Hypoxia-resistant natural killer cells

Abstract

The application discloses a low-oxygen-resistant natural killer cell. The application realizes overexpression of SIRT3 in the NK cell, enhances the adaptability of the NK cell under a low-oxygen condition, reverses the inhibition of the NK cell by a low-oxygen environment, and thus enhances the killing activity and / or metabolic capacity of the NK cell in the low-oxygen environment, thereby providing a new strategy for treatment of related tumors.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to a low-oxygen-resistant natural killer cell. BACKGROUND

[0002] Natural killer cell (NK) is a kind of innate immune cell and plays a crucial role in tumor surveillance. It has been shown that impaired NK cell antitumor activity is associated with hypoxic tumor micro-environment (TME) and tumor-derived metabolites, for example, hypoxic TME from tumor impairs NK cell effector function and promotes melanoma, pancreatic cancer, colorectal liver metastasis. In addition, hypoxic TME alters NK cell metabolism by inducing mitochondrial fragmentation of intrahepatic NK cells, thereby inhibiting its antitumor activity.

[0003] It has been known from the existing research that natural killer cell (NK) plays a crucial role in cancer immune surveillance, and hypoxic environment inhibits the metabolism and / or killing ability of NK cells, thereby inhibiting its antitumor activity. Therefore, it is necessary to seek a method for regulating the adaptability of NK cells to hypoxic environment, reverse the inhibition of NK cell killing by hypoxic environment, and enhance the metabolism and / or killing ability of NK cells in hypoxic environment. SUMMARY

[0004] In view of this, the primary purpose of the present application is to provide a low-oxygen-resistant natural killer cell, which is modified by overexpressing SIRT3 in NK cells, enhances the adaptability of NK cells to hypoxic environment, reverses the inhibition of NK cells by hypoxic environment, and enhances the metabolism and / or killing ability of NK cells in hypoxic environment, thereby providing a new strategy for the treatment of related tumors.

[0005] In order to achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0006] One aspect of the present application discloses a low-oxygen-resistant natural killer cell, which is a NK cell overexpressing SIRT3.

[0007] Another aspect of the present application discloses a method for preparing a low-oxygen-resistant natural killer cell, comprising the following steps:

[0008] Overexpressing SIRT3 in NK cells to obtain a low-oxygen-resistant natural killer cell.

[0009] Another aspect of the present application discloses the application of the low-oxygen-resistant natural killer cell or the low-oxygen-resistant natural killer cell prepared by the method in the preparation of a drug for treating tumors.

[0010] Another aspect of the present application discloses a medicine for treating tumors, containing an effective amount of the hypoxia-resistant natural killer cells described above or the hypoxia-resistant natural killer cells prepared by the method described above.

[0011] Advantages of the present application:

[0012] In the present application, by modifying the NK cells, overexpressing SIRT3 in the NK cells, the adaptability of the NK cells to the hypoxic environment is enhanced, the inhibition of the NK cells by the hypoxic environment is reversed, and the metabolism and / or killing ability of the NK cells in the hypoxic environment is enhanced, thereby providing a new strategy for the treatment of tumors related to NK cell therapy. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 WB effect diagram after overexpression of SIRT3 and SIRT1 in NK92MI cells in Example 1.

[0014] Figure 2 Flow cytometry results of killing of primary AML blast cells by in vitro treated NK92MI cells in Example 1, wherein, Figure 2 a is Annexin V + Flow cytometry analysis and statistical diagram of percentage of primary AML blast cells, CD107a + NK cells and IFN-γ + Flow cytometry analysis and statistical diagram of percentage of NK cells in total NK92MI cells; Figure 2 b is flow cytometry analysis diagram of Granzyme B expression on NK92MI cells; Figure 2 c is statistical diagram of mean fluorescence intensity MFI of Granzyme B expression on NK92MI cells.

[0015] Figure 3 Flow cytometry results of killing of K562 blast cells by in vitro treated NK92MI cells in Example 1, wherein, Figure 3 a is Annexin V + Flow cytometry analysis and statistical diagram of percentage of K562 blast cells, CD107a + NK cells and IFN-γ + Flow cytometry analysis and statistical diagram of percentage of NK cells in total NK92MI cells; Figure 3 b is flow cytometry analysis diagram of Granzyme B expression on NK92MI cells; Figure 3 c is statistical diagram of mean fluorescence intensity MFI of Granzyme B expression on NK92MI cells.

[0016] Figure 4Flow cytometry plots of the percentage of primary AML blasts after in vitro treatment of NK92MI cells for the different experimental groups of Example 1 + Flow cytometry plots and statistics of the percentage of primary AML blasts.

[0017] Figure 5 Flow cytometry results of the killing function after in vitro treatment of bone marrow NK (BMNK) cells for Example 2, wherein, Figure 5 a is Annexin V + Flow cytometry plots of the percentage of primary AML blasts and the expression of NKG2D, CD38 and CD160 on BMNK cells of AML relapsed patients; Figure 5 b is Annexin V + Statistics of the percentage of primary AML blasts and statistics of the mean fluorescence intensity MFI of the expression of NKG2D, CD38 and CD160 on BMNK cells of AML relapsed patients; Figure 5 c is CD107a + NK cells and Granzyme B + Statistics of the percentage of NK cells in total BMNK cells of AML relapsed patients; Figure 5 d is Annexin V + Flow cytometry plots of the percentage of K562 cells; Figure 5 e is Flow cytometry plots of the expression of NKG2D, CD38 and CD160 on BMNK cells of AML relapsed patients; Figure 5 f is Annexin V + Statistics of the percentage of K562 cells and statistics of the mean fluorescence intensity MFI of the expression of NKG2D, CD38 and CD160 on BMNK cells of AML relapsed patients; Figure 5 g is CD107a + NK cells and Granzyme B + Statistics of the percentage of NK cells in total BMNK cells of AML relapsed patients.

[0018] Figure 6 Flow cytometry results of the experiments in Example 3 to study the effect of SIRT3 overexpression on leukemia cells in a xenograft mouse model of leukemia, wherein, Figure 6 a is a schematic representation of the experimental procedure; Figure 6 b is the average of the AML load quantified as total flux (p / s) and the Kaplan-Meier survival curve of HL60 tumor-bearing mice; Figure 6 c is the bioluminescence imaging of the AML load. DETAILED DESCRIPTION

[0019] The embodiments of the present application will be described below clearly and completely. The technical solutions in the embodiments described below are exemplary and only possible technical implementations of the present application, not all possible implementations. Those skilled in the art can obtain other embodiments by combining the embodiments of the present application without creative labor, and these embodiments are also within the protection scope of the present application.

[0020] The first aspect of the present application discloses a low-oxygen-resistant natural killer cell, which is an NK cell overexpressing SIRT3.

[0021] It can be understood that SIRT3 in the present application can refer to SIRT3 gene or SIRT3 protein, and the overexpression refers to the expression level of SIRT3 gene or SIRT3 protein being increased or the expression activity being enhanced.

[0022] SIRT3 (Sirtuin-3, deacetylase 3) is a member of the sirtuin family. The sirtuin family includes various deacetylases, which depend on NAD + for catalytic reaction and are widely involved in the regulation of key life activities such as glycolipid metabolism, aging, DNA repair, etc. Among them, SIRT3 is mainly distributed in mitochondria in cells and participates in the regulation of mitochondrial function and metabolic process. SIRT3 is not only located in mitochondria, but also in the nucleus. It has been shown that full-length SIRT3 is a nuclear protein, but when SIRT3 is overexpressed or SIRT3 and SIRT5 are co-expressed, SIRT3 is translocated from the nucleus to the mitochondria. It has been confirmed that SIRT3 has deacetylation activity, fatty acylation activity and demethylation activity, but its role in immune cells is rarely studied.

[0023] Hypoxia can inhibit the killing function of NK cells by damaging mitochondria. SIRT3 is mainly distributed in mitochondria in cells and participates in the regulation of mitochondrial function and metabolic process, and the expression of SIRT3 is closely related to the integrity and function of mitochondria, which indicates that SIRT3 may play a key role in the recovery of NK cell function inhibited by hypoxia. Based on this, the present application is proposed.

[0024] It is determined through a series of experiments that the expression of SIRT3 plays a key role in the recovery of NK cell function inhibited by hypoxia. By overexpressing SIRT3 in NK cells, the inhibition of hypoxic environment on the killing activity and / or metabolic capacity of NK cells can be reversed, and the killing activity and metabolic capacity of NK cells under hypoxic conditions can be enhanced. Thus, a new scheme for NK cell-based immunotherapy is provided.

[0025] In the present application, the NK cells are not particularly required, and are of the type well known in the art, and can be derived from peripheral blood cells, umbilical cord blood cells, induced pluripotent stem cells, or NK cell lines. In some examples, the NK cells are derived from NK cell lines, and specific examples include, but are not limited to, at least one of NK92 cells, NK92MI cells, KHYG-1 cells, YT cells, CIML-NK cells, NKG cells, NKL cells, NK-YS cells, SNK-6 cells, IMC-1 cells, PB-NK cells, iPSC-NK cells, UCB-NK cells, or CAR-NK cells, preferably, the NK cells are NK92MI cells or CAR-NK cells.

[0026] In the present application, the hypoxia refers to an O2 concentration of no more than 10%, preferably, an O2 concentration of 0.1% to 10%; in some examples, the hypoxia refers to an O2 concentration of 5%.

[0027] The second aspect of the present application discloses a method for preparing hypoxia-resistant natural killer cells, comprising the following steps:

[0028] SIRT3 is overexpressed in the NK cells to obtain hypoxia-resistant natural killer cells.

[0029] In the present application, any method well known in the art can be used to overexpress SIRT3 in the NK cells, and preferably, a genetic regulation method is used, and in some examples, the genetic regulation method is lentivirus transfection.

[0030] Specifically, in some examples of the present application, the overexpression of SIRT3 is achieved by lentivirus transfection, comprising the following steps:

[0031] Based on a lentivirus expression vector, a lentivirus overexpression plasmid containing the target gene SIRT3 is constructed;

[0032] The lentivirus overexpression plasmid is transfected into packaging cells to obtain SIRT3 overexpression lentivirus supernatant;

[0033] The NK cells are pretreated with the SIRT3 overexpression lentivirus supernatant, and then the NK cells are cultured in a cell culture medium added with the SIRT3 overexpression lentivirus supernatant.

[0034] In the present application, the type of the lentivirus expression vector is not particularly limited, and any conventional type can be used, and specific examples include, but are not limited to, one of pLVX-IRES-Puro, pLKO.1, pLenti-CMV-GFP, pLVX-Puro, and pCDH, but are not limited thereto. In some examples, the lentivirus expression vector used is pLVX-IRES-Puro.

[0035] The way of constructing the lentivirus overexpression plasmid containing the target gene SIRT3 is not particularly limited. The lentivirus expression vector is used as a backbone vector, and the target gene SIRT3 is inserted into the lentivirus expression vector based on the PCR amplification and other ways known in the art, so as to obtain the lentivirus overexpression plasmid containing the target gene SIRT3.

[0036] Then, the SIRT3 overexpression lentivirus supernatant is obtained by lentivirus packaging. Specifically, the lentivirus overexpression plasmid and the packaging plasmid are co-transfected into the packaging cell, so that the target gene SIRT3 is stably expressed in the packaging cell, and the SIRT3 overexpression lentivirus supernatant is obtained. The packaging plasmid and the packaging cell can be of any kind commonly used in the art. In some examples, the packaging plasmid is ps.pAX2 and pMD.2G, and the packaging cell is 293T. The ratio of the lentivirus overexpression plasmid and the packaging plasmid can be determined by experiments, and thus is not particularly limited.

[0037] Finally, the NK cells are pretreated in the SIRT3 overexpression lentivirus supernatant for a period of time, and then cultured in the cell culture medium containing the SIRT3 overexpression lentivirus supernatant for a period of time, so as to obtain the NK cells overexpressing SIRT3. It can be understood that the cell culture medium is not particularly limited, and any medium that can be used for NK cell culture in the art can be used. Specific examples include RPMI 1640 medium, Alpha MEM medium, etc., but are not limited thereto. The amount of the SIRT3 overexpression lentivirus supernatant can be determined by experiments, as long as the expression of SIRT3 in the NK cells is increased. In some examples, the amount of the SIRT3 overexpression lentivirus supernatant is 1 mL-3 mL, preferably 2 mL, based on 2x10 6 NK cells. The specific culture time can be determined according to actual needs or by experiments. In some examples, the pretreatment time is 4-8 h, preferably 6 h, and the culture time after pretreatment is 24-42 h, preferably 42 h. By the overexpression method of the present application, the transfection efficiency of the plasmid in the NK cells can be significantly improved, and better transfection results can be obtained.

[0038] The third aspect of the present application provides the use of the hypoxia-resistant natural killer cells in the preparation of a drug for treating tumors.

[0039] The fourth aspect of the present application discloses a drug for treating tumors, containing an effective amount of the hypoxia-resistant natural killer cells or the hypoxia-resistant natural killer cells prepared by the method.

[0040] In the present application, the drug has at least one of the following effects:

[0041] a: reversing the inhibition of NK cell killing and / or metabolic capacity under hypoxic environment;

[0042] b: enhancing the metabolic and / or killing capacity of NK cells under hypoxic conditions;

[0043] c: inhibiting the growth of tumor cells;

[0044] d: promoting the apoptosis of tumor cells.

[0045] Specifically, by overexpressing SIRT3 to reverse the inhibition of NK cells under hypoxic environment, the killing activity and / or metabolic capacity of NK cells under hypoxic conditions are improved, thereby improving the growth, apoptosis and killing degree of NK cells on tumor cells under hypoxic conditions.

[0046] In the present application, the effective amount refers to the minimum dose or dose range of hypoxia-resistant natural killer cells required to achieve a therapeutic effect, under which the inhibition of NK cell killing and / or metabolic capacity under hypoxic environment can be effectively reversed; or the metabolic and / or killing capacity of NK cells under hypoxic conditions can be effectively enhanced; or the growth of tumor cells can be effectively inhibited; or the apoptosis of tumor cells can be effectively promoted.

[0047] In the present application, the tumor refers to various types of malignant and benign tumors that can be recognized by natural killer cells, preferably various blood tumors and / or solid tumors with hypoxic tumor microenvironment, and specific examples include but are not limited to lung cancer, breast cancer, colorectal cancer, liver cancer, brain cancer, bone cancer, esophageal cancer, gastric cancer, nasopharyngeal cancer, thyroid cancer, pancreatic cancer, endometrial cancer, ovarian cancer, cervical cancer, renal cell carcinoma, colorectal cancer, prostate cancer, bladder cancer, pancreatic cancer, glioblastoma, melanoma, leukemia, lymphoma, myeloma, etc. In some examples, the tumor is leukemia, particularly acute myeloid leukemia.

[0048] It can be understood that the drug for treating tumors contains not only hypoxia-resistant natural killer cells, but also at least any one of pharmaceutically acceptable adjuvants and / or carriers, including but not limited to at least one of diluents, binders, surfactants, adsorption carriers, lubricants, fillers, disintegrants.

[0049] In some specific examples of the present application, the diluent can be, for example, lactose, sodium chloride, glucose, urea, starch, water, etc., but is not limited thereto. The binder can be, for example, starch, pregelatinized starch, dextrin, maltodextrin, sucrose, gum arabic, gelatin, methylcellulose, carboxymethylcellulose, ethylcellulose, polyvinyl alcohol, polyethylene glycol, polyvinylpyrrolidone, alginic acid and alginic acid salts, xanthan gum, hydroxypropyl cellulose, hydroxypropyl methylcellulose, etc., but is not limited thereto. The surfactant can be, for example, polyoxyethylene sorbitan fatty acid ester, sodium dodecyl sulfate, glycerol monostearate, cetyl alcohol, etc., but is not limited thereto. The adsorptive carrier can be, for example, starch, lactose, bentonite, silica gel, kaolin, soap clay, etc. The lubricant can be, for example, zinc stearate, glycerol monostearate, polyethylene glycol, talc, calcium and magnesium stearate, polyethylene glycol, boric acid powder, hydrogenated vegetable oil, sodium stearo-fumarate, polyoxyethylene monostearate, sucrose monolaurate, sodium lauryl sulfate, magnesium lauryl sulfate, magnesium dodecyl sulfate, etc., but is not limited thereto. The filler can be, for example, mannitol, xylitol, sorbitol, maltose, erythrose, microcrystalline cellulose, polymeric sugar, coupled sugar, glucose, lactose, sucrose, dextrin, starch, sodium alginate, laminarin powder, agar powder, calcium carbonate, sodium bicarbonate, etc., but is not limited thereto. The disintegrant can be, for example, cross-linked vinylpyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium carboxymethyl cellulose, soybean polysaccharide, etc.

[0050] In addition, in the present application, the excipient and / or carrier can also be at least one of a stabilizer, a buffer, an isotonic agent, a pH adjuster, or a chelating agent.

[0051] The selection of the specific excipient and / or carrier can be made according to the dosage form of the drug, and when selected, it should be able to adapt to the active substance, or effectively improve the stability and solubility of the active ingredient contained in the drug, or change the release rate and absorption rate of the active substance, thereby ensuring or enhancing the drug effect of the active ingredient. In the present application, the dosage form of the drug is not particularly limited, and any dosage form known in the art that is beneficial for administration can be used, for example, aqueous solution injection, powder injection, pill, powder, tablet, granule, capsule, etc. In some specific examples of the present application, powder or injection is preferred. The beneficial administration herein refers to the ability to improve the therapeutic effect or improve the bioavailability or reduce the toxic side effects or improve the adaptability of the patient, etc.

[0052] Based on the low-oxygen-resistant natural killer cells in the present application, a treatment method based on NK cells, in particular a treatment method of CAR-NK cells, can be provided, that is, before the CAR-NK cells are delivered into the body of a tumor patient, the CAR-NK cells are pretreated by the gene regulation method described above, the overexpression of SIRT3 in the CAR-NK cells is achieved, and then the CAR-NK cells are delivered into the body of the tumor patient, so as to improve the treatment effect of the tumor.

[0053] In general, the present application enhances the adaptation of NK cells to a low-oxygen environment by overexpression of SIRT3 in NK cells, reverses the inhibition of NK cells by a low-oxygen environment, improves the metabolism and killing ability of NK cells under low-oxygen conditions, and thus can inhibit the growth of tumor cells and promote the apoptosis of tumor cells, and finally plays a therapeutic effect on tumors.

[0054] The following are specific embodiments of the present application, and it should be noted that the following specific embodiments are only for illustrative purposes and do not limit the scope of the present application in any way.

[0055] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application belongs. The terms used in the specification of the present application are only for the purpose of describing the specific embodiments and are not intended to limit the present application.

[0056] In addition, unless otherwise specified, the methods without specific conditions or steps are conventional methods, and the reagents and materials used can be obtained from commercial channels.

[0057] Example 1 SIRT3 overexpression enhances the adaptation of NK92MI to a low-oxygen environment and improves the killing function of NK cells

[0058] In this embodiment, a SIRT3 overexpression plasmid is constructed by a lentiviral vector, and a SIRT3 overexpression lentivirus supernatant is obtained, and the NK92MI cells are treated with the SIRT3 overexpression lentivirus supernatant to obtain NK cells overexpressing SIRT3.

[0059] 1.1, Construction of SIRT3 overexpression plasmid

[0060] (1) Provide a lentiviral vector pLVX-IRES-Puro (P0249, Mclibio), and cut the lentiviral vector using endonuclease Xho I (FD0694, Thermo) and BamH I (FD0054, Thermo), wherein the double enzyme cutting system of the lentiviral vector is shown in the following table:

[0061]

[0062] Mix according to the above double enzyme cutting system, 37℃ enzyme cutting overnight. The enzyme cutting product uses kit (SanPrep Column PCR Product Purification Kit) to recover the product, and determines the concentration.

[0063] (2) Provide pCMV-SIRT3 (human)-3xHA-Neo plasmid (P70777, Moli Bio), amplify SIRT3 target fragment by PCR, and the primer information is shown in the following table:

[0064] Primer name Sequence information Forward primer CCGCTCGAGATGGCGTTCTGGGGTTGG Reverse primer CGCGGATCCTCATTTGTCTGGTCCATCAAGC

[0065] PCR reaction system is shown in the following table:

[0066]

[0067]

[0068] PCR program is shown in the following table:

[0069]

[0070] The above SIRT3 fragment and endonuclease cut pLVX-IRES-Puro are connected by composite enzyme (C112-01 / 02, Novozyme) to realize the construction of pLVX-SIRT3-IRES-Puro lentivirus overexpression vector, and the successful construction is proved by sequencing.

[0071] 1.2, SIRT3 overexpression lentivirus supernatant

[0072] The 293T cells (Cellcook, SCSP-502) growing to exponential growth phase were inoculated into 6-hole plates and cultured overnight, and the cells grew to about 70%. Sterile EP tubes were prepared, and 100 μL Opti-MEM medium (Gibco company, 31985070) was added to each EP tube. In the above medium, the target plasmid (pLVX-SIRT3-IRES-Puro) and two packaging plasmids ps.pAX2 (Add gene company) and pMD.2G (Add gene company) were mixed according to the mass ratio of 4:3:1, and were placed for 5 min. The specific transfection system is shown in the following table:

[0073]

[0074] According to the mass ratio of target plasmid and PEI (polyethyleneimine) 1:4, add PEI, vortex mix, and stand for 20 min. Slowly drop the mixed solution into 293T cells, and culture the cells in 5% CO2, 37℃ incubator for 24 h.

[0075] Remove 293T cell culture medium, add new complete DMEM culture medium (Hyclone, 11965092), continue to culture for 24h, collect virus-containing cell culture supernatant. 3000rpm, 4℃ centrifugal 10min, remove cell debris; the supernatant is filtered with 0.45μm filter; the virus supernatant is high-speed centrifuged, 60000g, 4℃ centrifugal 2h, discard the supernatant, and resuspend the virus precipitate with PBS, and store in-80℃ refrigerator for standby.

[0076] In addition, SIRT1 overexpression plasmid is constructed in this embodiment, and SIRT1 overexpression lentivirus supernatant is obtained, which is one of the subsequent control experiments. The construction of SIRT1 overexpression plasmid and the obtaining of SIRT1 overexpression lentivirus supernatant are both referred to the steps of SIRT3. The template plasmid used in the construction of SIRT1 overexpression plasmid is pCMV-SIRT1 (human)-3×HA-Neo plasmid (P63391, Molling Biological), and the primers involved are shown in the following table:

[0077] Primer name Sequence information Forward primer ATTTCCGGTGAATTCCTCGAATGGCGGACGAGGCG Reverse primer GGAGGGAGAGGGGCGGGATCTCATGATTTGTTTGATGGATAGTTCATGTCTGTTACTT

[0078] 1.3, detection of SIRT3 overexpression in NK cells

[0079] Take NK92MI cells (100g, Cellcook) and centrifuge for 5min, remove the supernatant, and then treat with lentivirus supernatant (2mL) for 48h; at the same time, take NK cells without lentivirus supernatant treatment as control.

[0080] WB is used to detect the expression amount of SIRT3 / 1 in NK cells. The results are shown in Figure 1 Compared with the control NK cells, the expression level of SIRT3 / 1 in NK cells treated with SIRT3 / 1 overexpression lentivirus supernatant is significantly increased, indicating that SIRT3 / 1 overexpression NK cells are successfully constructed.

[0081] 1.4, SIRT3 overexpression enhances the adaptability of NK92MI to hypoxic environment

[0082] 1.4.1 Experimental materials

[0083] NK92MI cells verified by STR analysis were from Cellcook Biotechnology Co., Ltd. (Guangzhou, China). Cells were cultured in NK92MI complete medium, which was based on Alpha MEM medium (Cellcook, Cat: CM2003) with the addition of 12.5% horse serum (Cellcook, Cat: CM1001), 12.5% fetal bovine serum (Gibco, Cat: 10099), 0.2 mM myo-inositol, 0.1 mM thiol, and 0.02 mM folic acid. Cells were maintained in a humidified incubator at 37 °C, 5% CO2.

[0084] K562 cells were purchased from Shanghai Cell Bank (Chinese Academy of Sciences, Shanghai, China).

[0085] Primary AML blasts were collected from bone marrow of de novo AML patients. All human samples used were approved by the Ethics Committee of the First Affiliated Hospital of University of Science and Technology of China (2021-N(H)-120; Hefei, China) and written informed consent was obtained from all patients.

[0086] 1.4.2 Experimental methods

[0087] The following four experimental groups were used to pretreat NK92MI cells (2 x 10 6

[0088] (1) Control group (normoxia group): NK92MI cells were cultured in NK92MI complete medium at 37 °C, 5% CO2, 20% O2 in the incubator for 48 h.

[0089] (2) Hypoxia group: NK92MI cells were cultured in NK92MI complete medium at 37 °C, 5% O2, 5% CO2 in the hypoxic incubator for 48 h.

[0090] (3) Hypoxia + SIRT3 overexpression group: NK92MI cells were first treated in SIRT3 overexpression lentivirus supernatant (2 mL) at 37 °C, 5% O2, 5% CO2 in the hypoxic incubator for 6 h, and then supplemented with the same volume of NK92MI complete medium as the SIRT3 overexpression lentivirus supernatant for continued transfection to 48 h.

[0091] ​(4) Hypoxia + SIRT1 overexpression group: NK92MI cells were first treated in SIRT1 overexpression lentivirus supernatant (2 mL) for 6 h in a hypoxic incubator at 37°C, 5% O2, 5% CO2, and then supplemented with the same volume of NK92MI complete medium as the SIRT1 overexpression lentivirus supernatant for continued transfection to 48 h.

[0092] After culture, the cells in each experimental group (2 x 10 6 cells / mL) were inoculated with target cells (4 x 10 5 cells / mL, primary AML mother cells or K562 cells) in NK92MI complete medium, and incubated in a 37°C, 5% CO2, 20% O2 incubator for 4 h. After co-culture, the cells in each experimental group were labeled with flow cytometry antibodies, and the NK cell killing function was detected by flow cytometry. The flow cytometry antibody information is shown in the following table:

[0093]

[0094] 1.4.3 Experimental results

[0095] The flow cytometry results are shown in Figures 2-4 .

[0096] As can be seen from Figure 2 and Figure 3 , compared with the normal oxygen group, the toxicity of NK cells to primary AML mother cells and K562 cells was significantly inhibited in the hypoxic group, and the degranulation ability and IFN release ability of NK cells were inhibited, indicating that the hypoxic environment significantly inhibited the toxicity and killing ability of NK cells. Compared with the hypoxic group, after SIRT3 overexpression treatment, the toxicity of NK cells to primary AML mother cells and K562 cells was improved, and the proportion of NK cells expressing CD107a + and IFN-γ + was increased Figure 2 (a and Figure 3 a). In addition, after SIRT3 overexpression treatment, the expression level of granzyme B in NK cells was up-regulated Figure 2 (b- Figure 2 c and Figure 3 b- Figure 3 c).

[0097] In addition, in this embodiment, SIRT1, a member of the SIRT protein family, was used as one of the controls to detect the effect of SIRT1 overexpression on NK cell killing of primary AML mother cells under hypoxic conditions, and the results are shown in Figure 4It can be seen that the improvement of killing activity of NK cells after overexpression of SIRT1 is not significant. The overexpression of SIRT3 significantly reverses the inhibition of hypoxia on the killing function of NK92MI cells.

[0098] The above results show that SIRT3 overexpression can enhance the adaptation of NK cells to a hypoxic environment, reverse the inhibition of a hypoxic environment on NK cell toxicity or activity, and restore the killing ability of NK cells.

[0099] Example 2 SIRT3 overexpression enhances the adaptation ability of BMNK cells to a hypoxic environment and improves the killing function of NK cells

[0100] In this embodiment, the NK cells of a relapsed AML patient are treated with SIRT3 overexpression lentivirus supernatant, and it is further proved that SIRT3 overexpression can significantly enhance the activation of NK cells and reverse the damage of NK cell anti-leukemia function in relapsed AML patients. The NK cells of relapsed AML patients are in a hypoxic tumor microenvironment for a long time, and the hypoxic treatment in Example 1 is to simulate the hypoxic microenvironment of AML.

[0101] 2.1, Experimental materials

[0102] Bone marrow NK cells of acute myeloid leukemia (AML) patients are derived from bone marrow mononuclear cells (BMMCs), wherein the BMMCs are isolated from residual bone marrow samples of AML patients who have undergone laboratory tests by Ficoll density gradient method. These patients include patients who relapsed early after allogeneic hematopoietic stem cell transplantation and patients who did not relapse early, and early relapse is defined as relapse within 6 months after complete remission after allogeneic transplantation. The NK cells used in the in vivo experiment are purified from the blood of healthy donors: NK cells are purified by magnetic activated cell sorter (MACS) kit (Miltenyi Biotec, Cat.#130-092-657). The purity of NK cells in each test is >93%. All human samples used are approved by the Ethics Committee of the First Affiliated Hospital of China University of Science and Technology (2021-N(H)-120; Hefei, China) and written informed consent is obtained from all patients.

[0103] The primary AML blast cells and K562 cells and the flow cytometry antibodies used are the same as in Example 1.

[0104] 2.2, Experimental methods

[0105] First, refer to the method in Example 1 to obtain SIRT3 overexpression lentivirus supernatant, and use blank lentivirus vector plasmid as control, refer to the method in Example 1 to obtain lentivirus supernatant without target gene.

[0106] The following two experimental groups were used to detect bone marrow NK cells (2×10⁻⁶) in patients with relapsed AML. 6 Processed with (number / mL):

[0107] (1) SIRT3 overexpression group: In an incubator with 37℃, 5% CO2, and 20% O2 conditions, bone marrow NK cells from relapsed AML patients were first treated in SIRT3 overexpression lentivirus supernatant (2 mL) for 6 h, and then transfected for 48 h with the same volume of complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) as SIRT3 overexpression lentivirus supernatant.

[0108] (2) Control group: Bone marrow NK cells from patients with relapsed AML were first treated with lentiviral supernatant (2 mL) without the target gene for 6 h in an incubator at 37℃, 5% CO2, and 20% O2. Then, they were transfected with the same volume of complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) as the lentiviral supernatant without the target gene for 48 h.

[0109] After culture, cells from each experimental group (2×10⁶) were... 6 (cells / mL) and target cells (4 × 10) respectively 5 Primary AML blast cells (or K562 cells) were seeded in complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) and co-cultured at 37°C, 5% CO2, 20% O2 for 4 hours.

[0110] After co-culturing cells from each experimental group, flow cytometry was used to label them with antibodies, and then flow cytometry was used to detect the NK cell killing function. The information on the flow cytometry antibodies involved is shown in the table below:

[0111]

[0112] 2.3 Experimental Results

[0113] Please refer to the flow cytometry results. Figure 5 .

[0114] It can be seen that after SIRT3 overexpression treatment, Annexin V + The proportions of primary AML cells and K562 cells were significantly increased. Figure 5 a and Figure 5 d). CD107a + and Granzyme B +The proportion of BMNK cells was significantly increased after SIRT3 overexpression treatment Figure 5 c and Figure 5 g) and the expression levels of CD38, NKG2D and CD160 (Cat#341208, RRID:AB_2561435) in BMNK cells were significantly up-regulated Figure 5 a~5b and Figure 5 d~5f).

[0115] The above results show that the effector function of BMNK cells from relapsed AML patients on primary AML blast cells and AML cell lines is significantly improved after SIRT3 overexpression. Specifically, in vitro treatment with lentivirus overexpression of SIRT3 can restore the degranulation and cytokine secretion capacity of NK cells isolated from these AML patients. In addition, this pretreatment significantly enhances the activation of NK cells.

[0116] Example 3 SIRT3 overexpression can significantly inhibit the growth of leukemia cells in a leukemia mouse xenograft model

[0117] 3.1, Experimental materials

[0118] 6-week-old female NOD / ShiLtJ Gpt-Prkdc em26Cd52 IL-2rg em26Cd22 / Gpt (NCG) mice were purchased from GemPharmatech. All animals were bred under specific pathogen-free conditions. All experiments involving mice were performed in accordance with the regulations of the National Guidelines for Animal Usage in Research (China) and were approved by the Ethics Committee of the University of Science and Technology of China (USTC AUC2).

[0119] HL60 cells were purchased from Shanghai Cell Bank.

[0120] IL-2 (50000U, Jiangsu Kingsley Pharmaceuticals).

[0121] NK cells were purchased from Miaoshun (Shanghai) Biotechnology Co., Ltd.

[0122] 3.2, Experimental methods (see Figure 6 a)

[0123] a, Construction of animal models

[0124] Luciferase-labeled HL60 (2.5x10 4Leukemia cells were intravenously injected into NCG mice, and tumor growth was monitored using bioluminescence imaging via the IVIS spectral imaging system (PerkinElmer) to confirm successful transplantation of leukemia cells.

[0125] b. Pretreatment of NK cells

[0126] The following three experimental groups were used to treat NK cells (2×10⁻⁶). 6 Processed with (number / mL):

[0127] (1) Normal oxygen group: NK cells were cultured in complete RPMI 1640 medium at 37°C, 5% CO2, and 20% O2 for 48 h.

[0128] (2) Hypoxia group: NK cells were cultured in complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) at 37°C in a 5% CO2, 5% O2 incubator for 48 h.

[0129] (3) Hypoxia + SIRT3 overexpression group: NK cells were first treated with SIRT3 overexpression lentivirus supernatant (2 mL) for 6 h in a 37℃, 5% CO2, 5% O2 incubator, and then transfected with the same volume of complete RPMI 1640 medium (Thermo Fisher Scientific, 11875119) as SIRT3 lentivirus overexpression supernatant for 48 h.

[0130] c. On day 7 after tumor implantation in mice, NK cells (5.0 × 10⁻⁶) from each experimental group treated in step b were... 4 IL-2 (50,000 U / mouse) was adopted into mice (5 mice per group) to support the survival of NK cells in vivo. The mice were injected intraperitoneally with IL-2 every 2 days.

[0131] d. AML load was monitored using the IVIS spectral imaging system (PerkinElmer) via bioluminescence imaging at specified time points (7d, 14d, 28d, and 35d). Quantitative image data were analyzed using Living Image Software (PerkinElmer).

[0132] Throughout the experiment, the mice were fed a standard complete diet.

[0133] 3.3 Experimental Results

[0134] The results can be found in [the following text is missing]. Figure 6Compared with the normal oxygen group, the growth of HL60 cells and tumors of mice in the low oxygen group was significantly accelerated. The growth of HL60 cells and tumors of mice receiving SIRT3 overexpressed NK cells was significantly inhibited Figure 6 b and 6c).

[0135] The above results show that the mice in the low oxygen group have a heavier AML burden and a significantly shorter survival time compared with the normal oxygen group; the mice receiving SIRT3 overexpressed NK cells show a significantly lower AML burden and a longer survival time. These results clearly show that NK cells effectively restore the anti-leukemia response of low-oxygen-damaged NK cells by SIRT3 overexpression.

[0136] It can be understood that the examples in the present application take acute myeloid leukemia cells as an example to verify the function of NK cells overexpressing SIRT3, but it does not mean that the present application can only achieve the treatment of leukemia. Any tumor with a low-oxygen tumor microenvironment in the art can achieve the same or similar effect.

[0137] From the above example results, it can be seen that SIRT3 overexpression can enhance the adaptability of NK cells to low-oxygen environment, reverse the inhibition of low-oxygen environment on NK cells, thereby enhancing the metabolic and killing functions of NK cells under low-oxygen conditions, and further enhancing the killing of NK cells on tumor cells in vitro and in vivo. By targeting NK cells in low-oxygen environment, tumor cell apoptosis is promoted and tumor progression is inhibited. It shows that the adaptation of targeted NK cells to low-oxygen environment can enhance the metabolic and killing ability of NK cells, and promote the treatment of tumors.

[0138] It should be noted that the present application is not limited to the above-mentioned embodiments. The above-mentioned embodiments are only examples, and embodiments having the same technical idea and playing the same role and effect within the scope of the technical solutions of the present application are all included in the technical scope of the present application. In addition, within the scope of the main idea of the present application, various modifications of the embodiments that can be thought of by those skilled in the art, and other ways constructed by combining part of the components in the embodiments are also included in the scope of the present application.

Claims

1. A low oxygen resistant natural killer cell, characterized in that, The NK cell is a NK cell overexpressing SIRT3.

2. A method of preparing the hypoxia-resistant natural killer cells of claim 1, wherein, The method comprises the following steps: The SIRT3 is overexpressed in the NK cell to obtain the hypoxia-resistant NK cell.

3. The method of claim 2, wherein, The overexpression of the SIRT3 is achieved by lentivirus transfection, and the method comprises the following steps: Based on a lentivirus expression vector, a lentivirus overexpression plasmid containing a target gene SIRT3 is constructed; The lentivirus overexpression plasmid is transfected into a packaging cell to obtain SIRT3 overexpression lentivirus supernatant; The NK cell is pretreated by using the SIRT3 overexpression lentivirus supernatant, and then the NK cell is cultured in a cell culture medium added with the SIRT3 overexpression lentivirus supernatant.

4. The method of claim 3, wherein, The lentivirus expression vector is one of pLVX-IRES-Puro, pLKO.1, pLenti-CMV-GFP, pLVX-Puro and pCDH.

5. The method of claim 3, wherein, The packaging cell is a mammalian cell.

6. The method of claim 3, wherein, The amount of SIRT3 overexpression lentivirus supernatant added is 1 mL-3 mL, with 2 x 10 6 NK cells.

7. The hypoxia-resistant NK cell of claim 1 or the hypoxia-resistant NK cell prepared by the method of any one of claims 2-6 is used in the preparation of a drug for treating a tumor.

8. A medicament for treating a tumor, characterized by, The drug contains an effective amount of the hypoxia-resistant NK cell of claim 1 or the hypoxia-resistant NK cell prepared by the method of any one of claims 2-6.

9. The medicament according to claim 8, wherein The drug has at least one of the following effects: a: reversing the inhibition of the killing and / or metabolic capacity of the NK cell in a hypoxic environment; b: enhancing the metabolic and / or killing capacity of the NK cell under a hypoxic condition; c: inhibiting the growth of tumor cells; d: promoting the apoptosis of tumor cells.

10. The medicament according to claim 9, wherein The drug further comprises at least one of pharmaceutically acceptable adjuvants and / or carriers.

Images