STING gene knockout TIL with enhanced antineoplastic activity and preparation method and application of STING gene knockout TIL

By knocking out the STING gene in immune cells and silencing STING expression using CRISPR/Cas9 technology, the problem of low immune response rate in TIL cell therapy was solved, the tumor-killing ability and survival time of CD8+ T cells were enhanced, and a highly efficient tumor treatment effect was achieved.

CN121801840APending Publication Date: 2026-04-07SUN YAT SEN UNIVERSITY CANCER CENTER (CANCER HOSPITAL AFFILIATED TO SUN YAT SEN UNIVERSITY CANCER RESEARCH INSTITUTE OF SUN YAT SEN UNIVERSITY)

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2026-01-06
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Current TIL cell therapy has a low immune response rate, CD8+ T cell function is suppressed in the tumor microenvironment, and there is a lack of effective gene editing targets to enhance anti-tumor effects.

Method used

By knocking out the STING gene in immune cells (such as CD8+ T cells) and silencing its expression using CRISPR/Cas9 technology, iron ion concentration and lipid peroxide content are reduced, thereby enhancing the anti-tumor function of immune cells.

Benefits of technology

It significantly enhanced the tumor-killing ability of CD8+ T cells, prolonged their survival time in the tumor microenvironment, improved the efficacy of TIL adoptive cell immunotherapy, and had good safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121801840A_ABST
    Figure CN121801840A_ABST
Patent Text Reader

Abstract

The invention relates to an STING gene knockout TIL capable of enhancing anti-tumor activity and a preparation method and application of the TIL, in particular to a genetically engineered immune cell, and an STING gene in the genetically engineered immune cell is silenced or down-regulated. The ferroptosis resistance of the immune cell provided by the invention is remarkably enhanced, the immune cell can be better infiltrated into a tumor microenvironment, and the immune cell has a remarkable anti-tumor effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to STING gene knockout TILs with enhanced antitumor activity, their preparation methods, and applications. Background Technology

[0002] TIL (tumor-infiltrating lymphocyte) therapy is an immunotherapy regimen in which T cells that have recognized tumor antigens are isolated from the patient's tumor tissue, expanded in vitro, and then reinfused into the patient. Because TILs originate from the patient's own body, compared to treatments such as TCR-T and CAR-T, TIL cell therapy has advantages in high antigen specificity, high tumor chemotaxis, low side effects, and good safety profile, making it particularly beneficial for solid tumors.

[0003] In recent years, the number of clinical trials of TIL immunotherapy conducted both domestically and internationally has gradually increased, and its safety and efficacy have been demonstrated in solid tumors such as melanoma, breast cancer, and cervical cancer. In 2024, the world's first TIL cell therapy, AMTAGVI (lifileucel), received accelerated approval from the FDA for the treatment of advanced melanoma that has relapsed after PD-1 / PD-L1 therapy. However, the practical application of TIL cell therapy still faces many challenges, including low immune response rates and unsatisfactory results from monotherapy. For example, in patients with metastatic non-small cell lung cancer who have progressed after immunotherapy, the objective response rate (ORR) of TIL cell therapy was only 21.4%, and in HPV-associated epithelial carcinoma, the ORR was only 24%. Therefore, enhancing the immune response rate of TIL cell therapy and improving its tumor-killing ability are urgent scientific problems that need to be addressed.

[0004] The number and functional status of CD8+ T cells within the tumor microenvironment often determine the prognosis and survival of cancer patients. However, CD8+ T cells, influenced by the highly suppressive tumor microenvironment, often fail to efficiently perform their tumor-killing function. Enhancing the anti-tumor immune function of CD8+ T cells through gene editing is a feasible and efficient method, but currently, the number of gene editing targets that can effectively improve CD8+ T cell function remains very limited.

[0005] In summary, although the concept of enhancing the anti-tumor ability of immune cells through gene editing has been proposed, how to select better gene knockout targets to achieve safer, more durable and more powerful anti-tumor effects in specific immune cell types remains a key technical problem that urgently needs to be solved in this field. Summary of the Invention

[0006] The problem the invention aims to solve To address the shortcomings of the prior art mentioned above, this invention provides gene editing targets that can enhance the anti-tumor function of immune cells (e.g., CD8+ T cells). This invention improves the anti-tumor function of immune cells by knocking out the STING gene in immune cells (e.g., CD8+ T cells).

[0007] Solution for solving the problem On the one hand, the present invention provides a genetically engineered immune cell in which the expression of the STING gene is silenced.

[0008] Preferably, the immune cells include phagocytes, lymphocytes, neutrophils, eosinophils, and / or basophils.

[0009] Preferably, the immune cells include monocytes, macrophages, and / or dendritic cells.

[0010] Preferably, the immune cells include B cells, T cells, natural killer cells and / or natural killer T cells (NKT).

[0011] Preferably, the immune cells are T cells, and more preferably, the T cells are CD8+ T cells.

[0012] Preferably, the immune cells are tumor-infiltrating lymphocytes (TILs).

[0013] Preferably, the tumor-infiltrating lymphocytes are derived from tumor tissue, tumor-associated lymphoid tissue with or without tumor metastasis, metastatic lesions, fragments of adjacent tissue, pleural effusion and / or peritoneal effusion, and / or from TILs that have been cryopreserved and then revived.

[0014] Preferably, the genetically engineered immune cells have one or more characteristics selected from the following: (a) The expression of the STING gene in the genetically engineered immune cells is silenced; (b) The iron concentration in the genetically engineered immune cells is reduced; (c) The content of lipid peroxides in the genetically engineered immune cells is reduced.

[0015] Preferably, the genetically engineered immune cells are derived from humans or non-human mammals.

[0016] On one hand, the present invention provides a gene editing reagent for preparing genetically engineered immune cells as described above, the gene editing reagent comprising: (1) A gene-editing protein or its expression vector, wherein the gene-editing protein is selected from the group consisting of: CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or combinations thereof; and (2) gRNA or its expression vector, wherein the gRNA is a nucleotide sequence that guides the gene editing protein to specifically bind to the STING gene.

[0017] Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO.1 or 2, or its complementary sequence.

[0018] On one hand, the present invention provides a method for preparing genetically engineered immune cells as described in any one of the above claims, the method comprising: (1) Provide immune cells to be modified; and (2) Modify the immune cells to silence the expression of the STING gene in the immune cells, thereby obtaining the genetically engineered immune cells as described in any one of claims 1 to 6.

[0019] On one hand, the present invention provides a pharmaceutical composition comprising genetically engineered immune cells as described in any of the preceding claims, and optionally, a pharmaceutically acceptable carrier.

[0020] On the one hand, the present invention provides the use of the genetically engineered immune cells described in any of the above claims, or the gene editing reagents described above, or the pharmaceutical compositions described above in the preparation of a medicament for treating tumors.

[0021] The effects of the invention This invention is the first to investigate the function of STING in tumor immunity. It found that knocking out the STING gene on human and mouse CD8+ T cells enhances the ferroptosis resistance of CD8+ T cells, improves their inhibitory effect on the tumor microenvironment, promotes their infiltration into the tumor microenvironment, and thus prolongs the in vivo survival time and tumor-killing function of TILs. Furthermore, it was found that modifying the TIL gene with a STING-knockout recombinant lentivirus (Lenti-sgSTING) can improve the efficacy of adoptive cell immunotherapy with TILs in preclinical animal tumor models. Moreover, STING gene deletion has no significant adverse effects on mice, demonstrating good safety.

[0022] The method for preparing immune cells provided by this invention is simple, effective, and low in cost, and the prepared immune cells have a sustained and highly efficient tumor-suppressing effect. Attached Figure Description

[0023] Figure 1The results show the expression levels of the STING gene in Sting1-cKO mice and isotype wild-type WT mice. A is a schematic diagram of the Sting1-cKO mouse construction, and B is the expression level of CD8 in Sting1-cKO mice and isotype wild-type WT mice. -cre Mice and STING1 flox / flox The results of agarose gel electrophoresis identification of mice are shown in C, which represents the qPCR detection results of the downstream pathway of the Sting1 gene on CD8+ T cells and CD4+ T cells of Sting1-cKO mice and their isotype control mice, and D represents the immunoblotting results of the expression level of the STING1 gene on CD4+ T cells, CD8+ T cells and B cells derived from Sting1-cKO mice.

[0024] Figure 2 The figure shows the effect of STING-cKO mice and isotype control mice on the growth of MC38 cell line xenografts. In the figure, A is the growth curve of subcutaneous tumors in isotype control mice and STING-cKO mice, B is the bar chart of the statistical results of subcutaneous tumor quality in isotype control mice and STING-cKO mice, and C is the schematic diagram of the subcutaneous tumor anatomy results in isotype control mice and STING-cKO mice.

[0025] Figure 3 Map of recombinant lentiviral vectors targeting human STING.

[0026] Figure 4 The diagram illustrates the enhanced ferroptosis resistance of CD8+STING gene knockout T cells. A shows the expression levels of STING signaling pathway-related proteins (p-TBK1, p-IRF3) detected by Western blotting; B shows the apoptosis rate of CD8+ T cells detected by flow cytometry; C shows the lipid peroxide content of CD8+ T cells detected by flow cytometry; and D shows the intracellular Fe content of CD8+ T cells detected by flow cytometry. 2+ content.

[0027] Figure 5 This diagram illustrates the anti-tumor effect of STING gene knockout TIL derived from human cervical cancer in a tumor-bearing nude mouse xenograft model. In the diagram, A is a flowchart of the animal experiment, B is a schematic diagram of the subcutaneous tumor growth curves of different groups of nude mice, and the arrows indicate the time points of treatment with STING-KO-TIL or Mock-TIL. C is a schematic diagram of the statistical results of subcutaneous tumor weight in different groups of nude mice, and D is a schematic diagram of the anatomical results of subcutaneous tumors in different groups of nude mice. Detailed Implementation

[0028] To make the technical solution and beneficial effects of the present invention more apparent and understandable, a detailed description is provided below by listing specific embodiments. The accompanying drawings are not necessarily drawn to scale, and local features may be enlarged or reduced to more clearly show the details of the local features; unless otherwise defined, the technical and scientific terms used herein have the same meanings as those in the technical field to which this application pertains.

[0029] The STING signaling pathway is a core component of innate immunity and one of the main ways innate immune cells resist bacterial and viral infections. Cell-free DNA released by pathogens or tumor cells activates the cGAS-STING cascade within immune cells, inducing the production of type I interferons (such as IFN-β) and inflammatory factors, thereby initiating an antiviral immune response and inhibiting pathogen replication. However, in the process of antitumor immunity, excessive activation of the endogenous STING signaling pathway on T cells can lead to T cell proliferation inhibition and activating cell death, thus promoting immune escape.

[0030] Through extensive and in-depth research, the inventors have developed a STING gene-deficient immune cell, its preparation method, and its applications. This invention reveals that STING gene deletion in mouse CD8+ T cells significantly inhibits tumor growth, reduces the concentration of ferrous ions within CD8+ T cells, and simultaneously inhibits the content of lipid peroxides within the cells, thereby enhancing the tumor microenvironment's resistance to ferroptosis and demonstrating a good therapeutic effect on tumors. In vivo experiments have confirmed that STING gene deletion in CD8+ T cells is safe for the body. Based on these findings, this invention was completed.

[0031] STING gene STING (stimulator of interferon genes), also known as MITA, MPYS, ERIS, and TMEM173, is a four-transmembrane protein mainly distributed in immune-related tissues and cells. It is highly expressed in the thymus, spleen, and peripheral blood cells. This protein is mainly located in the endoplasmic reticulum (ER) and mitochondria and is a major component of the innate immune system. Cytoplasmic DNA (regardless of whether it originates from viruses, bacteria, or the organism itself) can bind to the enzyme cyclic GMP-AMP synthase (cGAS) to form cGAMP (a cyclic dinucleotide, abbreviated as CDN). The dimerized STING binds to this CDN, undergoing a conformational change that activates the downstream transcription factor TBK1 (STAT-6, NF-κB), recruiting and phosphorylating the transcription factor IRF3. This leads to the killing of tumor cells and viruses by interferon (IFN) (mainly type I IFN) and various other cytokines (including TNFα, IL6, etc.). This constitutes the cGAS-cGAMP-STING signaling pathway.

[0032] Silencing the expression of the STING gene As used in this article, "silencing of STING gene expression" refers to the absence or low expression of the STING gene. "Low expression" refers to the ratio of the expression level G1 of the STING gene in modified immune cells to the expression level G0 of the STING gene in normal immune cells, i.e., G1 / G0 ≤ 0.8, preferably G1 / G0 ≤ 0.5, more preferably ≤ 0.2, even more preferably ≤ 0.1, and optimally 0.

[0033] The methods for silencing the STING gene in this invention include CRISPR / Cas9, RNA interference, transcription activator-like (TAL) effector nucleases, and zinc finger nucleases (ZFNs). In a preferred embodiment, this invention uses CRISPR / Cas9 and RNA interference to downregulate or silence the STING gene. In this invention, gene editors can be used to achieve gene silencing or downregulation. The gene editors include DNA gene editors and RNA gene editors. In a preferred embodiment, the gene editor of this invention includes a gene-editing protein and optionally gRNA.

[0034] In this invention, the nucleotides of the gene-editing protein can be obtained through genetic engineering techniques, such as genome sequencing and polymerase chain reaction (PCR), and its amino acid sequence can be deduced from the nucleotide sequence. In a preferred embodiment of this invention, the gene-editing protein includes, but is not limited to, Cas13 (such as CasRx), Cpf1, SaCas9, Cas13a, Cas13b, and Cas13c.

[0035] As used herein, the terms “genetic engineering,” “gene editing,” or “engineering” refer to methods of modifying the genome of a cell, including but not limited to deleting coding or non-coding regions or portions thereof, or inserting coding regions or portions thereof. In some embodiments, the modified cells are lymphocytes, such as T cells, which may be obtained from a patient or donor. Cells may be modified to express exogenous constructs incorporated into the genome of that cell, such as chimeric antigen receptors (CARs) or T-cell receptors (TCRs).

[0036] As used herein, the term "tumor-infiltrating lymphocytes" or "TIL" generally refers to a cell population initially obtained as leukocytes, whose cells have left the subject's bloodstream and migrated into the tumor. TILs may include, but are not limited to, CD8 cytotoxic T cells (lymphocytes), Th1 and Th17 CD4+ T cells, natural killer cells, dendritic cells, and M1 macrophages. TILs may include primary TILs and secondary TILs. "Primary TILs" can be those TIL cells obtained from a subject's tissue sample, and "secondary TILs" can be any TIL population that has been expanded or amplified in this invention. In some embodiments, the tumor-infiltrating lymphocytes of this invention may be unisolated and unpurified, or may be interinfiltrating with tumor cells. In one embodiment, the TILs of this invention may refer to a purified collection of tumor tissue-derived T cells.

[0037] The present invention provides a genetically engineered immune cell in which the STING gene is silenced.

[0038] In some embodiments, the immune cells include phagocytes, lymphocytes, neutrophils, eosinophils, and / or basophils.

[0039] In some embodiments, the immune cells include monocytes, macrophages, and / or dendritic cells.

[0040] In some embodiments, the mononuclear cells are peripheral blood mononuclear cells (PBMCs).

[0041] In some embodiments, the immune cells include B cells, T cells, natural killer cells, and / or natural killer T cells (NKT).

[0042] In some embodiments, the immune cells are T cells.

[0043] In some embodiments, the T cells are CD8+ T cells.

[0044] In some embodiments, the immune cells include allogeneic and autologous sources.

[0045] In some embodiments, the immune cells are tumor-infiltrating lymphocytes (TILs).

[0046] In some embodiments, the TIL is derived from tumor tissue, tumor-associated lymph nodes with or without tumor metastasis, metastatic lesions, fragments of adjacent tissue, pleural effusion and / or ascites, and / or TIL derived from cryopreservation followed by thawing.

[0047] For example, the TIL of the present invention can be obtained by processing tumor tissue into tumor fragments.

[0048] In some implementations, the genetically engineered immune cells exhibit significantly lower iron concentrations compared to immune cells that have not undergone STING gene silencing or downregulation.

[0049] In some embodiments, the lipid peroxide content in the genetically engineered immune cells is significantly reduced compared to immune cells that have not undergone STING gene silencing or downregulation.

[0050] In some embodiments, the genetically engineered immune cells are derived from humans or non-human mammals (e.g., rodents).

[0051] In some embodiments, the genetically engineered immune cells are obtained through gene editing methods, preferably by knocking out the STING gene with sgRNA. In one embodiment, the sgRNA targets sequences as shown in SEQ ID NO:1 and / or SEQ ID NO:2.

[0052] In some implementations, STING gene expression is silenced or downregulated by introducing a gene regulatory system into the cell.

[0053] In some embodiments, the gene regulation system includes a guide nucleic acid molecule (gRNA) and a gene editing protein.

[0054] In some embodiments, a complex comprising the guide nucleic acid molecule and the gene-editing protein, or a complex comprising the guide nucleic acid molecule and a nucleic acid encoding the gene-editing protein, is introduced into the cell.

[0055] In some embodiments, the gene-editing protein comprises Cas protein, Cas protein homologues, or functionally active fragments thereof.

[0056] In some embodiments, the gene-editing protein is selected from CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or combinations thereof.

[0057] In some embodiments, the gRNA is sgRNA.

[0058] In some embodiments, the nucleotide sequence of the gRNA is as shown in SEQ ID NO.1 or 2, or its complementary sequence.

[0059] On one hand, the present invention provides a gene editing reagent for preparing genetically engineered immune cells as described in any of the above claims, the gene editing reagent comprising: (1) A gene-editing protein or its expression vector, wherein the gene-editing protein is selected from the group consisting of: CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or combinations thereof; and (2) gRNA or its expression vector, wherein the gRNA is a nucleotide sequence that guides the gene editing protein to specifically bind to the STING gene.

[0060] The guide RNA described in this invention may include single-stranded guide RNA (sgRNA) or double-stranded guide RNA composed of crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA). In some embodiments, the guide RNA is a double-stranded structure consisting of one crRNA and one tracrRNA. The crRNA generally contains a guide sequence and a tracr mating sequence, and the tracrRNA generally contains a tracr sequence.

[0061] In some embodiments, the nucleotide sequence of the gRNA is as shown in SEQ ID NO.1 or 2, or its complementary sequence.

[0062] On one hand, the present invention provides a method for preparing genetically engineered immune cells as described in any one of the above claims, the method comprising: (1) Provide immune cells to be modified; and (2) Modify the immune cells to silence the expression of the STING gene in the immune cells, thereby obtaining the genetically engineered immune cells as described in any of the above.

[0063] In some embodiments, the immune cells to be modified include monocytes, macrophages, and / or dendritic cells.

[0064] In some embodiments, the mononuclear cells are peripheral blood mononuclear cells (PBMCs).

[0065] In some embodiments, the immune cells to be modified include B cells, T cells, natural killer cells, and / or natural killer T cells (NKT).

[0066] In some embodiments, the immune cells to be modified are T cells.

[0067] In some embodiments, the T cells are CD8+ T cells.

[0068] In some embodiments, the immune cells to be modified include allogeneic and autologous sources.

[0069] In some embodiments, the immune cells to be modified are tumor-infiltrating lymphocytes (TILs).

[0070] In some embodiments, in step (2), the gene-editing reagent described above is introduced into the immune cells to knock out the STING gene. The preparation method can employ any conventional method known in the art to introduce the reagent for editing the STING gene into the immune cells, including, but not limited to, liposome delivery, nanoparticle delivery, vector, transfection, heat shock, electroporation, transduction, gene gun, or microinjection. Optionally, the reagent for editing the STING gene comprises an RNP complex formed by Cas nuclease and gRNA, which is introduced into the immune cells to be edited via electroporation.

[0071] In some implementations, TILs derived from tumor tissue, tumor-associated lymph nodes with or without tumor metastasis, metastatic lesions, fragments of adjacent tissue, pleural effusion and / or ascites, and which have not been amplified in vitro, undergo a first-stage in vitro amplification and a second-stage in vitro amplification, during which the STING gene is silenced or expressed at low levels.

[0072] In some embodiments, the first stage of in vitro expansion includes preparing a single-cell suspension of TILs derived from tumor tissue, tumor-associated lymphoid tissue with or without tumor metastasis, metastatic lesions, fragments of adjacent normal tissue, pleural effusion and / or ascites that have not been expanded in vitro. After separation, the TILs are cultured in human lymphocyte culture medium containing 1000-2000 IU / mL rhIL-2. Cells are then seeded at a rate of 5E6 cells / well and cultured in X-VIVO medium without IL-2. Subsequently, the constructed recombinant lentivirus containing STING knockout sgRNA is transfected into the cells. After a period of culture, rh-IL2 is added to the culture medium to a final concentration of 2000 IU / mL, and the cells are cultured for a further period of time to obtain recombinant lentivirus-modified TILs.

[0073] In some implementations, the second stage of in vitro expansion includes co-culturing X-ray-irradiated feeder cells with TILs modified by recombinant lentivirus to obtain genetically engineered TIL cells.

[0074] In some embodiments, the intensity of the irradiation is 200-250 Gy, such as 210 Gy, 220 Gy, 230 Gy, 240 Gy, 250 Gy, etc.

[0075] In some implementations, the ratio of feeder cells to recombinant lentivirus-modified TILs is 1:30 to 50, for example, 1:30, 1:35, 1:40, 1:45, or 1:50.

[0076] In some implementations, the co-culture medium is X-VIVO medium containing rhIL-2.

[0077] In some embodiments, the final concentration of rhIL-2 in X-VIVO medium is 3000~6000 IU / mL, such as 3000 IU / mL, 3500 IU / mL, 4000 IU / mL, 4500 IU / mL, 5000 IU / mL, 5500 IU / mL, 6000 IU / mL, etc.

[0078] Methods for introducing genes into cells and expressing genes into cells are known in the art. Within the scope of expression vectors, the vector can be readily introduced into host cells, such as mammalian, bacterial, yeast, or insect cells, by any method in the art. For example, expression vectors can be transferred into host cells by physical, chemical, or biological means.

[0079] Biological approaches to introducing polynucleotides of interest into host cells include the use of DNA and RNA vectors. Viral vectors, particularly retroviral vectors, have become the most widely used method for inserting genes into mammalian cells, such as human cells. Other viral vectors may be derived from lentiviruses, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, among others. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0080] In a preferred embodiment of the present invention, the carrier is a lentivirus carrier.

[0081] The sgRNA integrating STING designed in this invention is based on the pLentiCrispr V2 vector, but the invention is not limited to the pLentiCrispr-V2 vector and should be suitable for all other plasmid vectors suitable for constructing T cells.

[0082] On one hand, the present invention provides a pharmaceutical composition comprising the genetically engineered immune cells and a pharmaceutically acceptable carrier as described in any of the preceding claims.

[0083] As used herein, "pharmaceutical composition" refers to a formulation of the engineered cells of the present invention and a medium generally accepted in the art for delivering a bioactive ingredient (the genetically engineered immune cells provided by the present invention) to a mammal (e.g., a human). This medium includes pharmaceutically acceptable carriers. The purpose of the pharmaceutical composition is to facilitate drug administration to the organism, thereby promoting the absorption of the active ingredient and the exertion of its bioactivity.

[0084] As used herein, the term "pharmaceutically acceptable carrier" includes, but is not limited to, any adjuvant, carrier, excipient, gliding agent, sweetener, diluent, preservative, dye / coloring agent, flavoring agent, surfactant, wetting agent, dispersant, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier that is permitted by the relevant governmental regulatory authority to be acceptable for human or animal use.

[0085] On the one hand, the present invention provides the use of the genetically engineered immune cells described in any of the above claims, or the gene editing reagents described above, or the pharmaceutical compositions described above in the preparation of a medicament for treating tumors.

[0086] In some embodiments, the tumor is a solid tumor or a hematoma; In some embodiments, the solid tumor includes gastric cancer, gastric cancer peritoneal metastasis, liver cancer, kidney tumor, lung cancer, small bowel cancer, bone cancer, prostate cancer, colorectal cancer, breast cancer, colon cancer, cervical cancer, ovarian cancer, lymphoma, nasopharyngeal carcinoma, adrenal tumor, bladder tumor, non-small cell lung cancer (NSCLC), glioma, endometrial cancer, or combinations thereof.

[0087] In some embodiments, the hematologic malignancies include: acute myeloid leukemia (AML), pre-B-lymphoblastic leukemia / lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma, B-lymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone B-cell lymphoma, hairy cell leukemia, MALT-type marginal zone B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, diffuse large B-cell lymphoma, Burkitt lymphoma / leukemia, and pre-lymphoblastic lymphoma. Leukemia, T-cell lymphocytic leukemia, T-granular lymphocytic leukemia, aggressive NK-cell leukemia, mature T-cell lymphoma / leukemia, extranodal nasal NK / T-cell lymphoma, enteropathic T-cell lymphoma, mycosis fungoides / sezary syndrome (MF / SS), peripheral T-cell lymphoma, anaplastic large cell lymphoma, acute lymphoblastic leukemia (ALL), pre-T-cell lymphoma / leukemia, Hodgkin's lymphoma, mast cell leukemia (MCL), or combinations thereof.

[0088] On one hand, the present invention provides a method for treating cancer or tumors, comprising: administering to a subject requiring treatment a safe and effective amount of any of the above-described genetically engineered immune cells, or the above-described gene editing reagent, or the above-described pharmaceutical composition.

[0089] The pharmaceutical compositions of the present invention can be administered in a manner suitable for the disease to be treated (or prevented). The amount and frequency of administration will be determined by factors such as the patient's condition, and the type and severity of the patient's disease—although the appropriate dosage can be determined by clinical trials.

[0090] When referring to "immunologically effective amount," "antitumor effective amount," "tumor-suppressive effective amount," or "therapeutic amount," the precise amount of the composition of the invention to be administered can be determined by a physician, taking into account individual differences in the patient's (subject's) age, weight, tumor size, degree of infection or metastasis, and disease condition. It can generally be indicated that a pharmaceutical composition including T cells described herein can be administered in doses of 10... 4 Up to 10 9 A dose of cells / kg body weight, preferably 10. 5 Up to 10 6 The T-cell composition can be administered at a dose of cells per kg of body weight (including all integer values ​​within those ranges). These doses can also be administered multiple times. The cells can be administered using infusion techniques known in immunotherapy (see, for example, Rosenberg et al., New Eng. J. of Med. 319:1676, 1988). The optimal dose and treatment regimen for a specific patient can be readily determined by a physician skilled in the medical field by monitoring the patient's disease signs and thus adjusting the treatment accordingly.

[0091] The application of the target composition can be performed in any convenient manner, including by spraying, injection, swallowing, infusion, implantation, or transplantation. The compositions described herein can be administered to a patient subcutaneously, intradermally, intratumorally, intranodally, intraspinally, intramuscularly, intravenously (i.v.), or intraperitoneally. In one embodiment, the T-cell composition of the present invention is administered to a patient by intradermal or subcutaneous injection. In another embodiment, the T-cell composition of the present invention is preferably administered by i.v. injection. The T-cell composition can be injected directly into the tumor, lymph node, or site of infection.

[0092] On the one hand, the present invention provides a drug for reversing or improving the exhaustion state of CD8+ T cells, the drug comprising an inhibitor that inactivates or inhibits the expression of the STING gene in CD8+ T cells; In some embodiments, the inhibitor reduces the iron concentration in the genetically engineered immune cells; and / or, in some embodiments, the inhibitor inhibits the lipid peroxide content in the genetically engineered immune cells.

[0093] The following specific examples illustrate the implementation of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.

[0094] Before further describing specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terminology used in the embodiments of the present invention is for describing specific embodiments and not for limiting the scope of protection of the present invention.

[0095] Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in this invention all employ conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology, and related fields. These techniques have been well described in existing literature; see Sam Brook et al., *MOLECULAR CLONING: A LABORATORY MANUAL*, Second edition, Cold Spring Harbor Laboratory Press, 1989 and Third edition, 2001; Ausubel et al., *CURRENT PROTOCOLS IN MOLECULAR BIOLOGY*, John Wiley & Sons, New York, 1987 and periodic updates; *theseries METHODS IN ENZYMOLOGY*, Academic Press, San Diego; Wolffe, *CHROMATINSTRUCTURE AND FUNCTION*, Third edition, Academic Press, San Diego, 1998; *METHODS IN ENZYMOLOGY*, Vol. 304, Chromatin (P.M. Wassarman and A.P. Wolffe, eds.), Academic Press, San Diego, 1999; and *METHODS IN MOLECULAR*. BIOLOGY, Vol. 119, Chromatin Protocols (P. B. Becker, ed.) Humana Press, Totowa, 1999, etc.

[0096] In addition to the specific methods, equipment, and materials used in the embodiments, based on the knowledge of those skilled in the art and the description of this invention, any prior art methods, equipment, and materials similar to or equivalent to those described, used, and materials in the embodiments of this invention can be used to implement this invention. Unless otherwise stated, parts and percentages are parts by weight and weight percentages.

[0097] The raw materials and reagents used in this invention are all common reagents in the art. Unless otherwise specified, they can be purchased commercially or synthesized according to known methods. Of course, it is not excluded that they can be synthesized according to methods disclosed in the prior art.

[0098] Example 1 In this application, the STING1-flox / flox mice and CD8-Cre mice were constructed using a publicly available and commercially available construction process, and were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd. Specifically, the mouse strain used in this application is B6;129S. -Tmem173 tm1(flox)Smoc (STING1-flox / flox mice) and C57BL / 6JGpt-Tg(Cd8a-iCre)19 / Gpt (CD8-Cre mice).

[0099] CD8-Cre-STING1 - / - Construction and identification of gene knockout mice: (1) Construction of recombinant gene vector: For CD8-Cre mice, the recombinant gene vector is a vector in which the Cre recombinase encoding gene and tool gene are inserted after the start codon of the CD8a gene. For STING1-flox / flox mice, the recombinant vector is a loxp site inserted before exon 3 and after exon 5 of the STING1 gene. (2) Microinjection and transplantation of fertilized eggs: The recombinant vector is injected into the fertilized eggs of mice by microinjection, and the fertilized eggs are transplanted into the oviduct of pseudopregnant female mice. (3) After the female mice give birth, the offspring mice are identified by DNA identification by PCR. After the heterozygous mice are bred again and DNA identification is performed, homozygous mice (Sting1-cKO mice, see construction mode) are gradually obtained. Figure 1 (A)

[0100] All mice were raised under specific pathogen-free (SPF) conditions and in strict accordance with the standards of the Animal Welfare and Ethics Committee.

[0101] Using wild-type WT mice as a control, the genotype of STING-cKO mice was identified by qPCR and Western blotting. The results are shown in [Figure number missing]. Figure 1 In section B, the expression levels of other Sting1 downstream genes Isg15, Isg56, and Ifn-b in CD8+ T cells were detected by qPCR, and the expression levels of Sting1 gene and its downstream genes Isg15, Isg56, and Ifn-b in CD4+ T cells were also detected. The results are shown in [Figure B]. Figure 1 The expression levels of the STING1 gene in CD4+ T cells, CD8+ T cells, and B cells derived from STING-cKO mice were detected by qPCR. The results are shown in [Figure C]. Figure 1 D.

[0102] Depend on Figure 1It can be seen that Sting1-cKO mice carry two flux alleles and the cre recombinase gene. Only the expression of the Sting1 gene and its downstream Isg15, Isg56, and Ifn-b genes in CD8+ T cells is affected, while the expression level of related genes in CD4+ T cells is not affected. The results show that only the STING protein in CD8+ T cells of Sting1-cKO mice is knocked out.

[0103] Subcutaneous tumor formation was achieved using the MC38 cell line (5E5 cells / mouse) in the constructed gene-edited mice (STING-cKO) and isotype control wild-type mice (WT). Time-tumor growth curves were plotted and measured every 3 days. At the end of the experiment (day 20 post-inoculation), subcutaneous tumors were isolated for tumor statistics and gross imaging. Results are shown below. Figure 2 .

[0104] Figure 2 In the figures, A and B represent the subcutaneous tumor growth curves (A) and subcutaneous tumor quality statistics (B) of isotype control mice and STING-cKO mice, respectively. It can be seen that the subcutaneous tumor growth rate of STING-cKO mice is significantly reduced. Figure 2 The diagram in C shows the subcutaneous tumor anatomy results of isotype control mice and STING-cKO mice, indicating that the tumor burden in STING-cKO mice is significantly reduced.

[0105] Example 2 CRISPR-Cas9-based gene editing targeting human TMEM173: a recombinant lentiviral vector containing an sgRNA sequence targeting human TMEM173. Figure 3 The gene editing assay was performed on STING knockout lentivirus and transfected into human peripheral blood mononuclear cells (PBMCs). A recombinant lentiviral empty vector was used as a control group for gene editing identification. After infecting PBMCs with STING knockout lentivirus and the empty vector lentivirus, the PBMCs were co-cultured with SiHa cells for 72 hours. Subsequently, flow cytometry was used to detect T cell apoptosis (7-ADD dye method), ferrous ion metabolism (PGSK dye method), and lipid peroxidation metabolism (BODIPY dye method) to assess functional changes in STING knockout T cells.

[0106] The TEE173 sgRNA sequence used is as follows: sgRNA-TMEM173-1: GCTGGGACTGCTGTTAAACG (SEQ ID NO.1) sgRNA-TMEM173-2: CATATTACATCGGATATCTG (SEQ ID NO.2) After transfecting human T cells with lentivirus, the expression level of the STING gene was detected by Western blotting. The results are shown in [Figure number missing]. Figure 4 ,in Figure 4 Figure A shows the expression level of the STING gene after different lentiviral treatments as detected by Western blotting. It is evident that the expression of the STING gene is significantly reduced in T cells transfected with STING knockout lentivirus. The proportion of cell death is significantly reduced in the system co-cultured with Siha. Figure 4 In the middle B cell line, the intracellular lipid peroxide content was significantly reduced. Figure 4 (C), intracellular ferrous ion concentration ( Figure 4 The ferroptosis resistance was significantly enhanced when human PBMC-derived CD8+ T cells were co-cultured with SiHa cells after STING lentivirus knockout.

[0107] Isolation and purification of TILs: Tumor tissue was collected from patients (obtained through surgical resection or needle biopsy). Necrotic tissue was removed using physical methods, and the tissue was minced and digested with collagenase IV and hyaluronidase to prepare a single-cell suspension. The single-cell suspension was then subjected to gradient density centrifugation (800g, acceleration 2, deceleration 0) using lymphocyte separation medium. The intermediate density layer was then collected. The cells were then washed with 1640 medium containing 50 μg / mL gentamicin. The isolated TILs were placed in cell culture plates and cultured in human lymphocyte culture medium containing a low concentration of rhIL-22000 IU / mL for 5-10 days to obtain purified CD3+ T lymphocytes.

[0108] Preparation of STING gene knockout TIL cells: A blank vector control group (Lenti-sgEV) and a recombinant lentivirus with STING knockout sgRNA (sequence sgRNA-TMEM173-1) were prepared beforehand using 293T cells, with a viral titer of 5 × 10⁻⁶. 7 TU. Low-adhesion 24-well plates were pre-coated with human OKT3, which was removed before cell seeding. At 72 hours of TIL amplification, TIL cells were seeded into 24-well plates at a density of 5E6 cells / well (total volume 0.5 mL) and cultured in IL-2-free X-VIVO medium for 12 hours. Subsequently, 0.5 mL of lentivirus and 5 μg / mL of Polybrene were added to each well to be infected. The 24-well plates were then centrifuged at 500g, 37°C for 1 hour. After centrifugation, the 24-well plates were incubated for 10 hours. The medium in the 24-well plates was then partially changed, and rh-IL2 was added to the culture volume to a final concentration of 2000 IU / mL. After culturing for 24 hours, a portion of the cells was isolated for knockout efficiency testing.

[0109] Rapid expansion and in vitro culture of genetically engineered TILs: Feeder cells (healthy human PBMCs with a density of at least 3E7 cells / mL) were prepared and irradiated with 230 Gy using an X-ray irradiator. Then, the Feeder cells and transfected TIL cells were mixed at a ratio of 1:40 and cultured in human lymphocyte culture medium such as X-VIVO, with the addition of rhIL-2 to a final concentration of 6000 IU / mL. This process can be carried out in culture flasks or culture bags, with the addition or replacement of rhIL-2-containing human lymphocyte culture medium as needed.

[0110] Animal experiments evaluating the efficacy of TIL cell therapy: TIL cells transfected with two different lentiviruses (2E5 / animal) were reinfused via the tail vein into SiHa tumor-bearing cells (approximately 50-70 mm in size). 3 In nude mice (4 mice per group, with mice injected with an equal volume of PBS via tail vein as a blank control group, see below) Figure 5 (A). A time-tumor growth curve was then plotted, with measurements taken every 3 days. At the end of the experiment, subcutaneous tumors were dissected for weight analysis and gross imaging. The results are shown in […]. Figure 5 .

[0111] Depend on Figure 5 It can be seen that the tumor growth rate of both groups of mice treated with TIL was significantly slowed compared with the blank control group. Mice treated with STING gene knockout TIL showed significantly slower subcutaneous tumor growth and a significantly reduced tumor burden compared with mice treated with empty vector control TIL. This indicates that human cervical cancer patient-derived TIL, after STING lentivirus knockout, can produce better therapeutic effects in SiHa tumor-bearing nude mice, demonstrating enhanced anti-tumor activity.

[0112] It should be understood that the above embodiments are exemplary and are not intended to encompass all possible implementations included in the claims. Various modifications and changes can be made to the above embodiments without departing from the scope of this disclosure. Similarly, the various technical features of the above embodiments can be arbitrarily combined to form other embodiments of the present invention that may not be explicitly described. Therefore, the above embodiments only illustrate several implementations of the present invention and do not limit the scope of protection of this patent.

Claims

1. A genetically engineered immune cell, characterized in that, The expression of the STING gene in the genetically engineered immune cells is silenced.

2. The genetically engineered immune cells according to claim 1, characterized in that, The immune cells include phagocytes, lymphocytes, neutrophils, eosinophils and / or basophils; Preferably, the immune cells include monocytes, macrophages, and / or dendritic cells; Preferably, the immune cells include B cells, T cells, natural killer cells and / or natural killer T cells (NKT).

3. The genetically engineered immune cells according to claim 2, characterized in that, The immune cells are T cells, preferably CD8+ T cells.

4. The genetically engineered immune cells according to claim 2, characterized in that, The immune cells are tumor-infiltrating lymphocytes (TILs). Preferably, the tumor-infiltrating lymphocytes are derived from tumor tissue, tumor-associated lymph nodes with or without tumor metastasis, metastatic lesions, fragments of adjacent tissue, pleural effusion and / or ascites TILs, and / or TILs derived from cryopreservation and subsequent thawing.

5. The genetically engineered immune cells according to claim 1, characterized in that, The genetically engineered immune cells have one or more of the following characteristics: (a) The expression of the STING gene in the genetically engineered immune cells is silenced; (b) The iron concentration in the genetically engineered immune cells is reduced; (c) The content of lipid peroxides in the genetically engineered immune cells is reduced.

6. The genetically engineered immune cells according to claim 1, characterized in that, The genetically engineered immune cells are derived from humans or non-human mammals.

7. A gene-editing reagent for preparing genetically engineered immune cells as described in any one of claims 1 to 6, characterized in that, The gene editing reagent includes: (1) A gene-editing protein or its expression vector, wherein the gene-editing protein is selected from the group consisting of: CasRx, Cpf1, Cas9, Cas13a, Cas13b, Cas13c, or combinations thereof; and (2) gRNA or its expression vector, wherein the gRNA is a nucleotide sequence that guides the gene editing protein to specifically bind to the STING gene; Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO.1 or 2, or its complementary sequence.

8. A method for preparing genetically engineered immune cells according to any one of claims 1 to 6, characterized in that, The method includes: (1) Provide immune cells to be modified; and (2) Modify the immune cells to silence the expression of the STING gene in the immune cells, thereby obtaining the genetically engineered immune cells as described in any one of claims 1 to 6.

9. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the genetically engineered immune cells as described in any one of claims 1 to 6, and optionally, a pharmaceutically acceptable carrier.

10. The use of the genetically engineered immune cells according to any one of claims 1 to 6, or the gene editing reagent according to claim 7, or the pharmaceutical composition according to claim 9 in the preparation of a medicament for treating tumors.

Citation Information

Patent Citations

  • Intrinsic factor - horse peroxidase conjugates and a method for increasing the stability thereof

    US5350674A

  • Adenovirus vectors for gene therapy

    US5585362A

  • SiRNA for targeted knockdown of STING gene and application thereof

    CN116497028A

  • Gene-edited tumor infiltrating lymphocyte and T cell receptor engineered T cell and application thereof in immunotherapy

    CN120818493A

  • Modulation of immune response through stimulator of interferon genes

    US20200224200A1

Cited By

  • Preparation method and application of novel TIL with TOX gene knocked out

    CN121801841A