TRF related to prostatic cancer and application thereof

By detecting and inhibiting the expression of tRF-16, the problem of immunosuppression in the microenvironment of prostate cancer tumors was solved, and the effect of immunotherapy was significantly improved, and the prognosis and treatment effect of patients were improved.

CN120330197AActive Publication Date: 2025-07-18SHANDONG UNIV QILU HOSPITAL
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510829014.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-20
Publication Date
2025-07-18
Estimated Expiration
2045-06-20

AI Technical Summary

Technical Problem

The existing immune checkpoint inhibitors have poor therapeutic effects in prostate cancer, mainly due to the presence of immunosuppressive cells such as MDSCs and Tregs in the tumor microenvironment, which leads to inhibition of T cell function and making it difficult to effectively identify and eliminate cancer cells.

Method used

By detecting and inhibiting the expression of tRF-16, using the nucleotide sequence of tRF-16 as shown in SEQ ID NO.1, kits and drugs are developed to predict the prognosis of prostate cancer patients and to jointly enhance the efficacy of immunotherapy, especially in combination with PD-1 monoclonal antibody treatment.

Benefits of technology

It significantly improves the effect of immunotherapy, inhibits the growth of prostate cancer, improves the prognosis of patients, especially by knocking down tRF-16 to promote the killing effect of the immune system on prostate cancer, and enhances the therapeutic effect of PD-1 monoclonal antibody.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120330197A_ABST
    Figure CN120330197A_ABST
Patent Text Reader

Abstract

The invention discloses tRF related to prostatic cancer and application of the tRF, and belongs to the field of biological medicine. The tRF related to the prostate cancer, namely tRF-16, is obtained through screening, and the nucleotide sequence of the tRF is as shown in SEQ ID NO. 1. By detecting the expression quantity of the tRF, the prognosis condition of the prostate cancer can be determined, meanwhile, the expression of the tRF is inhibited, the effects of enhancing the immunotherapy curative effect and treating the prostate cancer can be achieved, and the tRF provides a solid theoretical basis and an experimental basis for comprehensive treatment of the prostate cancer.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to a tRF related to prostate cancer and its application. Background Art

[0002] Immune checkpoint inhibitors (ICIs), such as PD-1 / PD-L1 inhibitors, have shown significant effects in various cancers, but their effects in prostate cancer are relatively poor. The tumor microenvironment of castration-resistant prostate cancer often has immunosuppressive characteristics, resulting in the inhibition of the functions of effector immune cells such as T cells and NK cells, making it difficult for cancer cells to be effectively recognized and eliminated by the immune system. Studies have found that the low mutation burden of prostate cancer tumors and the "cold" tumor microenvironment (i.e., lack of immune cell infiltration) are the main reasons for the poor efficacy of immunotherapy. There are a large number of immunosuppressive cells in the cold tumor microenvironment, such as myeloid-derived suppressor cells (MDSCs) and regulatory T cells (Tregs). These cells secrete immunosuppressive factors that inhibit the functions of effector T cells and NK cells, resulting in insufficient immune responses. MDSCs and Tregs can also weaken the anti-tumor immune response through direct cell contact or secretion of inhibitory cytokines (such as TGF-β, IL-10). Analyzing the molecular mechanism of prostate cancer immune escape and developing new therapeutic targets to improve the treatment response rate of ICIs are crucial for improving the prognosis of prostate cancer patients.

[0003] tRNA-derived small RNAs (tRFs) are a class of multifunctional small RNAs with a length of about 14-30 nt, which play important roles in the occurrence, development, and drug resistance of tumors. The generation process of tRFs is highly conserved and is generated by cleavage of tRNA precursors or mature forms under the action of endonucleases. tRFs derived from mature tRNAs are divided into three categories according to the cleavage position: 5'-tRF, 3'-tRF, and i-tRF. The function of tRFs is closely related to their subcellular localization. There are two modes of action: base complementary pairing and RNA-binding protein-dependent mode of action. In recent years, many studies have shown that tRFs also play important roles in the regulation of the tumor immune microenvironment. Hoen et al. found through deep sequencing that 5'-tRF is significantly enriched in immune cell vesicles and secreted into the microenvironment, serving as an immune signaling molecule to be transmitted extracellularly to regulate immune responses. The research by Chiou et al. showed that T cells selectively excrete tRFs that inhibit their activation through vesicles, thereby maintaining the activation state of T cells and cytokine production. However, the research on tRFs in tumor immune regulation is still in its infancy, and there is no relevant report on its regulation of the prostate cancer immune microenvironment. Summary of the Invention

[0004] The object of the present invention is to provide a tRF related to prostate cancer and its applications, so as to solve the problems existing in the above-mentioned prior art. By detecting the expression level of the tRF, the prognosis of prostate cancer can be clarified. At the same time, by inhibiting the expression of the tRF, the efficacy of immunotherapy can be enhanced and prostate cancer can be treated, providing a solid theoretical basis and experimental foundation for the comprehensive treatment of prostate cancer.

[0005] To achieve the above object, the present invention provides the following solutions:

[0006] The present invention provides a tRF related to prostate cancer, the tRF is tRF-16, and the nucleotide sequence of the tRF-16 is shown in SEQ ID NO.1.

[0007] The present invention also provides the application of a reagent for detecting the expression level of the tRF in the preparation of a kit for predicting the prognosis of prostate cancer patients.

[0008] Preferably, the higher the expression level of the tRF, the worse the prognosis of prostate cancer patients.

[0009] The present invention also provides the application of an inhibitor for inhibiting the expression of the tRF in the preparation of a drug for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer. The tRF is tRF-16, and the nucleotide sequence of the tRF-16 is shown in SEQ ID NO.1.

[0010] Preferably, the inhibitor includes the reverse complementary sequence of the sequence shown in SEQ ID NO.1, and the immunotherapy is PD-1 monoclonal antibody therapy.

[0011] The present invention also provides a kit for predicting the prognosis of prostate cancer patients, including a reagent for detecting the expression level of the tRF.

[0012] The present invention also provides a drug for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer, and the drug is a drug for inhibiting the expression of the tRF.

[0013] The present invention discloses the following technical effects:

[0014] The present invention provides a tRF-16 molecular target that can be used for prognostic evaluation of prostate cancer patients and immunotherapy sensitization.

[0015] The present invention discovers through experiments that the correlation between the significantly highly expressed tRF-16 in the anti-PD-1 treatment non-responsive group and the progression-free survival is the most significant, and the higher the expression level, the shorter the progression-free survival of the patient. The expression of tRF-16 in tumor tissues is significantly higher than that in adjacent normal tissues, the expression level of advanced patients is significantly higher than that of early-stage patients, and the higher the expression level, the shorter the overall survival of the patient and the worse the prognosis. These characteristics indicate that tRF-16 can be used as one of the important indicators for judging the clinical outcome of prostate cancer patients.

[0016] The in-vivo experimental research of the present invention discovers the immune escape of prostate cancer and inhibits the therapeutic effect of anti-PD-1 monoclonal antibody. Knockdown of tRF-16 significantly inhibits the growth rate of transplanted tumors in immunocompetent mice (Balb / c mice), but does not affect the growth of transplanted tumors in immunodeficient mice (Nude mice). Further treatment with anti-PD-1 monoclonal antibody was given to immunocompetent tumor-bearing mice, and it was found that knockdown of tRF-16 made the inhibitory effect of anti-PD-1 monoclonal antibody on tumor growth more significant. It is suggested that knockdown of tRF-16 can promote the killing effect of the immune system on prostate cancer and synergistically enhance the therapeutic effect of anti-PD-1 monoclonal antibody. The results of single-cell sequencing combined with flow cytometry detection suggest that tRF-16 promotes the chemotaxis and infiltration of Treg cells in tumors. Brief Description of the Drawings

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0018] Figure 1 To screen tRFs related to prostate cancer; A: CD8 in prostate cancer tissues + T cell exhaustion regions relative to up / down-regulated tRFs in non-exhausted regions; B: Analysis of the correlation between differentially expressed tRFs and the survival of patients with TCGA prostate cancer; C: Verification of the correlation between 10 tRFs and patient survival in the prostate cancer cohort of Qilu Hospital of Shandong University; D: Analysis of the correlation between the expression level of tRF-16 and the overall survival of prostate cancer patients; E: Analysis of the correlation between the expression level of tRF-16 and the progression-free survival of prostate cancer patients; F: Analysis of the difference in the expression level of tRF-16 between prostate cancer and adjacent tissues; G: Analysis of the difference in the expression level of tRF-16 in cancer tissues of patients at different stages;

[0019] Figure 2To investigate the effect of tRF-16 on the prostate cancer microenvironment; A: Growth curve of subcutaneous xenografts of RM-1 cells in Balb / c nude mice; B: Growth curve of subcutaneous xenografts of RM-1 cells in C57BL / 6N mice;

[0020] Figure 3 Results for investigating the specific immune cell types regulated by tRF-16 in the prostate cancer tumor microenvironment;

[0021] Figure 4 Results of the molecular mechanism study on tRF-16 promoting Treg cell infiltration; A: tRF-16 pulldown to verify the binding of tRF-16 to DDX5; B: Alter the expression of tRF-16 and detect changes in the stability of DDX5 protein; C: Alter the expression of tRF-16 and detect the ubiquitination level of DDX5 protein by IP experiment;

[0022] Figure 5 Regarding the effect of tRF-16 on chemokine expression, Treg cells, and CD8 + T cell numbers; A: Flow chart of the experiment to verify whether DDX5 participates in the regulation of gene transcription as a transcriptional cofactor; B: Knockdown tRF-16 and DDX5 in prostate cancer cells respectively and perform RNAseq to determine the downregulated candidate differential genes; C: Flow chart of the experiment to verify whether tRF-16 affects the chemotaxis of Treg cells; D: Alter the expression of tRF-16 in prostate cancer cells and detect the chemotaxis of the culture supernatant to Treg cells; E: Treg and CD8 + T cells are co-cultured at different ratios, and the proliferation ability of CD8 + T cells is detected; F: Treg and CD8 + T cells are co-cultured at different ratios, and the production of IFN-γ is detected. Detailed implementation mode

[0023] Now, various exemplary implementation modes of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0024] It should be understood that the terms described in the present invention are only for describing specific implementation modes and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0025] Unless otherwise noted, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention has been described only with respect to preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to those documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0026] Without departing from the scope or spirit of the present invention, various modifications and variations to the specific embodiments of the description of the present invention will be apparent to those skilled in the art. Other embodiments derived from the description of the present invention will be apparent to those skilled in the art. The description of the present invention and the examples are merely exemplary.

[0027] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0028] Example 1

[0029] Tissue samples of 41 prostate cancer patients who received anti-PD-1 treatment at Qilu Hospital of Shandong University were collected (treatment response group CR / PR, n = 11; treatment non-response group SD / PD, n = 30), and tRF&tiRNA sequencing was performed on them. This part of the work was completed by the sequencing company, Shupu Biotechnology.

[0030] A large amount of previous immunohistochemical data showed that within the tumor of the same prostate cancer patient, CD8 + T cell exhaustion regions (mainly CD8 + PD-1 + T cells) and CD8 + T cell non-exhaustion regions (mainly CD8 + PD-1 - T cells) often coexisted. To find tRFs that can affect the efficacy of ICIs in prostate cancer, the applicant separately circled the CD8 + T cell exhaustion region and the CD8 + T cell non-exhaustion region, and collected the target region tissues by LCM capture, extracted RNA for tRF PCR Array detection. This experiment used the nrStar™ tRF&tiRNA PCR chip kit (Shupu Biotechnology) and was detected according to the instructions.

[0031] The results showed that compared with the CD8 + T cell non-exhaustion region, the CD8 +There were 30 tRFs significantly up-regulated and 8 tRFs significantly down-regulated in the tissue of the T cell exhaustion region, as shown in Figure 1 Figure A. Correlation analysis was performed between these significantly different tRFs and the survival of prostate cancer patients in the TCGA database, and 10 tRFs were significantly correlated (see Figure 1 Figure B). In the validation of a prostate cancer cohort of 100 patients from Qilu Hospital of Shandong University, only tRF-16-RP9830D (abbreviated as tRF-16) was significantly correlated with the survival of prostate cancer patients, and the overall survival and progression-free survival of patients with high expression of tRF-16 were shorter (see Figure 1 Figures C-E). The above results indicate that tRF-16 is significantly correlated with the prognosis of prostate cancer patients.

[0032] The expression of tRF-16 in tissue samples was detected by qRT-PCR. The specific steps were as follows: Total RNA of prostate cancer tissues from 41 patients was extracted and qPCR amplification was performed. The upstream primer was as shown in SEQ ID NO.2, and the specific sequence was 5’-CGCGCGGGTAGTGTGG-3’; the downstream primer was as shown in SEQ ID NO.3, and the specific sequence was 5’-AGTGCAGGGTCCGAGGTATT-3’. The upstream primer and downstream primer were designed and synthesized by Shanghai GenePharma Co., Ltd. The total system of qPCR was a 10 μL system: 5 μL of 2×SYBR Green Pro Taq Premix, 1 μL of cDNA, 0.2 μL of upstream primer, 0.2 μL of downstream primer, and 3.6 μL of enzyme-free and sterile water; The two-step qPCR amplification program: 95℃ for 30 sec; 95℃ for 5 sec, 60℃ for 30 sec, with 40 cycles.

[0033] The results showed that the expression level of tRF-16 in adjacent tissues was significantly lower than that in cancer tissues; the expression level in tissues of advanced patients (stage III / IV) was significantly higher than that in early patients (stage I / II), as shown in Figure 1 Figures F-G. The nucleotide sequence of tRF-16 was as shown in SEQ ID NO.1, specifically 5’-GGTAGTGTGGCCGAGC-3’.

[0034] Example 2

[0035] In vivo experiments found that tRF-16 did not affect the growth of xenograft tumors in nude mice. It was speculated that it might indirectly affect the tumor microenvironment. In vivo experiments were conducted to study the effect of tRF-16 on the prostate cancer microenvironment. The specific operations were as follows:

[0036] The methods for constructing stable cell lines with overexpression and knockdown of tRF-16 are as follows: The random control sequence, the sense strand sequence of tRF-16, and the antisense strand sequence of tRF-16 (the reverse complementary sequence of the sequence shown in SEQ ID NO.1) were respectively cloned into the lentiviral plasmid vector pLent-U6-shRNA-CMV-luciferase-P2A-puro vector to construct recombinant vectors. The recombinant vectors and the lentiviral packaging plasmids were co-transfected into 293T cells to prepare lentiviruses. The lentiviral particles were collected and used to infect RM-1 cells, and then RM-1 cells transfected with empty vectors, RM-1 cells with stable overexpression of tRF-16, or RM-1 cells with stable knockdown of tRF-16 were obtained through resistance screening.

[0037] Subcutaneous xenograft tumor models of RM-1 (mouse-derived cells) were constructed in Balb / c nude mice and C57BL / 6N mice respectively to investigate the effect of tRF-16 on tumor growth. 1×10 6 RM-1 cells (RM-1 cells transfected with empty vectors, RM-1 cells with stable overexpression of tRF-16, or RM-1 cells with stable knockdown of tRF-16) were inoculated subcutaneously on the back of mice to construct subcutaneous xenograft tumor models of mice. Vernier calipers were used to detect the tumor volume, and the growth rates of tumor masses in each group were compared. The measurement time was the 1st week, 2nd week, and 3rd week after modeling, and RM-1 cells transfected with empty vectors were used as the control group.

[0038] The results are as Figure 2 shown. The results of the Balb / c nude mouse model showed that there was no significant difference in the growth rate of xenograft tumors between the tRF-16 knockdown group and the control group (see A in Figure 2 ); while the results of the C57BL / 6N mouse model showed that, compared with the control group, the growth rate of xenograft tumors in the tRF-16 knockdown group was significantly slower (see B in Figure 2 ), suggesting that during the malignant progression of prostate cancer, compared with the promoting proliferation effect on tumor cells themselves, the inhibitory effect of tRF-16 on the tumor immune microenvironment may play a more important role.

[0039] Example 3

[0040] To explore the specific immune cell types regulated by tRF-16 in the tumor microenvironment of prostate cancer, C57BL / 6N mouse subcutaneous xenograft tumor models were constructed using control / stable tRF-16 knockdown RM-1 cell lines respectively. The tumor tissues were dissociated for single-cell sequencing. Bioinformatics analysis found that the proportion of Treg cells in the tRF-16 knockdown group decreased significantly (see Figure 3 ).

[0041] To verify the results of single-cell sequencing, RM-1 cell lines with stable overexpression / knockdown of tRF-16 were used to construct a subcutaneous xenograft tumor model in C57BL / 6N mice. The tumor tissues were dissociated and flow cytometry was performed to detect the infiltration of Treg cells in the subcutaneous xenograft tumors of RM-1 cells in C57BL / 6N mice. Analysis revealed that there was more infiltration of Treg cells in the tumors of the tRF-16 overexpression group; conversely, knockdown of tRF-16 yielded the opposite result, as shown in Figure 3 .

[0042] The above results suggest that tRF-16 induces an increase in the infiltration of Treg cells in prostate cancer tissues.

[0043] Example 4

[0044] To further explore the molecular mechanism by which tRF-16 promotes the infiltration of Treg cells, RNA pulldown combined with proteomics (experimental methods refer to "Inflammatory cytokine-regulated tRNA-derived fragment tRF-21 suppresses pancreatic ductal adenocarcinoma progression", PMID: 34779408) was used to identify that DDX5 might bind to tRF-16. The specific operations are as follows: In this experiment, protein lysates of prostate cancer cells DU-145 and PC-3 were collected and incubated with biotin-labeled tRF-16 sense sequence or antisense complementary sequence probes for in vitro binding detection. A non-target sequence was used as a negative control (UUGUACUACACAAAAGUACUG, SEQ ID NO.4).

[0045] The results were as Figure 4 shown. When tRF-16 was overexpressed / knocked down, the mRNA level of DDX5 did not change, but the protein level was significantly upregulated / downregulated, suggesting that the binding of tRF-16 to DDX5 might affect its post-translational modification process. Further research found that when tRF-16 was knocked down, the protein stability of DDX5 decreased significantly. The results of in vitro IP experiments showed that when tRF-16 was overexpressed, the ubiquitination level of DDX5 decreased significantly; conversely, when tRF-16 was knocked down, the result was opposite, suggesting that tRF-16 can inhibit the ubiquitination and degradation of DDX5.

[0046] The above results indicate that tRF-16 binds to DDX5 and inhibits its ubiquitination and degradation.

[0047] Example 5

[0048] As a transcriptional cofactor, DDX5 can participate in the regulation of gene transcription. To search for downstream effector genes that are simultaneously regulated by tRF-16 and DDX5, prostate cancer cells from the control group (DU-145), tRF-16 KD (tRF-16 knockdown), and DDX5 KD (DDX5 knockdown) were collected for RNA-seq. Among them, the method for constructing DDX5 KD prostate cancer cells was referred to Example 2, and the siRNA sequence for knocking out DDX5 was GCUCUAAGUGGAUUGGAUATT (SEQ ID NO.5). The experimental flow chart is shown in Figure 5 A in

[0049] As shown in Figure 5 B, the results of bioinformatics analysis showed that both tRF-16 KD and DDX5 KD could down-regulate the expression of key genes in the chemokine signaling pathway. Among the 19 key genes co-down-regulated by tRF-16 KD and DDX5 KD, CCL22, CCL28, and CXCL12 are known Treg cell chemokines, but which chemokine expression is regulated by tRF-16 and DDX5 and the specific regulatory mechanism remain to be further studied.

[0050] To verify whether tRF-16 affects Treg cell chemotaxis, the culture supernatants of prostate cancer cells from the control group, tRF-16 OE (tRF-16 overexpression), and tRF-16 KD (tRF-16 knockdown) were collected (the flow chart is shown in Figure 5 C) and placed in the lower chamber of a transwell. Peripheral blood mononuclear cells (PBMCs) were isolated from human whole blood and placed in the upper chamber. After 6 hours, the cells that migrated from the upper chamber were collected for flow cytometry analysis. As shown in Figure 5 D, the results showed that more Treg cells migrated in the tRF-16 OE group, while fewer migrated in the tRF-16 KD group, suggesting that tRF-16 may recruit Treg cells by regulating chemokine expression. Subsequently, Treg cells and CD8 + T cells were co-cultured at different cell number ratios (0:1, 1:8, 1:4, 1:2, 1:1), and the proliferation ability of CD8 + T cells and the production of IFN-γ were detected. As shown in Figure 5 E-F, the results showed that Treg cells inhibited the proliferation of CD8 + T cells and the production of IFN-γ in a concentration-dependent manner.

[0051] The above results indicate that tRF-16 regulates chemokine expression, recruits Treg cells, and inhibits the proliferation of CD8 + T cells.

[0052] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A tRF related to prostate cancer, characterized in that, The tRF is tRF-16, and the nucleotide sequence of tRF-16 is shown as SEQ ID NO.

1.

2. Use of a reagent for detecting the expression level of the tRF described in claim 1 in the preparation of a kit for predicting the prognosis of prostate cancer patients.

3. The application according to claim 2, characterized in that, The higher the expression level of the tRF, the worse the prognosis of prostate cancer patients.

4. Use of an inhibitor that inhibits tRF expression in the preparation of a medicament for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer, characterized in that, The tRF is tRF-16, and the nucleotide sequence of tRF-16 is shown as SEQ ID NO.

1.

5. The application according to claim 4, wherein, The inhibitor includes the reverse complementary sequence of the sequence shown in SEQ ID NO.1, and the immunotherapy is anti-PD-1 monoclonal antibody therapy.

6. A kit for predicting the prognosis of prostate cancer patients, characterized in that, It includes a reagent for detecting the expression level of the tRF described in claim 1.

7. A drug for treating prostate cancer and / or synergistically enhancing the efficacy of immunotherapy for prostate cancer, characterized in that, The drug is a drug that inhibits the expression of the tRF described in claim 1.

Citation Information

Patent Citations

  • Marker tRF-Thr-TGT-4-M2 for detecting prostate cancer through urine and application of marker tRF-Thr-TGT-4-M2

    CN115851729A

  • Glioma prognostic marker tRF-16 and application thereof

    CN116555431A

  • Blood marker for cervical cancer diagnosis and application thereof

    CN120290726A