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0019] In one specific embodiment of the present invention, a high-yield glutamine transaminase engineered bacterium is provided, wherein the engineered bacterium is a strain overexpressing the DnaK gene, and the originating strain of the engineered bacterium is *Streptomyces mobara* (…). Streptomyces mobaraensis ).

[0020] In a preferred embodiment, the starting strain of the engineered bacteria is *Streptomyces mogulata* (…). Streptomyces mobaraensis )GL, with accession number GDMCC No.63755.

[0021] In a preferred embodiment, the nucleotide sequence of the DnaK gene is shown in SEQ ID NO.1.

[0022] In another embodiment of the present invention, a method for constructing the above-mentioned engineered bacteria is provided, comprising introducing an expression vector containing the DnaK gene into a host cell.

[0023] In a preferred embodiment, the expression vector is prepared by ligating the DnaK gene or its gene expression cassette into a plasmid, wherein the nucleotide sequence of the DnaK gene is shown in SEQ ID NO.1.

[0024]

[0025] In a preferred embodiment, the amplification primers used in the construction of the gene expression cassette include the sequences shown in SEQ ID NO. 2-3, and the restriction enzyme ligation site is [missing information]. Nde I and Xba I.

[0026] In a preferred embodiment, the recombinant expression vector is pIB139.

[0027] In some embodiments of the present invention, the process of constructing the expression vector specifically includes:

[0028] Using the genomic DNA of *Streptomyces mobara* strain GL as a template, [the following was used] to introduce [DNA] at both ends. Nde I and Xba Primers for the I restriction site (dnaKF: GGGTTTCATATGGCCGTGTACGGCATCGA (SEQ ID NO.2); dnaKR: GCTTAGATCAGCCGATCCGCTGGCGG (SEQ ID NO.3)) were used to amplify the target gene fragment by PCR, and then integrative vector pIB139. Nde I and Xba Insert the target gene fragment after enzyme digestion at site I ( Nde I, Xba I), to obtain the expression vector pIB139-dnaK.

[0029] In a preferred embodiment, the host cell is *Streptomyces morihara* (…). Streptomyces mobaraensis )GL, with accession number GDMCC No.63755.

[0030] In some embodiments of the present invention, the introduction of host cells includes conjugation transfer, which includes the following steps:

[0031] (1) The expression vector was transformed into Escherichia coli as a donor bacterium;

[0032] (2) Spores of Streptomyces moharas were scraped, heat-shocked, added to the culture medium for pre-germination, and then rinsed with the culture medium to serve as the recipient bacteria;

[0033] (3) Mix the donor bacteria and recipient bacteria evenly according to the ratio and then spread them on MS solid medium;

[0034] (4) Verify the recombinant strain by mycelial PCR.

[0035] In some embodiments of the present invention, step (1) specifically involves transforming the expression vector pIB139-dnaK into the host Escherichia coli ET12567, inoculating it into LB medium containing three antibiotics: Apr (final concentration 50 μg / mL), Kan (final concentration 25 μg / mL), and Chl (final concentration 25 μg / mL), culturing it at 37°C for 20 h, and then rinsing the bacterial cells with fresh LB medium to remove the antibiotics from the culture to obtain the donor bacteria.

[0036] In some embodiments of the present invention, in step (2), the spores of *Streptomyces mobara* are 7-day cultures of *Streptomyces mobara* GL.

[0037] In some embodiments of the present invention, in step (2), the heat shock temperature is 50°C; the heat shock time is 10 min; the culture medium is 2×YT culture medium; and the pre-germination is specifically pre-germination at 37°C for 2 h.

[0038] In some embodiments of the present invention, in step (3), the donor bacteria and the recipient bacteria are mixed evenly at a volume ratio of 10:1 and then spread on MS solid medium for culture to obtain conjugates.

[0039] In some embodiments of the present invention, in step (4), the conjugate is transferred to ISP4 solid medium containing 1% apramycin and natriuretic acid to expand culture and obtain a single colony. The GL-dnaK mutant strain overexpressing the DnaK gene is obtained by mycelial PCR verification and screening.

[0040] In some embodiments of the present invention, the primers for mycelial PCR verification in step (4) are as follows:

[0041] dnaK-CX-F: TGCCGGTTGGTAGGATCCACAT (SEQ ID NO. 6);

[0042] dnaK-CX-R: GCGGCCGCGGATCCTCTAGA (SEQ ID NO. 7).

[0043] Another embodiment of the present invention provides a method for producing transglutaminase, comprising fermenting the above-mentioned engineered bacteria to obtain a fermentation broth, centrifuging to collect the supernatant of the fermentation broth, and obtaining transglutaminase.

[0044] In some embodiments of the present invention, the engineered bacteria are inoculated onto Gao's No. 1 medium for activation, cultured at 30°C for 5-7 days, a plate of spores is scraped off and inoculated into a seed culture medium, cultured at 30°C and 200 rpm for 18-30 hours, inoculated into a fermentation medium, and fermented at 30°C and 200 rpm for 48 hours to obtain a fermentation broth. The supernatant of the fermentation broth is collected by centrifugation to obtain transglutaminase.

[0045] In some embodiments of the present invention, the inoculation concentration is 10% (V / V).

[0046] In some embodiments of the present invention, the formulation of Gao's No. 1 culture medium is as follows: soluble starch 20 g / L, KNO3 1 g / L, NaCl 0.5 g / L, K2HPO4•3H2O 0.5 g / L, MgSO4•7H2O 0.5 g / L, FeSO4•7H2O 0.01 g / L, and agar 20 g / L.

[0047] In some embodiments of the present invention, the seed culture medium is formulated as follows: glycerol 20 g / L, peptone 20 g / L, yeast extract 5 g / L, MgSO4·H2O 2 g / L, K2HPO4 2 g / L, KH2PO4 2 g / L; the pH of the seed culture medium is 7.0.

[0048] In some embodiments of the present invention, the fermentation medium is formulated as follows: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, corn steep liquor powder 20 g / L, KH2PO4 4 g / L, K2HPO4 2 g / L, MgSO4·H2O 2 g / L, NH4Cl 3.2 g / L; the pH of the fermentation medium is 7.0.

[0049] In some embodiments of the present invention, the MS medium is formulated as follows: mannitol 20 g / L, soybean flour 20 g / L, agar powder 20 g / L, and the initial pH of the MS medium is adjusted to 7.0 using 1 M NaOH solution.

[0050] In some embodiments of the present invention, the formulation of 2×YT culture medium is: 16 g / L tryptone, 10 g / L yeast extract, and 5 g / L sodium chloride.

[0051] In some embodiments of the present invention, the formulation of ISP4 solid culture medium is as follows: starch 10.0 g / L, K2HPO4 1.0 g / L, MgSO4·7H2O 1.0 g / L, NaCl 1.0 g / L, CaCO3 2.0 g / L, FeSO4·7H2O 0.001 g / L, trace element solution 1 mL, agar 20.0 g / L; wherein the trace element solution formulation (per liter) is ZnSO4·7H2O 1.0 g, MnCl2·4H2O 1.0 g.

[0052] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0053] The *Streptomyces mobara* involved in this invention ( Streptomyces mobaraensis )GL is disclosed in Chinese patent CN118185837A, and is the *Streptomyces morihara* described in Chinese patent CN118185837A ( Streptomyces mobaraensis )GL has been deposited at the Guangdong Provincial Center for Microbial Culture Collection, accession number GDMCC No. 63755, and can be purchased from the collection center.

[0054] The plasmid pIB139 involved in this invention was purchased from Wuhan Miaoling Biotechnology Co., Ltd., catalog number: P0385.

[0055] Example 1: Construction of expression vector pIB139-dnaK

[0056] refer to Figure 1 The construction process shown illustrates the construction of the expression vector pIB139-dnaK. Using *Streptomyces moharawata* (… Streptomyces mobaraensis Using the genomic DNA of strain GL as a template, the mixture was introduced at both ends. Nde I / Xba Primers for the I restriction site dnaK F / R were used to amplify the target gene fragment by PCR. The sequence of the DnaK gene fragment is shown in SEQ ID NO.1. The fragment was then amplified using the integrative vector pIB139 (ΦC31 integration site, pSET152 derived, with the ermE* promoter). Nde I / Xba The amplified fragment after enzyme digestion was inserted at site I. Nde I / Xba I) The expression vector pIB139-dnaK was obtained. The expression vector pIB139-dnaK was sequenced and aligned using universal primers M13 F / M13 R, and the results were correct.

[0057] Primer dnaK F / R sequence:

[0058] dnaK F:GGGTTTCATATGATGGCCGTGTACGGCATCGA (SEQ ID NO. 2);

[0059] dnaK R:GCTCTAGATCAGCCGATCCGCTGGCGG (SEQ ID NO. 3);

[0060] Primer M13 F / M13 R sequence:

[0061] M13 F: GTAAAACGACGGCCAGT (SEQ ID NO.4);

[0062] M13 R: CAGGAAACAGCTATGAC (SEQ ID NO. 5).

[0063] The primer PCR reaction system used in the above steps is shown in Table 1, and the PCR reaction conditions are shown in Table 2.

[0064] Table 1 PCR reaction system

[0065]

[0066] Table 2 PCR reaction conditions

[0067]

[0068] Example 2: Construction of a Streptomyces mobara GL mutant strain overexpressing the DnaK gene (hereinafter referred to as GL-dnaK mutant strain)

[0069] The constructed DnaK overexpression vector pIB139-dnaK was introduced into *Streptomyces mobara* GL via conjugation transfer for site-specific recombination. Correct conjugates were screened using resistance testing and PCR verification to obtain the GL-dnaK mutant strain overexpressing the DnaK gene. The specific steps include:

[0070] pIB139-dnaK was transformed into host Escherichia coli ET12567 (purchased from UBO Biotechnology). The corresponding E. coli ET12567 was inoculated into LB containing three antibiotics: Apr (final concentration 50 μg / mL), Kan (final concentration 25 μg / mL), and Chl (final concentration 25 μg / mL). The culture was incubated at 37°C for 20 h. The bacterial cells were then rinsed with fresh LB solution to remove the antibiotics from the culture, and the bacterial culture was collected as the donor bacteria. Simultaneously, fresh spores of *Streptomyces moharaja* GL (7-day culture) were scraped, heat-shocked at 50°C for 10 min, and then added to 2×YT medium for pre-germination at 37°C for 2 h. After rinsing 2-3 times with 2×YT medium, the spores were collected as recipient bacteria and mixed with the previously prepared donor bacteria ET12567 (pIB139-dnaK) (the ratio of recipient bacteria cells to donor bacteria cells was approximately 1:10). The mixture was then spread evenly on MS solid medium containing 10 mM magnesium ions and incubated upside down at 30°C. After 16 h, the plates were removed, and apramycin (final concentration 50 μg / mL) and nalidixic acid (final concentration 50 μg / mL) were added to 1 mL of sterile water, mixed well, and then spread onto the MS solid medium. The MS solid medium was then dried and incubated upside down at 30°C. After 3-5 days, conjugates can usually be seen growing on the plate. These conjugates are then transferred to ISP4 solid medium containing 1% apramycin and nalidixic acid for expansion culture to obtain single colonies. The GL-dnaK mutant strain overexpressing the DnaK gene is then screened and verified by mycelial PCR.

[0071] Among them, the mycelium of the conidia is used as a DNA template, and DNA is introduced at both ends. Nde I / Xba Primers for the I restriction site dnaK-CX F / R (dnaK-CX-F: TGCCGGTTGGTAGGATCCACAT (SEQ ID NO.6); dnaK-CX-R: GCGGCCGCGGATCCTCTAGA (SEQ ID NO.7)) were used to screen for GL-dnaK mutant strains by PCR verification. The PCR system used is shown in Table 3, and the PCR conditions are shown in Table 4.

[0072] Table 3 PCR reaction system

[0073]

[0074] Table 4 PCR reaction conditions

[0075]

[0076] Example 3 Production of transglutaminase

[0077] This embodiment describes the process of producing glutamine transaminase using the wild-type Streptomyces moharawiryans GL strain (hereinafter referred to as GL strain) and the GL-dnaK mutant strain, respectively.

[0078] Fermentation method: The strains were plated on Gao's No. 1 medium for activation and cultured at 30℃ for 5-7 days. Spores were scraped from a plate and inoculated into seed culture medium and cultured at 30℃ and 200 rpm for 24 h. The inoculum was then transferred to fermentation medium at a rate of 10% (volume ratio) and fermented at 30℃ and 200 rpm for 48-72 h to obtain the fermentation broth. The supernatant of the fermentation broth was collected by centrifugation, which yielded transglutaminase, and its enzyme activity was detected.

[0079] Example 4: Assay of Glutamine Transaminase Activity

[0080] The enzyme activity of transglutaminase produced by the GL strain and the GL-dnaK mutant strain in Example 3 was detected.

[0081] Enzyme activity was determined using the Grossowicz colorimetric method.

[0082] Reaction solution A consists of 0.2 mol / L Tris-HCl (pH 6.0), 0.1 mol / L hydroxylamine hydrochloride, 0.1 mol / L reduced glutathione, and 0.03 mol / L N-α-CBZ-GIn-Gly.

[0083] Termination solution B: It is a mixture of equal volumes of three reagents: 3 mol / L hydrochloric acid, 12% trichloroacetic acid (mass fraction), and 5% ferric chloride hexahydrate (mass fraction) (dissolved in 0.1 mol / L hydrochloric acid).

[0084] Prepare L-glutamic acid-γ-monoisohydroxamic acid standard solutions of different concentrations: 0, 0.5, 1.0, 2.0, and 4.0 μmol / mL. Then, mix 1 mL of reagent A with 200 μL of each concentration standard solution, incubate at 37℃ for 10 min, then add reagent B to terminate the reaction. Centrifuge at 4℃, 7000 r / min for 10 min, and measure the color at 525 nm. Plot a standard curve; the results are shown below. Figure 2 As shown, the equation of the standard curve is y = 7.34x + 0.0779, R0 2 =0.9996.

[0085] One unit of transglutaminase activity is defined as the amount of enzyme required to generate 1 μmol of monohydroxyxamic acid per minute under 37°C conditions, expressed in U / mL.

[0086] For sample determination, 200 μL of the supernatant diluted 10 times (prepared in Example 3) was transferred, 1 mL of reagent A was added, and the reaction was carried out at 37°C for 10 min. Then, 1 mL of reagent B was added to terminate the reaction. After centrifugation at 4°C and 7000 r / min for 10 min, the sample was measured at 525 nm. The blank control group consisted of 200 μL of sample, which was first reacted with reagent B at 37°C for 10 min, and then reagent A was added. All other procedures were the same.

[0087] The relative enzyme activities of GL strains containing the empty vector pIB139 were determined under the same conditions using the above method, and the results are as follows: Figure 3 As shown in the figure, the comparison shows that the relative TGase activity of the GL-dnaK mutant strain is 1.53 times that of the wild strain at the laboratory shake flask level, indicating that the GL-dnaK mutant strain provided by the present invention can significantly improve the fermentation level of TGase in Streptomyces mobara.

[0088] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An engineered bacterium that produces high levels of transglutaminase, characterized in that, The engineered bacteria are strains that overexpress the DnaK gene, and the originating strain of the engineered bacteria is *Streptomyces mobara*. Streptomyces mobaraensis The DnaK gene is described in SEQ ID NO.1, with accession number GDMCC No. 63755.

2. The method for constructing engineered bacteria according to claim 1, characterized in that, This includes introducing an expression vector containing the DnaK gene into host cells.

3. The construction method as described in claim 2, characterized in that, The expression vector is prepared by ligating the DnaK gene or its gene expression cassette into a plasmid. The nucleotide sequence of the DnaK gene is shown in SEQ ID NO.

1.

4. The construction method as described in claim 3, characterized in that, In the construction of the gene expression cassette, the amplification primers are the sequences shown in SEQ ID NO.2-3, and the restriction enzyme ligation sites are... Nde I and Xba I.

5. The construction method as described in claim 2, characterized in that, The introduction of host cells includes conjugation transfer, which includes the following steps: (1) The expression vector was transformed into Escherichia coli as a donor bacterium; (2) Spores of Streptomyces moharas were scraped, heat-shocked, added to the culture medium for pre-germination, and then rinsed with the culture medium to serve as the recipient bacteria; (3) Mix the donor bacteria and recipient bacteria evenly according to the ratio and then spread them on MS solid medium; (4) Verify the recombinant strain by mycelial PCR.

6. The application of the engineered bacteria according to claim 1 in the production of transglutaminase.

7. A method for producing transglutaminase, characterized in that, include: The engineered bacteria described in claim 1 are fermented to obtain a fermentation broth. The supernatant of the fermentation broth is collected by centrifugation to obtain transglutaminase.

8. The method as described in claim 7, characterized in that, include: The engineered bacteria were inoculated onto Gao's No. 1 medium for activation and cultured at 30°C for 5-7 days. A plate of spores was scraped off and inoculated into a seed culture medium. The culture was carried out at 30°C and 200 rpm for 18-30 hours. The culture was then inoculated into a fermentation medium and fermented at 30°C and 200 rpm.

9. The method as described in claim 8, characterized in that, The formula of the Gao's No. 1 culture medium is as follows: soluble starch 20 g / L, KNO3 1 g / L, NaCl 0.5 g / L, K2HPO4•3H2O 0.5 g / L, MgSO4•7H2O 0.5 g / L, FeSO4•7H2O 0.01 g / L, agar 20 g / L; The seed culture medium is formulated as follows: glycerol 20 g / L, peptone 20 g / L, yeast extract 5 g / L, MgSO4·H2O 2 g / L, K2HPO4 2 g / L, KH2PO4 2 g / L, pH 7.0; The fermentation medium has the following formula: glycerol 20 g / L, peptone 20 g / L, yeast powder 5 g / L, corn steep liquor powder 20 g / L, KH2PO4 4 g / L, K2HPO4 2 g / L, MgSO4·H2O 2 g / L, NH4Cl 3.2 g / L; the pH of the fermentation medium is 7.0.

Images